Name: from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028
Uploaded: 2017-01-13T13:00:00
Duration: 9 min 8 s
Description: Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

Neste laboratório, uma biblioteca de cosmídeos genómica de Streptomyces diastatochromogenes foi gerado e rastreados muitos anos atrás, resultando na identificação do grupo de genes polyketomycin através de um processo extremamente moroso. Caracterização de genes individuais foram possíveis usando deleções de genes-alvo e análise dos mutantes resultantes 12. Recentemente, uma sequência projecto de genoma de S. diastatochromogenes foi obtido permitindo a identificação rápida do cluster gene biossintético polyketomycin. Poderíamos facilmente detectar os genes biossintéticos, embora a sequência projecto genoma ainda contém muitos contigs. O processo descrito pode ser alcançado dentro de alguns meses. No entanto, o processo compreende diversos passos. etapas individuais podem falhar várias vezes, impedindo a progressão para as etapas subseqüentes: O género Streptomyces é conhecida pela sua capacidade para produzir compostos bioactivos. Enquanto eles carregam muitas vezes mais de 20 biosynthetic agrupamentos de genes, normalmente, apenas um ou dois compostos são produzidos em condições de laboratório. A aplicação da abordagem OSMAC (cultivo de uma estirpe em condições diferentes) para acordar agrupamentos de genes silenciosos podem não ser suficientes. A manipulação genética dos genes reguladores, tais como os genes reguladores pleiotrópicos ADPA 44 e bldA 45,46, é também um método eficaz para activar a produção de outros metabolitos secundários. Para o esclarecimento da estrutura do composto, por exemplo, por análise de RMN, geralmente superior a 2 mg de composto purificado é necessário. Por conseguinte, a fermentação de mais de 10 l de cultura é muitas vezes necessária. Sem um fermentador que é capaz de manter condições de oxigénio, pH e temperatura, pode ser um desafio numa pequena laboratório para lidar com esta quantidade de cultura e a extracção subsequente. Durante a purificação, o composto pode ser alterado devido a oxidação, radiação ou a temperatura.Além disso, quanto mais etapas de purificação são utilizados, maior é a possibilidade de degradação. Ao analisar a estrutura do produto natural, e os clusters no genoma, às vezes não é tão fácil de identificar o cluster apropriado. Em primeiro lugar, se houver apenas uma sequência projecto genoma alguma parte do cluster pode estar faltando. Em segundo lugar, nem todos os genes que são necessários para a biossíntese estão no cluster. Em terceiro lugar, por vezes, um cluster é dividido em duas partes separadas umas das outras por muitas quilobases. Em quarto lugar, pode ser difícil decidir qual é o aglomerado de genes apropriados. Em caso de grandes sistemas de PKS tipo I ou NRPS, onde é possível calcular o número de unidades de diluição com base no número de módulos, ou mesmo identificar as unidades de diluição simples por análise dos domínios de selecção, que se transforma-se facilmente. No entanto, no caso de enzimas trabalhar de forma iterativa a previsão dos compostos sintetizados não é muitas vezes possível, especialmente se o strano tem mais do que 40 conjuntos de genes. Em quinto lugar, a natureza é altamente complexa e cheia de compostos ainda desconhecidas. Muitas vezes, a biossíntese é uma mistura de diferentes vias. Se o novo composto não é identificada ainda, ou não relacionado com outro composto, pode ser difícil identificar o cluster, propor um modelo de biossíntese e para provar isso. Uma vez que o cluster é identificado, a técnica de passagem única é um método bom e rápido para verificar a hipótese. PCR, clonagem num vector suicida, conjugação, a selecção de clones positivos, e o ensaio de produção são os únicos passos necessários. Uma desvantagem desta técnica é que a integração do vector no cromossoma não é estável devido à mais eventos de recombinação. Por conseguinte, a fim de analisar mais genes simples, deleções de genes precisos são necessários. Também pode ser complicado para manipular estirpes Streptomyces no nível genético. O processo descrito pode ser atribuído tO qualquer outro composto produzido por uma estirpe de Streptomyces ou outro microrganismo. O conhecimento sobre um conjunto de genes biossintéticos e seu composto sintetizado nos dá novas oportunidades para já modificar moléculas existentes com o objectivo de melhorar-los para a luta contra patógenos multirresistentes.

produtos naturais de plantas e microrganismos sempre foram uma fonte importante para o desenvolvimento de medicamentos clínicos e de pesquisa. O primeiro antibiótico penicilina foi descoberta em 1928, a partir de um fungo por Alexander Fleming 1. Hoje em dia, muitos produtos mais naturais são utilizadas no tratamento clínico. Um gênero conhecido por sua capacidade de produzir vários tipos de metabólitos secundários com diferentes bioatividades é Streptomyces. Streptomyces são bactérias Gram-positivas e pertencem à classe de Actinobactérias e da ordem Actinomycetales. Quase dois terços dos antibióticos utilizados clinicamente são derivados de Actinomycetales, principalmente a partir de Streptomyces, como anfotericina 2, 3 daptomicina ou tetraciclina 4. Dois prêmios Nobel foram concedidos no domínio dos Streptomyces pesquisa antibiótico. O primeiro foi para Selman Waksman para a descoberta da estreptomicina, o primeiro de umatibiotic eficaz contra a tuberculose. 5 Em 2015, como parte do Prêmio Nobel de Fisiologia e Medicina, a descoberta de avermectina de S. avermitilis foi premiado também. Avermectina é utilizado para o tratamento de doenças parasitárias 6,7. A abordagem tradicional para a descoberta de produtos naturais em microorganismos tais como Streptomyces envolve geralmente a cultura da estirpe, sob diferentes condições de crescimento, bem como a extracção e análise de metabolitos secundários. Testes de bioactividade (por exemplo, ensaios para a actividade anti-bacteriana e anti-cancro) são realizados para detectar a actividade do composto. Finalmente, o composto de interesse é isolado e a estrutura química é elucidado. As estruturas dos produtos naturais são muitas vezes composta de porções individuais, que estão a formar moléculas complexas. Existem alguns, mas limitados principais vias biossintéticas, levando a construção de blocoKS, que são utilizados para a biossíntese de produtos naturais. As principais vias biossintéticas são os caminhos de policétido, vias que levam à terpenóides e alcalóides, vias utilizando aminoácidos, e as vias que levam a porções de açúcar. Cada caminho é caracterizada por um conjunto de enzimas específicas 8. Com base na estrutura do composto, estas enzimas biossintéticas podem ser previstos. Hoje em dia, a análise estrutural detalhada de um composto em combinação com a próxima geração de sequenciação e análise bioinformática pode ajudar a identificar o agrupamento de genes de biossíntese responsável. As informações de cluster abre novos caminhos para novas pesquisas produto natural. Isto inclui a expressão heteróloga para aumentar o rendimento do produto natural, modificação composto alvo por deleção ou alteração de genes e biossíntese combinatória com genes de outras vias. Polyketomycin foi isolado independentemente a partir do caldo de cultura deduas estirpes, Streptomyces sp. MK277-AF1 9 e Streptomyces diastatochromogenes Tü6028 10. A estrutura foi elucidada por análise de RMN e de raios-X. Polyketomycin é composto de um decaketid tetracíclico e um ácido salicílico de dimetilo, ligados por as duas porções deoxysugar p-D-amicetose e α-L-axenose. Ele exibe citotóxica e actividade antibiótica, mesmo contra estirpes Gram-positivas multirresistentes, como a MRSA 11. Uma biblioteca de cosmídeos genómica de S. diastatochromogenes Tü6028 foi gerado e rastreados há muitos anos. Usando gene específico sondas cluster gene polyketomycin com um tamanho de 52,2 kb, contendo 41 genes, foi identificada depois de vários meses de trabalho intenso 12. Recentemente, uma sequência de projecto de genoma de S. diastatochromogenes foi obtido levando à identificação rápida do agrupamento de genes de biossíntese polyketomycin. Nesta visão geral, um método de ajudar a identificar um produto natural e elucidar o seu agrupamento de genes de biossíntese será descrito, usando polyketomycin como um exemplo. Aqui nós explicamos os passos simples que levam de um produto natural ao seu conjunto de genes biossintéticos mostrado para polyketomycin produzido por Streptomyces diastatochromogenes Tü6028. O protocolo compreende a identificação e a purificação de um produto natural com propriedades antibióticas. Outras análises estruturais e comparação com os resultados de chumbo genoma de mineração para a identificação do grupo de genes de biossíntese. Este procedimento pode ser aplicado a qualquer outro composto derivado de uma estirpe de Streptomyces ou qualquer outro microorganismo.

<table border="0" cellpadding="0" cellspacing="0" width="1334">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">agar</td>
			<td style="width:397px;">Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">5210.4</td>
			<td style="width:360px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">agarose</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6352.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">D-mannitol&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4175.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">glucose&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6780.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">LB&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X964.3</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">malt extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X976.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">MgCl2</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2189.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Peptone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">soy flour&#160;</td>
			<td style="width:397px;">W.Schoenemberger GmbH, Magstadt, Germany</td>
			<td style="width:231px;"></td>
			<td>Hensec-Vollsoja</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">tryptic soy broth</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">X938.3</td>
			<td>Caso-Bouillon</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">yeast extract&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">2363.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Solvents</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetic acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">3738.5</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetone&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">9372.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Acetonitrile</td>
			<td style="width:397px;">Avantor Performance Materials B.V., Deventer, The Netherlands</td>
			<td>JT-9012-03</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Dichlorofrom&#160;</td>
			<td>Fisher Scientific GmbH, Schwerte, Germany</td>
			<td>1530754</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO (Dimethyl sulfoxide)</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">4720.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">DMSO-d6 (Dimethyl sulfoxide-d6) 99.9atom%D</td>
			<td style="width:397px;">ARMAR Chemicals, D&#246;ttingen, Switzerland</td>
			<td style="width:231px;">15200.204</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Ethyl acetate</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td>6784.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Hydrochloric acid</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">6331.4</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Methanol</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">7342.1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Enzymes</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">restriction enzymes</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">polymerase&#160;</td>
			<td colspan="2">New England Biolabs GmbH, Frankfurt am Main, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DNA Polymerase I Large (Klenow) Fragment</td>
			<td>Promega GmbH, Mannheim, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Antibiotics</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">apramycin</td>
			<td>AppliChem GmbH, Darmstadt, Germany&#160;</td>
			<td style="width:231px;">A7682.0005</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">fosfomycin</td>
			<td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td>
			<td style="width:231px;">P5396-50G</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">kanamycin</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td style="width:231px;">T832.2</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Plasmid/Vectors</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pKC1132</td>
			<td style="width:397px;">Bierman et al. 1992</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Primer&#160;</td>
			<td style="width:397px;"></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_for</td>
			<td>TGATGGTGCCGCTGGCCATGG</td>
			<td rowspan="2" style="width:231px;">Primer to amplify fragment containing pokPI gene</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">pokPI_rev</td>
			<td>AGCGTTCACTGTTCCGCCCGAC</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacterial strains</td>
			<td style="width:397px;"></td>
			<td style="width:231px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Bacillus subtilis COHN ATCC6051</td>
			<td></td>
			<td>Gram-positive test strain&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Escherichia coli ET12567 pUZ8002&#160;</td>
			<td>MacNeil et al., 1992</td>
			<td>strain for conjugation&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Escherichia coli XL1 Blue</td>
			<td style="width:397px;">Agilient Technologies, Santa Clara, USA</td>
			<td colspan="2">Gram-negative test strain + cloning host&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Streptomyces diastatochromogenes T&#252;6028</td>
			<td style="width:397px;">Paululat et al., 1999</td>
			<td>Polyketomycin producer</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Online services</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td>
			<td style="width:397px;">http://antismash.secondarymetabolites.org/</td>
			<td colspan="2">Detection of secondary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">BLAST (Basic Local Alignment Search Tool)</td>
			<td style="width:397px;">http://blast.ncbi.nlm.nih.gov/Blast.cgi</td>
			<td colspan="2">finds regions of similarity between biological sequences</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">GenDB</td>
			<td style="width:397px;">https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td>
			<td style="width:397px;">http://mibig.secondarymetabolites.org/</td>
			<td colspan="2">Database of biosyntetic gene clusters</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NaPDoS</td>
			<td style="width:397px;">http://napdos.ucsd.edu/</td>
			<td colspan="2">Detection of seconary metabolite gene cluster</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">NCBI Prokaryotic Genome Annotation Pipeline</td>
			<td style="width:397px;">http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NRPSpredictor</td>
			<td style="width:397px;">http://nrps.informatik.uni-tuebingen.de/</td>
			<td>Detection of NRPS domains</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Prokka (rapid prokaryotic genome annotation)</td>
			<td style="width:397px;">http://www.vicbioinformatics.com/software.prokka.shtml</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">RAST (rapid annotation using subsystems technology)</td>
			<td style="width:397px;">http://rast.nmpdr.org/</td>
			<td>Annotation of ORFs&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">other programs&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Chem Station Rev. A.09.03</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td style="width:231px;">Handling program for HPLC&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Clone Manager Suite 7</td>
			<td style="width:397px;">Scientific and Educational Software, Cary, USA</td>
			<td style="width:231px;">Designing Cloning Experiment&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Newbler v2.8</td>
			<td style="width:397px;">Roche Diagnostics</td>
			<td>Alignment of sequencing reads</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Machines&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Centrifuge Avanti J-6000, Rotor JA-10</td>
			<td>Beckman Coulter GmbH, Krefeld, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC/MS</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Autosampler: G1313A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Column:Xbridge C18 (100 mm &#215; 4.6 mm; Particle size: 3.5 &#956;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &#181;m)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Degasser: G1322A&#160;</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quarternary pump: G1311A</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Diode array detector (DAD )G1315B (&#955; = 254 nm and 400 nm)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td>
			<td style="width:397px;">Agilent Technologies, Waldbronn, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">rotary evaporator</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_heating bath Hei-VAP Value/G3</td>
			<td colspan="2">Heidolph Instruments GmbH &#38; Co.KG, Schwabach, Germany</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">_vacuum pump system SC 920 G</td>
			<td>KNF&#160;Global Strategies&#160;AG, Sursee, Switzerland</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">other material&#160;</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:347px;">Sephadex LH20</td>
			<td style="width:397px;">GE Healthcare,&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Chromafil PVDF-45/15MS (pore size 0.45 &#181;m; filter &#216;15 mm)</td>
			<td>MACHEREY-NAGEL GmbH &#38; Co. KG, D&#252;ren, Germany</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SPE column Oasis HLB 20 35 cc (6g)</td>
			<td style="width:397px;">Waters GmbH, Eschborn, Germany&#160;</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">E. coli&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Bacillus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: LB, Composition: LB, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Streptomyces sp.</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H2O: 30 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H2O: 10 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Peptone, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">fungus&#160;</td>
			<td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td>
			<td></td>
			<td>Medium: YPD, Composition: Glucose, Amount to 1 L H2O: 20 g</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;"></td>
			<td></td>
			<td></td>
			<td>for agar plates add 2 % agar</td>
		</tr>
	</tbody>
</table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

As estirpes de Streptomyces são conhecidos pela sua capacidade de produzir uma grande quantidade de diferentes compostos com várias bioactividades. O cultivo sob condições diferentes, muitas vezes leva à produção de novos compostos. Assim, culturas de produção das estirpes são extraídos com acetato de etilo e os extractos brutos foram analisados ​​por HPLC. Além disso, os extractos são testados quanto à sua bioactividade por ensaios diferentes. Para elucidação da estrutura do composto de interesse é purificado por uma combinação de diferentes métodos de cromatografia. sequenciamento do genoma juntamente com a mineração genoma permite a identificação de um conjunto de genes biossintéticos produto natural utilizando diferentes programas de computador. Para confirmar que o aglomerado de genes correcta tenha sido identificado, experiências de inactivação de gene tem que ser executada. Os mutantes resultantes são analisadas para a produção do produto natural particular. Uma vez que o aglomerado de genes correcta foi inactivado, oestirpe deve deixar de produzir o composto. O fluxo de trabalho é mostrado para o polyketomycin composto antibacteriano produzido por Streptomyces diastatochromogenes Tü6028. Cerca de dez anos atrás, quando sequenciação do genoma ainda era muito caro, a clonagem e identificação de um grupo de genes foi um processo muito demorado. sequenciamento rápido do genoma combinado com a mineração genoma acelera o julgamento de identificação cluster e abre novas maneiras de explorar a biossíntese e gerar novos produtos naturais por métodos genéticos. O protocolo descrito no presente documento pode ser atribuído a qualquer outro composto derivado de uma estirpe de Streptomyces ou outro microrganismo.

Nesta visão geral, descrevemos os passos individuais da identificação de um antibiótico que conduz à sua aglomerado de genes biossintéticos. Há muitos anos que clonado de uma biblioteca de cosmídeo, embalados-los em fagos, transduzidas células hospedeiras de E. coli, e teve de tela milhares de colónias para identificar os clones que possuem regiões que se sobrepõem de aglomerado polyketomycin. A sequenciação dos cosmídeos foi também um processo difícil e dispendioso 12. A fim de realizar novos estudos sobre a tensão que sequenciou o genoma inteiro de Streptomyces diastatochromogenes Tü6028. Com o projeto de sequenciamento do genoma que facilmente identificados no cluster de genes biossintéticos de polyketomycin e outros clusters que codificam compostos promissores. A Figura 7 compara o método &quot;velho&quot; de identificação do cluster biossintético por clonagem de uma biblioteca de cosmídeos e rastreio elaborativa, eo método &quot;novo&quot; por toda a sequenciação do genoma com a mineração genoma subsequente numa escala de tempo áspero. As novas tecnologias de sequenciamento e programas de mineração genoma novas acelerar todo o processo. <img alt="Figura 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> Figura 7: Comparação entre o &quot;velho&quot; e &quot;novo&quot; método de atribuição de um biossintética Gene Cluster. O método &quot;velho&quot; compreende a clonagem de uma biblioteca de cosmídeos com uma selecção de clones positivos e sequenciação do respectivo cosmideo (s) (supra); O método &quot;novo&quot; inclui sequenciação do genoma completo e -mining para identificar todos os agrupamentos de genes de metabolitos secundários localizados no genoma da estirpe (em baixo). Duração de etapas individuais são mostrados em uma escala de tempo áspero. <a href="http://ecsource.jove.com/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÂ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃƒÆ’Ã†'Ãƒâ€šÃ‚Â¼6028

Aqui é apresentado um protocolo detalhado de (A) a identificação de um produto natural com actividade antibiótica, (B) a purificação do composto, o primeiro modelo da sua biossintese (C), (D) a sequenciação do genoma / -mining e o ( E) a verificação do grupo de genes de biossíntese.

A partir de um produto natural para seu cluster de genes biossintéticos: Uma demonstração utilizando Polyketomycin de<em&gt; Streptomyces diastatochromogenes</em&gt; Tü6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

Research

JoVE Journal

Genetics

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Using a GFP-tagged TMEM184A Construct for Confirmation of Heparin Receptor Identity

Usando um TMEM184A GFP Construir para a confirmação da Heparina Receptor Identity

When novel proteins are identified through affinity-based isolation and bioinformatics analysis, they are often largely uncharacterized. Antibodies ...

Genética

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

Preparação da amostra e análise de dados da expressão do Gene RNASeq-baseado de Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Uma metodologia padrão para examinar a mutagenicidade no local como uma função de ponto de mutação reparação catalisada por CRISPR/Cas9 e SsODN em células humanas

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Geração de um Gene-interrompeu Streptococcus mutans estirpe sem Gene clonagem

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Efficient Production and Identification of CRISPR/Cas9-generated Gene Knockouts in the Model System Danio rerio

Produção eficiente e identificação de CRISPR/Cas9 gerado pelo Gene nocautes no sistema modelo Danio rerio

Characterization of the clustered, regularly interspaced, short, palindromic repeat (CRISPR) system of Streptococcus pyogenes has enabled the development ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Explorando o microbioma da raiz: extraindo dados da comunidade bacteriana do solo

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Informatic Analysis of Sequence Data from Batch Yeast 2-Hybrid Screens

Análise informática de dados da sequência do lote levedura híbrida-2 telas

We have adapted the yeast 2-hybrid assay to simultaneously uncover dozens of transient and static protein interactions within a single screen utilizing ...

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture (4C-seq)

High-throughput Identification of Gene Regulatory Sequences Using Next-generation Sequencing of Circular Chromosome Conformation Capture 4C-seq

Identificação do elevado-throughput de sequências de genes regulatórios utilizando a próxima geração sequenciamento de conformação Circular cromossoma capturar (4C-seq)

The identification of regulatory elements for a given target gene poses a significant technical challenge owing to the variability in the positioning and ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Na aplicação do sistema de controle remoto para a manipulação da expressão do Gene endógeno de vivo

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Espectrometria de massa-baseado Proteomics análises usando banco de dados OpenProt para desvendar novas proteínas traduzidas de Frames de leitura abertos não-canônicos

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...