Name: induction of mesenchymal-epithelial transitions in sarcoma cells
Uploaded: 2017-04-07T15:00:00
Description: Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

JAS erkjenner støtte fra Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, og Duke University Ortopedisk avdeling. HL ble støttet av National Science Foundation (NSF) Senter for teoretisk Biological Physics (NSF PHY-1427654) og NSF DMS-1361411, og som en CPRIT (Cancer Prevention and Research Institute of Texas) Scholar i Cancer Research i delstaten Texas ved Rice University. KEW ble støttet av NIH F32 CA192630 MKJ og HL tjente nyttig diskusjon med Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, og Donald S. Coffey.

1. Fremstilling av reagenser <ol><li> Forbered DMEM i cellekultur ved å tilsette 50 ml føtalt bovint serum (FBS) og 5 ml penicillin-streptomycin (5.000 U / ml) til 500 ml DMEM. Dette mediet kan lagres ved 4 ° C i opp til seks måneder. </li><li> Resuspender lyofiliserte primere i nuklease-fritt vann til en sluttkonsentrasjon på 10 uM. Oppbevar resuspendert primere ved -20 ° C. </li><li> Forbered radioimmunopresipitasjonsanalyse assay (RIPA) buffer (150 mM NaCl, 0,5% natriumdeoxycholat, 0,1% SDS, 50 mM Tris, pH 8,...

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

Sarkomer er sjeldne, men svært aggressiv kreft i en mesenchymale avstamning. Til tross for deres mesenchymale avstamning, en undergruppe av sarkomer ser ut til å gjennomgå en fenotypisk overgang til en mer epitel-lignende tilstand. Dette MET-lignende bryter har prognostisk betydning, da pasienter med mer epitel-lignende svulster er mindre aggressive 24. Til tross for sin kliniske relevans, er det få studier som omhandler de molekylære mekanismene som driver disse fenotypiske overganger i sar...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Fenotypisk plastisitet refererer til en reversibel overgang mellom cellulære fenotyper, og er vanligvis delt inn i to typer, epitelial-til-mesenchymale (EMT) overganger og mesenchymale-til-epitelial overganger (MET). Dette fenotypisk plastisitet spiller en viktig rolle i normale prosesser i flercellede organismer, slik som utvikling og sårheling 1; imidlertid kan de samme reaksjonsveier og genekspresjon programmene også føre til sykdom, slik som fibrose (oversikt i 2, 3, 4) og karsinom metastase (gjennomgått i henvisningene 5, 6, 7, 8). I løpet av metastasering, for eksempel, forstyrrer EMT celle polaritet, og celle-celleinteraksjoner, og fremmer invasjon 9, 10. Sammen, EMT bidras til en fenotypisk tilstand som muliggjør kreftcelle formidling. I tillegg EMT fører også til en rekke andre fenotypiske endringer og som driver en aggressiv fenotype, inkludert Dereguleringen av kreftcellemetabolismen 6, utvikling av medikamentresistens 11, 12, økt tumor-initiering evne 13, 14 og vertens immun flukt 15. Fenotypisk plastisitet er blitt grundig undersøkt i karsinom progresjon; Men sarkomer også vise fenotypisk plastisitet. Interessant, ser det ut som om noen av de samme driverne av fenotypisk plastisitet i Kreftsvulster også bidra til sarkom plastisitet og aggressivitet. For eksempel har sirkulerende tumorceller (CTCs) fra sarcoma pasienter blitt vist å uttrykke EpCAM, et celleoverflateprotein som vanligvis finnes på epitelceller 16. Addimessig, ble 250 mykvevssarkoma prøvene kategorisert som epitel-lignende eller mesenchymale-lignende basert på genekspresjon. Pasienter i epitel-lignende biomarkør signatur hadde en bedre prognose enn pasienter med mesenchymale-lignende biomarkør signatur 17. Dette er i overensstemmelse med mange karsinomer, hvor pasienter med mer epitel-lignende karsinomer, har bedre resultater sammenlignet med pasienter med mer mesenchymale lignende tumorer 18. Mens noen sarkomer viser biomarkører og genekspresjon baner i samsvar med MET, forblir de molekylære grunnlaget for denne fenotypisk plastisitet dårlig forstått. For å studere mekanismene og sjåfører MET i sarkom vi utviklet en modell for MET-induksjon ved hjelp av to epitel-spesifikke faktorer, mikroRNA (MIR) -200 familie og grainyhead-lignende 2 (GRHL2). MIR-200s er en familie av små ikke-kodende RNA som regulerer genekspresjon ved å binde seg til de 3&#39; UTR av Messenger RNA og hindre oversettelse til protein. MIR-200-familien består av to undergrupper - en som inneholder MIR-141 og MIR-200A, og den andre, inkludert MIR-200b, MIR-200c, og MIR-429. Medlemmer av MIR-200-familien er anriket i epitelvev, og tapet av mir-200s er forbundet med metastase i karsinomer 19. MIR-200 familien er også nedregulert i bløtvevssarkomer sammenlignet med normalt vev 20. I likhet med de MIR-200S, er GRHL2 en nøkkel regulator som er viktig for epitelisk utvikling 21. Den GRHL2 transkripsjonsfaktor virker på to måter for å oppregulere epiteliale gener, slik som E-cadherin: 1) i epitelceller, GRHL2 direkte undertrykker EMT hovedregulator, ZEB1 22; og 2) GRHL2 aktiverer direkte transkripsjon av gener epiteliale 23. Våre tidligere undersøkelser har vist at kombinerte ekspresjon av MIR-200s og GRHL2 i sarkomcellerinduserer en MET-lignende fenotype 24. Her presenterer vi en detaljert protokoll for å skape en in vitro modell av MET-induksjon i sarcom-celler ved hjelp av ektopisk ekspresjon av MIR-200S og GRHL2.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

Fenotypisk plastisitet refererer til et fenomen der cellene forbigående får trekk fra en annen slekt. Under karsinom progresjon, driver fenotypisk plastisitet invasjon, spredning og metastase. Faktisk, mens det meste av studier av fenotypisk plastisitet har vært i sammenheng med epitel-avledet karsinomer, viser det seg sarkomer, som er mesenchymale opprinnelse, også vise fenotypisk plastisitet, med en undergruppe av sarkomer gjennomgår et fenomen som ligner en mesenchymal- epitelial overgang (MET). Her har vi utviklet en fremgangsmåte som omfatter MIR-200 familie og grainyhead-lignende 2 (GRHL2) for å etterligne dette MET-lignende fenomen ble observert i sarkom pasient samples.We sekvensielt uttrykker GRHL2 og MIR-200 ved bruk av familie celle transduksjon og transfeksjon, respektivt , for bedre å forstå de molekylære grunnlaget for disse fenotypiske overganger i sarkomceller. Sarcom-celler som uttrykker MIR-200s og GRHL2 vist forbedret epitelial characteristics i cellemorfologi og endring av epiteliale og mesenkymale biomarkører. Fremtidige studier ved bruk av disse fremgangsmåter kan anvendes for å bedre forstå de fenotypiske konsekvensene av MET-lignende prosesser på sarkomceller, som migrering, invasjon, metastatisk tilbøyelighet, og terapi motstand.

Schema for MET-induksjon i sarkomceller En generell tidslinje for induksjon av MET-lignende forandringer i sarcom-celler er vist i figur 1. Protokollen begynner ved å transdusere GRHL2 (figur 1A), etterfulgt av transfeksjon av den mir-200 familie (figur 1B). GRHL2 eller MIR-200 familiemedlemmer var ikke i stand til å påvirke utseendet av RD-celler når de uttrykkes alene, men ...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Vi presenterer her en cellekultur metode for indusering av mesenchymale-epitelial overganger (MET) i sarcom-celler basert på kombinerte ektopisk ekspresjon av mikroRNA-200 familiemedlemmer og grainyhead liknende 2 (GRHL2). Denne metoden er egnet for bedre å forstå den biologiske effekten av fenotypisk plastisitet på kreft aggressivitet og behandlinger.

Induksjon av Mesenchymale-Epitelial Transitions i sarkomceller

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

Research

JoVE Journal

Developmental Biology

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

Direkte Induction of Human Neural stamceller fra perifert blod Hematopoietiske stamceller

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

Direkte Induksjon av Hemogenic endotelet og Blood av Overekspresjon av transkripsjonsfaktorer i Human Pluripotent stamceller

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Chondrogenic Differensiering Induksjon av adipose-avledet stamceller ved Sentrifugal Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

Rettet differensiering av Primitive og Definitive blodkreft Progenitors fra menneskelige Pluripotent stamceller

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Induksjon av hypoksi i levende frosk og sebrafiskembryoer

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Horisontal helmontering: En romanbehandlings- og bildeprotokoll for tykke, tredimensjonale vev Tverrsnitt av huden

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

Encellede Photoconversion i levende intakt sebrafisk

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Beregningsorientert analyse av Caenorhabditis elegans Germline å studere distribusjon av kjerner, proteiner og Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

Induksjon og validering av mobilnettet Senescence i primære menneskeceller

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

Induksjon av Endothelial differensiering i Cardiac Progenitor celler Under lav Serum forhold

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...