Name: induction of mesenchymal-epithelial transitions in sarcoma cells
Uploaded: 2017-04-07T15:00:00
Description: Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

JAS는 듀크 암 연구소, 듀크 대학 비뇨 생식기 종양학 연구소 및 정형 외과의 듀크 대학교의 지원을 인정합니다. HL은 이론 생물 물리학에 대한 국립 과학 재단 (National Science Foundation, NSF) 센터에 의해 지원되었다 (NSF PHY-1427654)와 NSF DMS-1361411, 텍사스 주 암 연구에 CPRIT로 (암 예방 및 텍사스 연구소) 학술 라이스 대학 (Rice University)에서. KEW는 NIH F32 CA192630 MKJ 지원하고 HL 메리 C. Farach-카슨 JN Onuchic 사미르 M. Hanash, 케네스 J 피엔타, 도널드 S. 코피 유용한 논의 혜택.

시약의 제조 1. <ol><li> 소 태아 혈청 (FBS) 및 페니실린 - 스트렙토 마이신 (5,000 U / ㎖) 500 ㎖의 DMEM에 5 mL의 50 ㎖를 첨가하여 세포를 DMEM 배양을 준비한다. 이 매체는 최대 6 개월 동안 4 ° C에 저장할 수 있습니다. </li><li> 10 μM의 최종 농도 핵산 분해 효소가없는 물에 동결 건조 된 프라이머를 재현 탁. 저장 -20 ° C에서 프라이머를 재 - 중단. </li><li> radioimmunoprecipitation 분석 (RIPA) 완충액 (150 mM의 염화나...

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

육종은 중간 엽 계보의 희귀하지만, 매우 공격적인 암이다. 자신의 중간 엽 혈통에도 불구하고, 육종의 부분 집합은 더 상피와 같은 상태로 형질 전환을 겪을 것으로 보인다. 더 상피와 같은 종양을 가진 환자가 24 덜 공격적으로이 MET-같은 스위치는, 예후 관련이있다. 임상 관련성에도 불구하고, 육종 이러한 형질 전환을 운전하는 분자 메커니즘을 해결 몇몇 연구가있다. <p cla...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

표현형 가소성 세포 표현형 사이의 가역적 인 변화를 의미하고, 일반적으로 두 가지 유형, 상피 간 간엽 (EMT) 전환 및 중간 엽 간 상피 천이 (MET)로 분할된다. 이 표현형의 가소성은 개발 및 상처 치유 1과 다세포 생물의 정상적인 과정에서 중요한 역할을한다; 그러나,이 같은 경로 유전자 발현 프로그램 또한 섬유증, 질병을 초래할 수있다 (검토를 2, 3, 4), 암 전이 (참고 문헌 5, 6, 7의 평가 8). 전이 동안, 예를 들어, EMT 세포 극성, 세포 - 세포 상호 작용을 방해하고, 침략 9, 10 추진하고 있습니다. 함께, EMT 기여암 세포의 보급을 촉진하는 표현형 상태로의. 또한 EMT는 암 세포 대사 (6)의 규제 완화 약물 저항 (11), (12)의 개발을 포함 공격적인 표현형을 유도 다른 표현형 변화, 증가 된 종양 개시 능력 (13), (14)와 면역 회피 15 호스트의 호스트로 이끈다. 표현형 소성 잘 암의 진행에서 연구되고있다; 그러나, 육종은 표현형의 가소성을 나타낸다. 암의 표현형 가소성 같은 드라이버 중 일부는 또한 육종 소성 및 공격성에 기여하는 것처럼 흥미롭게도,이 나타납니다. 예를 들어, 육종 환자의 순환 성 종양 세포 (CTCS은)는 EpCAM, 일반적으로 상피 세포 (16)에서 발견되는 세포 표면 단백질을 발현하는 것으로 나타났다. ADDI전통적으로, 250 개 연조직 육종 샘플 상피 형상 또는 간엽 같은 유전자 발현에 기초로 분류 하였다. 상피와 같은 바이오 마커의 서명이있는 환자는 중간 엽 같은 바이오 마커의 서명 (17)을 가진 환자보다 더 나은 예후를했다. 이것은 더 상피와 같은 암 환자보다 중간 엽 같은 종양 18 환자에 비해 더 나은 결과를 보유하고있는 많은 암과 일치한다. 일부 육종이 생체와 MET와 일치 유전자 발현 경로를 표시하지만,이 표현형 가소성의 분자 토대는 잘 이해되지 유지. 육종 MET의 메커니즘과 드라이버를 연구하기 위해 우리는 두 가지 상피 특정 요소를 사용하여 MET 유도의 모델을 개발, 마이크로 RNA (은 miR) -200 가족과 grainyhead 같은 2 (GRHL2). 미르-200S는 messen의 3 &#39;의 UTRs에 결합함으로써 유전자 발현을 조절하는 작은 비 RNA를 코딩하는 가족게르 RNA와 단백질에 방지 번역. 미르 141, 미르 (200A)를 포함 하나, 미르-200B, 200C 미르, 미르-429을 포함한 타 - 미르-200 가족 개의 서브 그룹들로 구성된다. 미르-200 계열의 구성원은 상피 조직에 충실 미르-200S 손실은 암 (19)의 전이와 관련된다. 미르-200 계열은 정상 조직에 비해 20 연조직 육종에서 하향 조절된다. 미르-200S 유사하게, GRHL2 상피 개발 (21)에 대한 중요 핵심 레귤레이터이다. GRHL2 전사 인자는 E-cadherin의 상피 유전자를 상향 조절하는 방법은 두 가지 작용 1) 상피 세포에서 GRHL2 직접 EMT 마스터 레귤레이터 억압을 ZEB1 22; 2) GRHL2 직접 상피 유전자 (23)의 전사를 활성화합니다. 우리의 이전 연구는 것으로 나타났습니다 육종 세포 미르-200S와 GRHL2의 결합 된 표현MET-같은 표현형 (24)를 유도한다. 여기서는은 miR-200S 및 GRHL2의 이소성 발현하여 육종 세포에서 MET 유도 시험 관내 모델을 작성하는 구체적인 프로토콜을 제안한다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

표현형 소성은 세포가 일시적으로 다른 혈통의 특성을 얻을하는 현상을 말한다. 암 진행하는 동안, 표현형의 가소성은 침공, 보급 및 전이를 구동한다. 표현형 가소성 연구의 대부분은 상피 유래 암의 맥락에서되었지만 실제로, 그것은 mesenchymal- 유사한 현상을 겪고 육종의 부분 집합으로, 또한 표현형의 가소성을 전시, 기원 중간 엽 있습니다 육종을 밝혀 상피 성 전이 (MET). 여기서는 각각 순차적 GRHL2 및 미르 200 패밀리는 세포 형질 도입 및 형질 전환을 이용하여 표현 육종 환자 samples.We 관찰이 메티오닌과 같은 현상을 모방 미르-200 가족 grainyhead 같은 2 (GRHL2)를 포함하는 방법을 개발 더 나은 육종 세포에서 이러한 형질 전환의 분자 토대를 이해합니다. 미르 200S 및 GRHL2 표현 육종 세포는 상피 향상된 characterist 입증세포 형태와 상피와 중간 엽 바이오 마커의 변화에 ​​ICS. 이러한 방법을 사용하여 앞으로의 연구는 더 나은 등의 이동, 침윤, 전이 성향 및 치료 저항 등의 육종 세포에 대한 MET-같은 프로세스의 표현형의 결과를 이해하는 데 사용할 수 있습니다.

육종 세포에서 MET 유도를위한 스키마 육종 세포에서 MET와 같은 변화의 도입을위한 일반적인 타임 라인은도 1에 도시되어있다. 프로토콜은 미르-200 계열 (도 1b)의 형질 GRHL2 하였다 (도 1a)을 열 변환하는 것으로 시작한다. GRHL2 또는은 miR-200 가족만으로는 표현할 때 RD 세포의 모양에 영향을 ?...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

우리는 여기에서 마이크로 RNA-200의 가족과 같은 grainyhead 2 (GRHL2)의 결합에 기초 이소성 발현 육종 세포에서 중간 엽 상피 전환 (MET)을 유도하는 세포 배양 방법을 제시한다. 이 방법은 암의 공격성과 치료에 대한 표현형 가소성의 생물학적 영향을 이해하기 더 적합합니다.

육종 세포의 중간 엽 상피 전환 유도

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

Research

JoVE Journal

Developmental Biology

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

말초 혈액 조혈 전구 세포에서 인간 신경 줄기 세포의 직접 유도

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

연구

발생학

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

인간 만능 줄기 세포에서 전사 인자의 과발현에 의해 직접 Hemogenic 내피 세포의 유도 및 혈액

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

원심 중력에 의해 지방이 유래 줄기 세포의 연골 분화 유도

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

기본 및 확실 한 조 혈 창시자 인간 만능 줄기 세포에서의 감독

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

살아있는 개구리와 Zebrafish 태아의 저산소증 유도

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

수평 한 전체적인 거치 : 피부의 두껍고, 3 차원 조직 단면도를위한 비발 한 가공 그리고 화상 진찰 의정서

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

생활 그대로 Zebrafish에 단일 셀 Photoconversion

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

꼬마 선 충 생식 핵의 분포, 단백질, 및 골격을 전산 분석

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

유도 및 기본 인간 세포에서 세포 노화의 유효성 검사

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

낮은 혈 청 조건 하에서 심장 조상 세포에서 내 피 분화의 유도

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...