Name: induction of mesenchymal-epithelial transitions in sarcoma cells
Uploaded: 2017-04-07T15:00:00
Description: Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

JAS erkent steun van het Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, en de Duke University Afdeling Orthopedie. HL werd gesteund door de National Science Foundation (NSF) Centrum voor Theoretische Biological Physics (NSF PHY-1.427.654) en NSF DMS-1.361.411, en als een CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in Cancer Research van de staat Texas aan de Rice University. KEW werd ondersteund door NIH F32 CA192630 MKJ en HL geprofiteerd van nuttige besprekingen met Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta en Donald S. Coffey.

1. Bereiding van reagentia <ol><li> Bereid DMEM gedurende celkweek door toevoeging van 50 ml foetaal runderserum (FBS) en 5 ml penicilline-streptomycine (5000 U / ml) en 500 ml DMEM. Dit medium kan voor maximaal zes maanden worden bewaard bij 4 ° C. </li><li> Resuspendeer gevriesdroogde primers in nuclease-vrij water tot een eindconcentratie van 10 uM. WINKEL hersuspendeerd primers bij -20 ° C. </li><li> Bereid radioimmunoprecipitatietest (RIPA) buffer (150 mM NaCl, 0,5% natriumdeoxycholaat, 0,1% SDS, 50 mM Tris, pH...

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

Sarcomen zijn zeldzaam, maar zeer agressieve kanker van een mesenchymale lijn. Ondanks hun mesenchymale lijn, een subset van sarcomen blijkt een fenotypische overgang naar een epitheel-achtige toestand ondergaan. Dit MET-achtige schakelaar prognostische impact, zoals patiënten met epitheel-achtige tumoren zijn minder agressief 24. Ondanks hun klinische relevantie, zijn er weinig studies over de moleculaire mechanismen die deze fenotypische overgangen in sarcomen. Om ...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Fenotypische plasticiteit heeft betrekking op een reversibele overgang tussen cellulaire fenotypes en wordt gewoonlijk verdeeld in twee types, epitheliale naar mesenchymale (EMT) overgangen en mesenchymale tot epitheliale overgangen (MET). Deze fenotypische plasticiteit speelt een belangrijke rol in de normale processen van meercellige organismen, zoals de ontwikkeling en wondgenezing 1; echter kan deze zelfde paden en genexpressie programma ook leiden tot ziekten zoals fibrose (samengevat in 2, 3, 4) en carcinoom metastase (samengevat in referenties 5, 6, 7, 8). Tijdens metastase, bijvoorbeeld EMT verstoort celpolariteit, cel-cel interacties en bevordert invasie 9, 10. Samen EMT bijdragens om een ​​fenotypische staat die kankercel verspreiding vergemakkelijkt. Bovendien, EMT leidt ook tot een aantal andere fenotypische veranderingen die een agressieve fenotype trekken, inclusief deregulering van kankercel metabolisme 6, ontwikkeling van geneesmiddelresistentie 11, 12, verhoogde tumor-initiatie vermogen 13, 14 en gastheer immuunontwijking 15. Fenotypische plasticiteit is goed onderzocht in carcinoom progressie; Maar ook sarcomen fenotypische plasticiteit vertonen. Interessant, lijkt het alsof een aantal van dezelfde drijfveren van fenotypische plasticiteit in carcinomen ook bijdragen aan sarcoom plasticiteit en agressiviteit. Zo zijn circulerende tumorcellen (CTCs) vanaf sarcoom patiënten aangetoond dat EpCAM, een celoppervlakte-eiwit dat gewoonlijk wordt gevonden op epitheelcellen 16 expressie brengen. Additioneel werd 250 wekedelensarcoom monsters geclassificeerd als epitheel-achtige of mesenchymale-achtige basis van genexpressie. Patiënten in de epitheliale-achtige biomarker handtekening had een betere prognose dan patiënten met de mesenchymale-achtige biomarker handtekening 17. Dit is consistent met vele carcinomen, waarbij patiënten met meer epitheel-achtige carcinomen hebben betere resultaten in vergelijking met patiënten met meer mesenchymale-achtige tumoren 18. Terwijl sommige sarcomen geven biomerkers en genexpressie paden in overeenstemming met BMO blijven de moleculaire onderbouwing van deze fenotypische plasticiteit slecht begrepen. Om de mechanismen en bestuurders van BMO in sarcoma bestuderen we een model ontwikkeld van BMO inductie met behulp van twee epitheliale-specifieke factoren, de microRNA (MIR) -200 familie en grainyhead-achtige 2 (GRHL2). De miR-200S zijn een familie van kleine niet-coderende RNAs die genexpressie reguleren door te binden aan de 3&#39; UTR van messenger RNA en verhinderen translatie in eiwit. Het miR-200 familie bestaat uit twee subgroepen - een met miR-141 en miR-200a en de andere met inbegrip van miR-200b, miR-200c en miR-429. Familieleden miR-200 verrijkt in epitheliale weefsels, en het verlies van miR-200s is geassocieerd met metastase in carcinomen 19. De familie miR-200 ook omlaag gereguleerd in zacht weefsel sarcomen in vergelijking met normaal weefsel 20. Net als bij de miR-200S, GRHL2 is een belangrijke regulator die belangrijk is voor epitheliale ontwikkeling 21. De GRHL2 transcriptiefactor fungeert op twee manieren epitheliale genen, zoals E-cadherine upregulate: 1) in epitheelcellen, GRHL2 direct onderdrukt de EMT hoofdregelaar, ZEB1 22; en 2) GRHL2 direct activeert transcriptie van genen epitheliale 23. Onze eerdere onderzoekingen hebben aangetoond dat de gecombineerde expressie van miR-200s en GRHL2 in sarcoomcelleninduceert een MET-fenotype 24. Hier presenteren we een gedetailleerd protocol voor een in vitro model van MET inductie in sarcoomcellen via ectopische expressie van miR-200s en GRHL2 creëren.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

Fenotypische plasticiteit verwijst naar een fenomeen waarin cellen transiënt trekken van een lijn krijgen. Tijdens carcinoom progressie, fenotypische plasticiteit drijft invasie, verspreiding en metastase. Inderdaad, terwijl de meeste van de studies van fenotypische plasticiteit in het kader van epitheliale carcinomen afkomstig zijn, blijkt sarcomen, die mesenchymale oorsprong zijn, ook fenotypische plasticiteit vertonen, met een subset van sarcomen een verschijnsel dat lijkt mesenchymal- ondergaan epitheliale transitie (MET). Hier hebben we een werkwijze omvattende de miR-200-familie en grainyhead als 2 (GRHL2) deze MET-achtige fenomeen waargenomen sarcoom patiënten samples.We achtereenvolgens tot expressie GRHL2 en miR-200 familie die cel transductie en transfectie nabootsen respectievelijk , beter inzicht in de moleculaire onderbouwing van deze fenotypische overgangen in sarcoma cellen. Sarcoma cellen die miR-200s en GRHL2 aangetoond verbeterde epitheliale characteristics in cel morfologie en verandering van epitheliale en mesenchymale biomarkers. Toekomstige studies met behulp van deze methoden kunnen worden gebruikt om beter inzicht in de fenotypische gevolgen van de MET-achtige processen op sarcoma cellen, zoals migratie, invasie, metastatische neiging, en therapie weerstand.

Schema voor BMO inductie in sarcoma cellen Een algemene tijdschema voor de inductie van MET-achtige veranderingen in sarcoma cellen wordt getoond in figuur 1. Het protocol begint met transducerende GRHL2 (figuur 1A), gevolgd door transfectie van de familie miR-200 (Figuur 1B). GRHL2 of miR-200 familieleden waren niet in staat om de impact van de verschijning van RD-cellen wanneer...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

We presenteren hier een celkweek werkwijze voor het induceren mesenchymale-epitheliale overgangen (MET) sarcoom cellen op basis van gecombineerde ectopische expressie van microRNA-200 familieleden en grainyhead-achtig 2 (GRHL2). Deze methode is geschikt voor een beter begrip van de biologische gevolgen van de fenotypische plasticiteit in de agressiviteit van kanker en behandelingen.

Inductie van mesenchymale-epitheliale Transities sarcoomcellen

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

Research

JoVE Journal

Developmental Biology

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

Direct Inductie van Human neurale stamcellen uit perifeer bloed hematopoïetische voorlopercellen

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

Direct Inductie van Hemogenic Endotheel en Bloed door overexpressie van transcriptiefactoren in menselijke pluripotente stamcellen

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Chondrogene differentiatie Inductie van vetcellen afgeleide stamcellen door Centrifugaal Zwaartekracht

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

Regie van differentiatie van primitieve en definitieve hematopoietische progenitorcellen van menselijke pluripotente stamcellen

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Inductie van hypoxie in levende kikker en zebravis embryo&#39;s

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Horizontale gehele berging: Een nieuw verwerkings- en beeldprotocol voor dikke, driedimensionale weefsel dwarsdoorsneden van de huid

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

Eencellige Photoconversion in levende Intact zebravis

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computationele analyse van de Caenorhabditis elegans Germline te bestuderen van de distributie van kernen, eiwitten en het cytoskelet

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

Inductie en validatie van cellulaire senescentie in primaire menselijke cellen

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

Inductie van Endothelial differentiatie in cardiale voorlopercellen onder lage Serum voorwaarden

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...