Name: from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028
Uploaded: 2017-01-13T13:00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

इस प्रयोगशाला में Streptomyces diastatochromogenes की एक जीनोमिक cosmid पुस्तकालय उत्पन्न होता है और कई साल पहले जांच की, एक बहुत समय लेने वाली प्रक्रिया के माध्यम से polyketomycin जीन क्लस्टर की पहचान में जिसके परिणामस्वरूप था। एकल जीन की विशेषता लक्षित जीन विलोपन और जिसके परिणामस्वरूप म्यूटेंट 12 के विश्लेषण का उपयोग संभव हो गया है। हाल ही में, एस diastatochromogenes का एक मसौदा जीनोम अनुक्रम polyketomycin biosynthetic जीन क्लस्टर की तेजी से पहचान की अनुमति प्राप्त हुई थी। हम आसानी से biosynthetic जीन का पता लगा सकता है, हालांकि मसौदा जीनोम अनुक्रम अभी भी कई contigs शामिल हैं। वर्णित प्रक्रिया महीने के भीतर प्राप्त किया जा सकता है। हालांकि, प्रक्रिया में कई कदम शामिल हैं। एकल कदम कई बार विफल हो सकता है, बाद के चरणों को बढ़ने से रोकने: जीनस Streptomyces अपनी क्षमता बायोएक्टिव यौगिकों का निर्माण करने के लिए जाना जाता है। वे अक्सर अधिक से अधिक 20 BIOS ले, जबकिynthetic जीन समूहों, आमतौर पर केवल एक या दो यौगिकों प्रयोगशाला परिस्थितियों में उत्पादित कर रहे हैं। OSMAC दृष्टिकोण (अलग अलग परिस्थितियों में एक तनाव की खेती) चुप जीन समूहों को जागृत करने के आवेदन कभी कभी पर्याप्त नहीं हो सकता। ऐसे pleiotropic नियामक जीन adpA 44 और bldA 45,46 के रूप में नियामक जीन, के आनुवंशिक हेरफेर, यह भी अन्य माध्यमिक चयापचयों के उत्पादन को सक्रिय करने के लिए एक प्रभावी तरीका है। परिसर की संरचना की व्याख्या, एनएमआर विश्लेषण द्वारा उदाहरण के लिए, आम तौर पर शुद्ध परिसर के अधिक से अधिक 2 मिलीग्राम आवश्यक है। इसलिए, 10 से अधिक एल संस्कृति के किण्वन अक्सर आवश्यक है। एक किण्वक है कि ऑक्सीजन, पीएच और तापमान की स्थिति बनाए रखने में सक्षम है बिना, यह एक छोटी सी प्रयोगशाला संस्कृति और बाद निकासी की इस राशि को संभालने के लिए चुनौतीपूर्ण हो सकता है। शुद्धि के दौरान, यौगिक ऑक्सीकरण, विकिरण या तापमान के कारण बदला जा सकता है।इसके अलावा, अधिक शुद्धि चरणों इस्तेमाल कर रहे हैं, उच्च गिरावट की संभावना। जब प्राकृतिक उत्पाद की संरचना और जीनोम में समूहों का विश्लेषण करने, कभी कभी यह है कि उचित क्लस्टर की पहचान करने के लिए आसान नहीं है। सबसे पहले, अगर वहाँ केवल एक मसौदा जीनोम अनुक्रम क्लस्टर का कुछ हिस्सा लापता हो सकता है। दूसरे, नहीं तो सब जीन जो जैव संश्लेषण के लिए आवश्यक हैं क्लस्टर में हैं। तीसरा, कभी कभी एक क्लस्टर कई kilobases द्वारा एक दूसरे से अलग दो भागों में विभाजित है। चौथे, यह जो एक उचित जीन क्लस्टर है तय करना मुश्किल हो सकता है। बड़े पीकेएस प्रकार मैं या NRPS प्रणाली, जहां यह मॉड्यूल की संख्या के आधार पर भरनेवाला इकाइयों की संख्या की गणना, या यहां तक ​​कि चयन डोमेन के विश्लेषण द्वारा एकल भरनेवाला इकाइयों की पहचान करने के लिए संभव है के मामले में, यह आसानी से बदल जाता है। हालांकि, iteratively काम करने के मामले में एंजाइमों संश्लेषित यौगिकों की भविष्यवाणी अक्सर संभव नहीं है, विशेष रूप से रणनीति यदिमें 40 से अधिक जीन समूहों है। पांचवें क्रम में, प्रकृति अत्यधिक जटिल और अभी तक अज्ञात यौगिकों से भरा है। अक्सर जैवसंश्लेषण अलग रास्ते का एक मिश्रण है। नया परिसर अभी तक पहचान नहीं है, तो या नहीं एक और परिसर से संबंधित है, यह क्लस्टर की पहचान करने के लिए, एक जैवसंश्लेषण मॉडल का प्रस्ताव करने के लिए है और यह साबित करने के लिए मुश्किल हो सकता है। एक बार क्लस्टर की पहचान की है, एकल विदेशी तकनीक परिकल्पना सत्यापित करने के लिए एक अच्छा और त्वरित तरीका है। पीसीआर, एक आत्मघाती वेक्टर, विकार, सकारात्मक क्लोन के चयन, और उत्पादन परख में क्लोनिंग केवल आवश्यक कदम उठाए हैं। इस तकनीक का एक नुकसान यह है कि गुणसूत्र में वेक्टर के एकीकरण के आगे पुनर्संयोजन घटनाओं के कारण स्थिर नहीं है। इसलिए, ताकि आगे की एकल जीन का विश्लेषण करने के लिए, सटीक जीन विलोपन के लिए आवश्यक हैं। इसके अलावा यह आनुवंशिक स्तर पर Streptomyces उपभेदों हेरफेर करने के लिए मुश्किल हो सकता है। वर्णित प्रक्रिया टी सौंपा जा सकता हैओ किसी अन्य यौगिक एक Streptomyces तनाव या अन्य सूक्ष्मजीव द्वारा उत्पादन किया। एक biosynthetic जीन क्लस्टर और उसके संश्लेषित परिसर के बारे में ज्ञान हमें बहुऔषध प्रतिरोधी रोगजनकों के खिलाफ लड़ाई के लिए उन्हें सुधार लाने के उद्देश्य के साथ पहले से ही विद्यमान अणुओं को संशोधित करने के लिए आगे अवसर देता है।

पौधों और सूक्ष्मजीवों से प्राकृतिक उत्पादों को हमेशा नैदानिक ​​दवा के विकास और अनुसंधान के लिए एक महत्वपूर्ण स्रोत रहा है। पहली एंटीबायोटिक पेनिसिलिन अलेक्जेंडर फ्लेमिंग 1 से एक कवक से 1928 में खोज की थी। आजकल, कई और अधिक प्राकृतिक उत्पादों चिकित्सीय उपचार में किया जाता है। एक जीनस अलग bioactivities के साथ माध्यमिक चयापचयों के विभिन्न प्रकार के निर्माण की अपनी क्षमता के लिए जाना जाता Streptomyces है। Streptomyces ग्राम पॉजिटिव बैक्टीरिया होते हैं और Actinobacteria के वर्ग और व्यवस्था Actinomycetales के हैं। चिकित्सकीय इस्तेमाल किया एंटीबायोटिक दवाओं के लगभग दो-तिहाई, Actinomycetales से निकाली गई है, मुख्य रूप से Streptomyces, amphotericin 2 की तरह, 3 या 4 टेट्रासाइक्लिन daptomycin। दो नोबेल पुरस्कार Streptomyces एंटीबायोटिक अनुसंधान के क्षेत्र में सम्मानित किया गया है। पहले एक स्ट्रेप्टोमाइसिन की खोज, पहली बार एक के लिए Selman Waksman के पास गयाtibiotic तपेदिक के खिलाफ प्रभावी है। 5 2015 में, शरीर विज्ञान और चिकित्सा में नोबेल पुरस्कार के हिस्से के रूप में, एस avermitilis से avermectin की खोज के साथ ही प्रदान किया गया। Avermectin परजीवी रोगों 6.7 के इलाज के लिए प्रयोग किया जाता है। ऐसे Streptomyces के रूप में सूक्ष्मजीवों में प्राकृतिक उत्पादों की खोज के लिए परंपरागत दृष्टिकोण आम तौर पर विभिन्न विकास शर्तों के तहत तनाव के खेती के साथ-साथ निकासी और माध्यमिक चयापचयों का विश्लेषण शामिल है। Bioactivity assays (जीवाणुरोधी और विरोधी गतिविधि के लिए जैसे assays) परिसर की गतिविधि का पता लगाने के लिए प्रदर्शन कर रहे हैं। अंत में, ब्याज की चक्रवृद्धि अलग है और रासायनिक संरचना स्पष्ट है। प्राकृतिक उत्पादों की संरचनाओं अक्सर एकल moieties जो जटिल अणुओं के गठन से बना रहे हैं। वहाँ कुछ है, लेकिन सीमित, प्रमुख biosynthetic रास्ते ब्लॉक के निर्माण के लिए नेतृत्व कर रहे हैंएस, जो प्राकृतिक उत्पादों के biosynthesis के लिए उपयोग किया जाता है। प्रमुख biosynthetic रास्ते polyketide रास्ते, चीनी moieties के लिए अग्रणी terpenoids और alkaloids, रास्ते अमीनो एसिड का उपयोग करने के लिए अग्रणी रास्ते, और रास्ते हैं। प्रत्येक मार्ग विशिष्ट एंजाइमों 8 के एक सेट की विशेषता है। परिसर की संरचना के आधार पर, इन biosynthetic एंजाइमों की भविष्यवाणी की जा सकती है। आजकल, अगली पीढ़ी के अनुक्रमण और bioinformatic विश्लेषण के साथ संयोजन में एक परिसर की विस्तृत संरचनात्मक विश्लेषण जिम्मेदार biosynthetic जीन क्लस्टर की पहचान करने में मदद कर सकते हैं। क्लस्टर जानकारी आगे प्राकृतिक उत्पाद अनुसंधान के लिए नए तरीके को खोलता है। यह जीन विलोपन या परिवर्तन और अन्य रास्ते से जीन के साथ मिश्रित जैवसंश्लेषण द्वारा प्राकृतिक उत्पाद की उपज, लक्षित यौगिक संशोधन बढ़ाने के लिए heterologous अभिव्यक्ति भी शामिल है। Polyketomycin की संस्कृति शोरबा से स्वतंत्र रूप से अलग किया गया थादो उपभेदों, Streptomyces सपा। MK277-AF1 9 और Streptomyces diastatochromogenes Tü6028 10। संरचना एनएमआर और एक्स-रे विश्लेषण से स्पष्ट किया गया था। Polyketomycin एक चतुश्चक्रीय decaketid और एक डाइमिथाइल चिरायता एसिड से बना, β-D-amicetose और α एल axenose दो deoxysugar moieties से जुड़ा हुआ है। यह साइटोटोक्सिक और एंटीबायोटिक गतिविधि प्रदर्शित करता है, यहां तक कि इस तरह के मरसा के रूप में 11 ग्राम पॉजिटिव बहुऔषध प्रतिरोधी उपभेदों के खिलाफ। एस diastatochromogenes Tü6028 के एक जीनोमिक पुस्तकालय cosmid जनित और बहुत साल पहले दिखाई गई। विशिष्ट जीन जांच, 52.2 केबी का एक आकार के साथ polyketomycin जीन क्लस्टर का उपयोग 41 जीन से युक्त, तीव्र काम 12 के कई महीनों के बाद पहचान की थी। हाल ही में, एस diastatochromogenes का एक मसौदा जीनोम अनुक्रम polyketomycin biosynthetic जीन क्लस्टर की तेजी से पहचान करने के लिए अग्रणी प्राप्त हुई थी। इस अवलोकन में, एक विधि IDEN करने के लिए मददएक प्राकृतिक उत्पाद tify और स्पष्ट इसकी biosynthetic जीन क्लस्टर वर्णित किया जाएगा, polyketomycin एक उदाहरण के रूप में इस्तेमाल करते हैं। यहाँ हम एक कदम है जो Streptomyces diastatochromogenes Tü6028 द्वारा उत्पादित polyketomycin के लिए दिखाया इसकी biosynthetic जीन क्लस्टर के लिए एक प्राकृतिक उत्पाद से नेतृत्व समझाओ। प्रोटोकॉल पहचान और एंटीबायोटिक गुणों के साथ एक प्राकृतिक उत्पाद की शुद्धि शामिल हैं। आगे संरचनात्मक विश्लेषण और biosynthetic जीन क्लस्टर की पहचान के लिए जीनोम खनन नेतृत्व से परिणामों के साथ तुलना। यह प्रक्रिया एक Streptomyces तनाव या किसी अन्य सूक्ष्मजीव से निकाली गई किसी भी अन्य यौगिक के लिए लागू किया जा सकता है।

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Streptomyces उपभेदों उनकी क्षमता विभिन्न bioactivities के साथ अलग अलग यौगिकों की एक बहुत का उत्पादन करने के लिए जाना जाता है। अलग अलग परिस्थितियों में खेती अक्सर नए यौगिकों का उत्पादन होता है। इसलिए, उपभेदों के उत्पादन संस्कृतियों एथिल एसीटेट के साथ निकाले जाते हैं और कच्चे तेल के अर्क एचपीएलसी से विश्लेषण कर रहे हैं। इसके अलावा, अर्क विभिन्न संसाधनों द्वारा उनकी bioactivity के लिए परीक्षण कर रहे हैं। संरचना व्याख्या के लिए ब्याज की यौगिक अलग क्रोमैटोग्राफी विधियों के संयोजन के द्वारा शुद्ध होता है। जीनोम अनुक्रमण जीनोम खनन के साथ मिलकर विभिन्न कंप्यूटर प्रोग्राम का उपयोग कर एक प्राकृतिक उत्पाद biosynthetic जीन क्लस्टर की पहचान के लिए अनुमति देता है। इस बात की पुष्टि करें कि सही जीन क्लस्टर पहचान की गई है, जीन निष्क्रियता प्रयोगों का प्रदर्शन किया जाना है। जिसके परिणामस्वरूप म्यूटेंट विशेष प्राकृतिक उत्पाद के उत्पादन के लिए विश्लेषण कर रहे हैं। एक बार सही जीन क्लस्टर निष्क्रिय कर दिया गया है,तनाव यौगिक का उत्पादन करने में विफल चाहिए। कार्यप्रवाह जीवाणुरोधी चक्रवृद्धि polyketomycin Streptomyces diastatochromogenes Tü6028 द्वारा उत्पादित के लिए दिखाया गया है। लगभग दस साल पहले, जब जीनोम अनुक्रमण अभी भी बहुत महंगा था, क्लोनिंग और एक जीन क्लस्टर की पहचान के लिए एक बहुत समय लेने वाली प्रक्रिया थी। फास्ट जीनोम जीनोम खनन के साथ संयुक्त अनुक्रमण क्लस्टर पहचान का परीक्षण accelerates और जैव संश्लेषण का पता लगाने के लिए और आनुवंशिक तरीकों से उपन्यास प्राकृतिक उत्पादों उत्पन्न करने के लिए नए तरीके को खोलता है। इस पत्र में वर्णित प्रोटोकॉल एक Streptomyces तनाव या अन्य सूक्ष्मजीव से निकाली गई किसी भी अन्य यौगिक को सौंपा जा सकता है।

इस अवलोकन में हम एक एंटीबायोटिक अपनी biosynthetic जीन क्लस्टर के लिए अग्रणी की पहचान से ही कदम का वर्णन है। कई साल पहले हम एक cosmid पुस्तकालय, उन्हें फगेस में पैक क्लोन, ई कोलाई मेजबान कोशिकाओं transduced, और कालोनियों के हजारों स्क्रीन करने के लिए polyketomycin क्लस्टर की ओवरलैपिंग क्षेत्रों होने क्लोन की पहचान के लिए किया था। Cosmids का अनुक्रमण भी एक कठिन और महंगी प्रक्रिया 12 थी। आदेश में तनाव पर आगे के अध्ययन का संचालन करने के लिए हम Streptomyces diastatochromogenes Tü6028 के पूरे जीनोम अनुक्रम। मसौदा जीनोम अनुक्रम के साथ हम आसानी से polyketomycin और अन्य समूहों के होनहार यौगिकों एन्कोडिंग के biosynthetic जीन क्लस्टर की पहचान की। चित्रा 7 एक cosmid पुस्तकालय और elaborative स्क्रीनिंग की क्लोनिंग द्वारा biosynthetic क्लस्टर की पहचान करने का &quot;&quot; पुराने विधि की तुलना, और&#39;नई&#39; किसी न किसी समय के पैमाने पर बाद में जीनोम खनन के साथ पूरे जीनोम अनुक्रमण द्वारा विधि। नई अनुक्रमण प्रौद्योगिकियों और नए जीनोम खनन कार्यक्रमों पूरी प्रक्रिया में तेजी लाने के। <img alt="चित्रा 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> चित्रा 7: &quot;पुराने&quot; और &quot;नया&quot; एक biosynthetic जीन क्लस्टर बताए की विधि की तुलना। &quot;&quot; पुराने विधि सकारात्मक क्लोन के चयन और संबंधित cosmid (एस) के साथ एक अनुक्रमण cosmid पुस्तकालय की क्लोनिंग (ऊपर) शामिल हैं; &#39;नई&#39; विधि पूरे जीनोम अनुक्रमण और तनाव (नीचे) के जीनोम पर स्थित सभी माध्यमिक मेटाबोलाइट जीन समूहों की पहचान करने के -mining भी शामिल है। एकल कदम की अवधि को किसी न किसी समय के पैमाने पर दिखाए जाते हैं। <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÆ’Ã†'Ãƒâ€šÃ‚Â¼6028

यहाँ हम (ए) एंटीबायोटिक गतिविधि के साथ एक प्राकृतिक उत्पाद की पहचान, (बी) के परिसर की शुद्धि, (सी) ने अपनी जैव संश्लेषण की पहली मॉडल, (डी) जीनोम अनुक्रमण / -mining और की एक विस्तृत प्रोटोकॉल वर्तमान ( ई) biosynthetic जीन क्लस्टर का सत्यापन।

से Polyketomycin का उपयोग करते हुए एक प्रदर्शन: इसकी biosynthetic जीन क्लस्टर के लिए एक प्राकृतिक उत्पाद से<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Research

JoVE Journal

Genetics

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

एक GFP टैग TMEM184A का प्रयोग हेपरिन रिसेप्टर पहचान की पुष्टि के लिए निर्माण

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

नमूना तैयारी और Zebrafish से RNASeq आधारित जीन अभिव्यक्ति डेटा का विश्लेषण

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

एक मानक पद्धति पर जांच करने के लिए साइट Mutagenicity के एक समारोह के रूप में बिंदु उत्परिवर्तन मरंमत Catalyzed द्वारा CRISPR/Cas9 और SsODN मानव कोशिकाओं में

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

जीन क्लोनिंग के बिना एक जीन-बाधित स्ट्रेप्टोकोकस mutans तनाव की पीढ़ी

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

मॉडल प्रणाली ढाणियो rerio में कुशल उत्पादन और CRISPR/Cas9 जनित जीन नॉकआउट की पहचान

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

जड़ Microbiome की खोज: मिट्टी, Rhizosphere से बैक्टीरियल समुदाय डेटा निकालने, और जड़ Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

बैच खमीर 2 से अनुक्रम डेटा का स्वरूप विश्लेषण-संकर स्क्रीन

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

परिपत्र गुणसूत्र अनुरूप कब्जा की अगली पीढ़ी के अनुक्रमण का उपयोग जीन विनियामक अनुक्रम का उच्च प्रवाह पहचान (4c-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

अंतर्जात जीन अभिव्यक्ति के हेरफेर के लिए दूरस्थ नियंत्रण प्रणाली के vivo आवेदन में

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

मास स्पेक्ट्रोमेट्री-आधारित Proteomics विश्लेषण OpenProt डेटाबेस का उपयोग कर उपन्यास प्रोटीन गैर-विहित ओपन रीडिंग फ्रेम्स से अनुवादित

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...