Name: from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028
Uploaded: 2017-01-13T13:00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

במעבדה זו ספריית cosmid הגנומי של diastatochromogenes Streptomyces נוצרה והוקרנה לפני שנים רבות, וכתוצאה מכך ההזדהות של אשכול גני polyketomycin באמצעות תהליך זמן רב מאוד. אפיון של גנים בודדים היו אפשרי באמצעות מחיקות גן ממוקדות וניתוח של מוטציות וכתוצאה מכך 12. לאחרונה, רצף הגנום טיוטת diastatochromogenes ס הושג המאפשר זיהוי מהיר של אשכול גנים biosynthetic polyketomycin. יכולנו לזהות את גני biosynthetic בקלות, למרות רצף הגנום הטיוטה מכיל עדיין contigs רב. התהליך המתואר יכול להיות מושג בתוך חודשים. עם זאת, ההליך מורכב שלבים רבים. צעדים יחידים עלולים להיכשל מספר פעמים, מניעת התקדמות בשלבים הבאים: הסוג Streptomyces ידוע ביכולת שלו לייצר תרכובות ביו. בעוד שהם נושאים לעתים קרובות יותר מ -20 BIOSאשכולות גני ynthetic, בדרך כלל רק אחד או שתיים תרכובות מיוצרות בתנאי מעבדה. היישום של גישת OSMAC (טיפוח זן אחד בתנאים שונים) להתעורר אשכולות גנים שקטים לעתים לא יספיק. מניפולציה גנטית של גנים רגולטוריים, כמו הגנים הרגולטור pleiotropic adpA 44 ו bldA 45,46, הוא גם שיטה יעילה כדי להפעיל את הייצור של מטבוליטים משניים אחרים. לקבלת ההבהרה של המבנה המתחם, למשל על ידי ניתוח NMR, בדרך כלל יותר מ -2 מ&quot;ג של מתחם מטוהר הוא הכרחי. לכן, תסיסה של יותר מ -10 תרבות L נדרשה לעתים קרובות. ללא פרמנטור כי הוא מסוגל לשמור על חמצן, תנאי pH וטמפרטורה, זה יכול להיות מאתגר במעבדה קטנה לטפל סכום זה של תרבות החילוץ הבא. במהלך הטיהור, במתחם ניתן לשנות עקב חמצון, קרינה או טמפרטורה.כמו כן, השלבים לטיהור יותר משמשים, כך עולה הסיכוי של השפלה. כאשר בוחנים את המבנה של המוצר הטבעי, ואת האשכולות בגנום, לפעמים זה לא כל כך קל לזהות את האשכול המתאים. ראשית, אם יש רק רצף הגנום טיוטת חלק של האשכול עלול להיות חסר. שנית, לא כל הגנים אשר נדרשים עבור ביוסינתזה נמצאים באשכול. שלישית, לעתים אשכול מחולק לשני חלקים המופרדים זה מזה על ידי kilobases רב. רביעית, זה עלול להיות קשה להחליט איזה מהם הוא מתאים באשכול הגנים. במקרה של לי סוג PKS גדול או מערכות NRPS, שבו אפשר לחשב את מספר יחידות המאריכות מבוסס על מספר מודולים, או אפילו לזהות את יחידות מאריך היחידות על ידי ניתוח של תחומי הבחירה, זה מייד מתפרסם בקלות. עם זאת, במקרה של איטרטיבית עובד אנזימי התחזית של התרכובות המסונתזות היא לעתים קרובות לא אפשרית, במיוחד אם straיש יותר מ -40 אשכולות גנים. חמישית, הטבע הוא מאוד מורכב ומלא של תרכובות ידועות עדיין. לעתים קרובות ביוסינתזה היא תערובת של מסלולים שונים. אם המתחם החדש הוא לא זיהה עדיין, או שאינו קשור למתחם אחר, זה עלול להיות קשה לזהות את האשכול, להציע מודל ביוסינתזה וכדי להוכיח את זה. לאחר באשכול מזוהה, הטכניקה המוצלבת אחת היא שיטה טובה ומהירה כדי לאמת את ההשערה. PCR, שיבוט לתוך וקטור התאבדות, נטייה, בחירה של שיבוטים חיוביים, assay ייצור הם הצעדים הנדרשים בלבד. אחד החסרונות של שיטה זו הוא כי שילוב של וקטור לתוך הכרומוזום אינו יציב עקב אירועי רקומבינציה נוספת. לכן, כדי להמשיך לנתח גנים בודדים, מחיקות גן מדויקות נדרשות. וכן זה היה יכול להיות מסובך לתמרן זני Streptomyces במישור הגנטי. ניתן להקצות ההליך המתואר to כל תרכובת אחרים המיוצרים על ידי זן Streptomyces או מיקרואורגניזם אחר. הידיעה על באשכול גני biosynthetic המתחם המסונתז שלה נותנת לנו הזדמנויות נוספות לשנות כבר למולקולות קיימות במטרה לשפר אותם במאבק נגד פתוגנים עמידים multidrug.

מוצרים טבעיים מצמחים ומיקרואורגניזמים תמיד היו מקור חשוב לפיתוח קליני של תרופה ומחקר. הפניצילין האנטיביוטי הראשון התגלה בשנת 1928 מפטרייה ידי אלכסנדר פלמינג 1. כיום, רבי מוצרים טבעיים יותר משמשים בטיפול קליני. סוג אחת ידוע ביכולתה לייצר סוגים שונים של מטבוליטים משניים עם bioactivities השונה הוא Streptomyces. Streptomyces הם גראם חיוביים חיידקים שייכים למעמד של Actinobacteria וצו Actinomycetales. כמעט שני שלישים של אנטיביוטיקה בשימוש קליני נגזרות Actinomycetales, בעיקר Streptomyces, כמו amphotericin 2, daptomycin 3 או 4 טטרציקלין. שני פרסי נובל הוענקו בתחום המחקר אנטיביוטי Streptomyces. הראשון הלך זלמן אברהם וקסמן על גילוי סטרפטומיצין, היווצרותו הראשונהtibiotic יעיל נגד שחפת. 5 בשנת 2015, כחלק פרס נובל לפיזיולוגיה ורפואה, גילוי avermectin מ avermitilis ס הוענק גם כן. Avermectin משמש לטיפול במחלות טפיליות 6,7. הגישה המסורתית על הגילוי של מוצרים טבעיים מיקרואורגניזמים כגון Streptomyces בדרך כלל כרוך טיפוח של הזן בתנאי גידול שונה, כמו גם מיצוי וניתוח של מטבוליטים משניים. מבחני פעילות ביולוגיים (מבחנים למשל לפעילות אנטיבקטריאלי נגד סרטן) מבוצעים על מנת לזהות את הפעילות של המתחם. לבסוף, במתחם של עניין מבודד ואת המבנה הכימי הוא הובהר. המבנים של מוצרים טבעיים מורכבים לרוב moieties היחיד אשר יוצרים מולקולות מורכבות. יש כמה, אבל מוגבלים, שבילי biosynthetic גדולים מובילים לבניית גושKS, אשר משמש ביוסינתזה של חומרי טבע. מסלולי biosynthetic העיקריים הם נתיבי polyketide, שבילים מובילים אל terpenoids ו אלקלואידים, מסלולים באמצעות חומצות אמינו, ושבילים מובילים moieties סוכר. מסלול כל מאופיין על ידי קבוצה של אנזימים ספציפיים 8. בהתבסס על המבנה של המתחם, אנזימים biosynthetic אלה ניתן לחזות. כיום, ניתוח המבנים המפורט של תרכובת בשילוב עם רצף הדור הבא וניתוח bioinformatic יכול לעזור לזהות באשכול גני biosynthetic האחראי. מידע האשכול פותח דרכים חדשות למחקר מוצר טבעי נוסף. זה כולל ביטוי Heterologous כדי להגדיל את התשואה של המוצר הטבעי, שינוי במתחם ממוקד על ידי מחיקת הגן או שינוי וביוסינטזה קומבינטורית עם גנים של מסלולים אחרים. Polyketomycin היה מבודד באופן עצמאי מן מרק התרבותשני זנים, sp Streptomyces. MK277-AF1 9 ו Streptomyces diastatochromogenes Tü6028 10. המבנה הוברר על ידי ניתוח NMR ו- X-ray. Polyketomycin מורכב decaketid tetracyclic וכן חומצה סליצילית דימתיל, מקושרים על ידי שני moieties deoxysugar β-D-amicetose ו α-L-axenose. הוא מציג ציטוטוקסיות פעילות אנטיביוטית, אפילו כנגד זנים עמידים multidrug גראם חיוביים כגון MRSA 11. ספריית cosmid הגנומי של Tü6028 diastatochromogenes ס נוצרה והוקרנה לפני שנים רבות. באמצעות גן ספציפי בדיקות באשכול גני polyketomycin עם גודל של 52.2 kb, המכיל 41 גנים, זוהה לאחר מספר חודשים של עבודה אינטנסיבית 12. לאחרונה, רצף הגנום טיוטת diastatochromogenes ס הושג מוביל לזיהוי המהיר של אשכול גני biosynthetic polyketomycin. בסקירה זו, שיטה עוזרת iDENתצדיק מוצר טבעי להבהיר באשכול גני biosynthetic שלה יתואר, באמצעות polyketomycin כדוגמא. נסביר את הצעדים יחידים אשר להוביל ממוצר טבעי באשכול גני biosynthetic שבו, המופיע על polyketomycin המיוצר על ידי Streptomyces diastatochromogenes Tü6028. הפרוטוקול כולל זיהוי וטיהור מוצר טבעי עם תכונות אנטיביוטיות. ניתוח והשוואה מבניים נוספים עם תוצאות החל להוביל כרייה הגנום לזיהוי באשכול גני biosynthetic. הליך זה יכול להיות מיושם על כל מתחם אחר שמקורו בזן Streptomyces או כל מיקרואורגניזם אחר.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

זני Streptomyces ידועים היכולת שלהם לייצר הרבה תרכובות שונות עם bioactivities השונה. טיפוח בתנאים שונים לעתים קרובות מוביל לייצור תרכובות חדשות. לכן, תרבויות הייצור של זנים המחולצים עם אתיל אצטט ואת תמציות גולמי מנותחים על ידי HPLC. יתר על כן, תמציות נבדקי הפעילות הביולוגית שלהם על ידי מבחנים שונים. לקבלת הבהרת מבנה במתחם העניין מטוהר על ידי שילוב של שיטות כרומטוגרפיה שונות. הגנום רצף בשילוב עם כריית הגנום מאפשר זיהוי של אשכול גני biosynthetic מוצר טבעי באמצעות תוכנות מחשב שונות. כדי לאשר כי באשכול הגנים הנכון זוהה, ניסויי איון גן צריכות להתבצע. המוטציות כתוצאה מנותחות לייצור המוצר הטבעי בפרט. לאחר באשכול הגן התקין כבר מומת, אתזן ייכשל כדי לייצר את המתחם. זרימת העבודה מוצגת עבור polyketomycin מתחם אנטיבקטריאלי המיוצר על ידי Streptomyces diastatochromogenes Tü6028. לפני כעשר שנים, כאשר רצף הגנום היה עדיין מאוד יקר, השיבוט וזיהוי אשכול גנים היה זמן רב בתהליך מאוד. רצף הגנום מהיר בשילוב עם כריית הגנום מאיץ את משפטו של זיהוי אשכול ופותח דרכים חדשות לחקור ביוסינתזה לייצר מוצרים טבעיים רומן מאת בשיטות גנטיות. הפרוטוקול המתואר במאמר זה ניתן להקצות כל תרכובת אחרת שמקורו בזן Streptomyces או מיקרואורגניזם אחר.

בסקירה זו נתאר את הצעדים היחידים מהזדהות של אנטיביוטיקה המובילה באשכול גני biosynthetic שלה. לפני שנים רבות אנו משובטים ספריית cosmid, ארוזה אותם פאגים, transduced תאי מארחי E. coli, והיה צריך להקרין אלף מושבות לזהות שיבוטים שיש אזורים חופפים של אשכול polyketomycin. רצף של cosmids גם היה תהליך קשה ויקר 12. על מנת לערוך מחקרים נוספים על זן אנו רצף הגנום כולו של Streptomyces diastatochromogenes Tü6028. עם רצף הגנום הטיוטה זיהינו בקלות באשכול גני biosynthetic של polyketomycin ואשכולות אחרים קידוד תרכובות מבטיחות. איור 7 משווה את השיטה &quot;הישנה&quot; של זיהוי אשכול biosynthetic ידי שיבוט של ספריה cosmid והקרנת elaborative, ושיטת ה &quot;חדשה&quot; על ידי רצף הגנום כולו עם כריית הגנום הבאה בסולם תקופה קשה. טכנולוגיות הרצף החדשות ותוכניות כרייה הגנום חדשות להאיץ את התהליך כולו. <img alt="איור 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> איור 7: השוואה בין &quot;היהודי הישן&quot; ו &quot;חדש&quot; שיטה של הקצאת biosynthetic ג&#39;ין אשכול. השיטה &quot;הישנה&quot; כוללת שיבוט של ספריית cosmid עם מבחר של שיבוטים חיוביים רצף של cosmid בהתאמה (ים) (לעיל); השיטה &quot;החדשה&quot; כוללת רצף הגנום כולו -mining לזהות כל אשכולות גנים המטבוליט משנה הפרושות על הגנום של זן (להלן). משך צעדים יחידים מוצג על ציר זמן מחוספס. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÆ’Ã†'Ãƒâ€šÃ‚Â¼6028

כאן אנו מציגים פרוטוקול מפורט של (א) זיהוי של מוצר טבעי עם פעילות אנטיביוטית, (B) הטיהור של המתחם, (ג) את הדגם הראשון של ביוסינתזה שלה, (ד) הגנום רצף / -mining ואת ( E) אימות של אשכול גני biosynthetic.

ממוצר טבעי כדי המצרר שלו biosynthetic ג&#39;ין: הפגנה שימוש Polyketomycin מ<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Research

JoVE Journal

Genetics

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

באמצעות TMEM184A GFP-tagged לבנות לתעודה המעידה על הפרין קולטן זהות

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

הכנת הדוגמא וניתוח של נתונים ביטוי גנים מבוססת RNASeq דג זברה

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

מתודולוגיה סטנדרטי כדי לבדוק באתר המוטגניות כפונקציה של תיקון נקודת מוטציה על ידי CRISPR/Cas9 ו- SsODN בתאי אדם

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

מהדור ג'ין-שיבשו סטרפטוקוקוס mutans זן בלי ג'ין שיבוט

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

ייצור יעיל והסתרות שנוצרו על-ידי זיהוי של CRISPR/Cas9 ג'ין, מערכת מודל רזבורה rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

לחקור את השורש Microbiome: שליפת נתונים הקהילה חיידקי מן האדמה, Rhizosphere, Endosphere שורש

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

Informatic ניתוח של נתוני רצף אצווה שמרים 2-היברידית המסכים

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

זיהוי תפוקה גבוהה של ג'ין רצפים תקינה באמצעות רצף הדור הבא של כרומוזום מעגלי קונפורמציה ללכוד (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

In vivo היישום של מערכת שליטה מרחוק עבור הביטוי מניפולציה של ג'ין אנדוגני

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

ניתוחים פרוטאומיקס מבוססי ספקטרומטר מסה משימוש במסד הנתונים OpenProt לחשוף את הרומן חלבונים מתורגם ממסגרות קאנונית קריאה פתוחה

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...