Name: induction of mesenchymal-epithelial transitions in sarcoma cells
Uploaded: 2017-04-07T15:00:00
Description: Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

JA erkennt an Unterstützung von dem Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, und die Duke University Abteilung für Orthopädie. HL wurde von der National Science Foundation (NSF) Zentrum für Theoretische Biologische Physik (NSF PHY-1.427.654) und NSF DMS-1361411 und als CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in der Krebsforschung des Staates Texas unterstützt an der Rice University. KEW wurde vom NIH F32 CA192630 MKJ unterstützt und HL profitierte von nützlichen Gesprächen mit Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta und Donald S. Coffey.

1. Vorbereitung der Reagenzien <ol><li> Bereiten DMEM für Zellkultur durch Zugabe von 50 ml fötalen Rinderserum (FBS) und 5 ml Penicillin-Streptomycin (5000 U / ml) zu 500 ml DMEM. Dieses Medium kann für bis zu sechs Monate bei 4 ° C gelagert werden. </li><li> Resuspendieren lyophilisierte Primer in Nuklease-freies Wasser bis zu einer Endkonzentration von 10 uM. Store resuspendierten Primer bei -20 ° C. </li><li> Bereiten Radioimmunpräzipitation-Assay (RIPA) -Puffer (150 mM NaCl, 0,5% Natriumdesoxycholat, 0,1% S...

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

Sarkome sind selten, aber sehr aggressive Krebsarten von einer mesenchymalen Abstammungslinie. Trotz ihrer mesenchymalen Abstammungslinie, wird eine Teilmenge von Sarkomen einen phänotypischen Übergang zu einem epithelial-ähnlichen Zustand zu unterziehen. Der MET-like - Schalter hat prognostische Relevanz, da Patienten mit Epithel-ähnlichen Tumoren sind weniger aggressiv 24. Trotz ihrer klinischen Relevanz, gibt es nur wenige Studien, die molekularen Mechanismen der Bewältigung dieser phäno...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Phänotypische Plastizität bezieht sich auf einen reversible Übergang zwischen zellulären Phänotypen, und wird allgemein in zwei Typen unterteilt, epithelial-to-mesenchymalen (EMT) Transitionen und mesenchymalen-to-epithelialen Transitionen (MET). Diese phänotypische Plastizität spielt eine wichtige Rolle bei der normalen Prozessen mehrzelliger Organismen, wie Entwicklung und Wundheilung 1; jedoch können dieselben Wege und Genexpressionsprogramme auch zu Krankheiten führen, wie Fibrose ( beschrieben in 2, 3, 4) und Karzinom - Metastasen (rezensiert in Referenzen 5, 6, 7, 8). Während Metastasierung zum Beispiel stört EMT Zellpolarität, Zell-Zell - Wechselwirkungen und fördert Invasion 9, 10. Zusammen EMT beitragens zu einem phänotypischen Zustand, dass Krebszellen Verbreitung erleichtert. Außerdem führt EMT auch mit vielen anderen phänotypischen Veränderungen , die einen aggressiven Phänotyp treiben, einschließlich der Deregulierung von Krebszellmetabolismus 6, der Entwicklung der Arzneimittelresistenz 11, 12, erhöhte Tumor-Initiierungsfähigkeit 13, 14 und Host Immunevasion 15. Phänotypische Plastizität wurde in Karzinom Progression gut untersucht; zeigen jedoch Sarkome auch phänotypische Plastizität. Interessanterweise scheint es, als ob einige der gleichen Treiber der phänotypischen Plastizität bei Karzinomen auch Sarkom Plastizität und Aggressivität beitragen. Zum Beispiel zirkulierende Tumorzellen (CTCs) von Sarkom - Patienten wurden EpCAM, ein Zelloberflächenprotein exprimieren gezeigt , die typischerweise auf epithelialen Zellen 16 zu finden ist. Additional wurden 250 Weichteilsarkom Proben als Epithel-ähnlichen oder mesenchymalen artigen basierend auf Genexpression kategorisiert. Den Patienten in der Epithel-ähnlichen Biomarker Unterschrift hatten eine bessere Prognose als Patienten mit der mesenchymalen ähnlichen Biomarkers Signatur 17. Dies steht im Einklang mit vielen Karzinomen, in denen Patienten mit Epithel-ähnlichen Karzinome haben bessere Ergebnisse im Vergleich zu Patienten mit mesenchymalen artigen Tumoren 18. Während einige Sarkome Biomarker und Genexpression Wege im Einklang mit MET, die molekularen Grundlagen dieser phänotypischen Plastizität zeigen noch schwer abzuschätzen. Um die Mechanismen und Fahrer von MET in Sarkom zu studieren wir ein Modell der MET Induktion entwickeln unter Verwendung von zwei epithelialen spezifischen Faktoren, die microRNA (du) -200 Familie und grainyhead-like 2 (GRHL2). Der miR-200s ist eine Familie von kleinem nicht-kodierenden RNAs, die die Genexpression regulieren, indem sie an den 3&#39;-UTRs der Bindung messenger RNA und verhindert Übersetzung in ein Protein. Die miR-200-Familie besteht aus zwei Untergruppen - eines enthält, miR-141 und miR-200a, und das andere darunter miR-200b, miR-200c, miR-429 und. Mitglieder der ich-200 - Familie werden in epithelialen Geweben angereichert, und der Verlust von miR-200s ist mit Metastase in Karzinomen 19 verbunden. Die ich-200 - Familie ist auch in Weichteilsarkomen im Vergleich zu normalen Gewebe 20 nach unten reguliert. Ähnlich den miR-200s ist GRHL2 ein Schlüsselregulator für die Entwicklung epithelialer 21 wichtig ist. Der GRHL2 Transkriptionsfaktor wirkt auf zwei Arten epitheliale Gene, wie E-Cadherin hochzuregulieren: 1) in Epithelzellen, GRHL2 reprimiert direkt der EMT Master - Regulator, ZEB1 22; und 2) GRHL2 aktiviert direkt die Transkription von Genen epithelialer 23. Unsere bisherigen Untersuchungen haben gezeigt, dass die kombinierte Expression von miR-200s und GRHL2 in Sarcomzelleninduziert einen MET-ähnlichen Phänotyp 24. Hier stellen wir ein detailliertes Protokoll ein in vitro - Modell der MET - Induktion in Sarkomzellen Verwendung ektopische Expression von miR-200s und GRHL2 zu schaffen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

Phänotypische Plastizität bezieht sich auf ein Phänomen, bei dem Zellen, die transient Züge eines anderen Abstammungslinie gewinnen. Während Karzinom Progression treibt phänotypische Plastizität Invasion, Verbreitung und Metastasierung. Tatsächlich, während die meisten Studien der phänotypischen Plastizität im Zusammenhang mit der epithelialen abgeleiteten Karzinome waren, stellt sich Sarkome aus, die mesenchymalen Ursprungs sind, auch phänotypische Plastizität aufweisen, mit einer Teilmenge von Sarkomen ein Phänomen unterziehen, die eine mesenchymal- ähnelt epithelial Übergang (MET). Hier entwickeln wir ein Verfahren mit der ich-200-Familie und grainyhead-like 2 (GRHL2) diese MET-Phänomene wie in Sarkom Patienten beobachtet samples.we nachzuahmen sequentiell GRHL2 exprimieren und die ich-200-Familie unter Verwendung von Zell-Transduktion und Transfektion bzw. zu verstehen, um besser auf die molekularen Grundlagen dieser phänotypischen Übergänge in Sarcomzellen. Sarcoma-Zellen, ich-200s und GRHL2 demonstrierten verbesserten epithelialen characteristICs in der Zellmorphologie und den Umbau von epithelialen und mesenchymalen Biomarker. Zukünftige Studien mit Hilfe dieser Methoden können besser genutzt werden, um die phänotypischen Folgen der MET-ähnlicher Prozesse auf Sarkom-Zellen zu verstehen, wie Migration, Invasion, metastasierendem Neigung und Therapieresistenz.

Schema für MET Induktion in Sarkomzellen Eine allgemeine Zeitleiste für die Induktion von MET artigen Veränderungen in Sarkomzellen ist in Abbildung 1 dargestellt. Das Protokoll beginnt mit GRHL2 (Abbildung 1A), gefolgt von Transfektion der miR-200 - Familie (Abbildung 1B) Umwandlungs. GRHL2 oder ich-200 Familienmitglieder waren nicht in der Lage das Auftreten von RD-Zellen zu...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Wir stellen hier ein Zellkulturverfahren für die auf Basis von kombinierten ektopische Expression von microRNA-200 Familienmitgliedern und grainyhead-like 2 (GRHL2) mesenchymale-epithelialen Transitionen (MET) in Sarkomzellen zu induzieren. Dieses Verfahren ist für eine besseren geeignet, die biologische Wirkung der phänotypischen Plastizität auf Krebs Aggressivität und Behandlungen zu verstehen.

Die Induktion von mesenchymalen-Epithelial Transitions in Sarcomzellen

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

Research

JoVE Journal

Developmental Biology

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

Direkte Induktion von humanen neuralen Stammzellen aus peripherem Blut hämatopoetischen Vorläuferzellen

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

Forschung

Entwicklungsbiologie

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

Direkte Induktion von Hemogenic Endothel und das Blut durch die Überexpression von Transkriptionsfaktoren in der Personal pluripotenten Stammzellen

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Chondrogene Differenzierung Induktion von Fettgewebe gewonnene Stammzellen durch Zentrifugalkraft Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

Differenzierung der Primitive und Definitive hämatopoetischen Vorläuferzellen aus menschlichen pluripotente Stammzellen gerichtet

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Induktion von Hypoxie im lebenden Frosch und Zebrafisch Embryonen

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Horizontale Ganze Mount: Ein neuartiges Verarbeitungs- und Imaging-Protokoll für dickes, dreidimensionales Gewebequerschnitt der Haut

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

Einzellige Ladungszustand im lebendigen intakten Zebrafisch

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computergestützte Analyse der Keimbahn Caenorhabditis Elegans , die Verteilung der Kerne, Proteine und das Zytoskelett zu studieren

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

Induktion und Validierung der zellulären Seneszenz in primären humanen Zellen

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

Induktion der endothelialen Differenzierung in kardialen Vorläuferzellen unter niedrigen Serum-Bedingungen

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...