Name: induction of mesenchymal-epithelial transitions in sarcoma cells
Uploaded: 2017-04-07T15:00:00
Description: Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

JAS reconhece o apoio do Instituto Duke Cancer, The Duke University Genitourinary Oncologia Laboratory, e do Departamento de Ortopedia da Universidade de Duke. HL foi apoiado pela National Science Foundation (NSF) Centro de Física Biológica Teórica (NSF PHY-1427654) e NSF DMS-1361411, e como CPRIT (Prevenção do Câncer e Instituto de Pesquisa do Texas) Scholar na Cancer Research do Estado do Texas na Universidade Rice. KEW foi apoiado pelo NIH F32 CA192630 MKJ e HL beneficiado a partir de discussões úteis com Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta, e Donald S. Coffey.

1. Preparação dos Reagentes <ol><li> Prepare DMEM para cultura de células por adição de 50 ml de soro fetal de bovino (FBS) e 5 mL de penicilina-estreptomicina (5000 U / mL) a 500 mL de meio DMEM. Este meio pode ser armazenado a 4 ° C durante até seis meses. </li><li> Ressuspender iniciadores liofilizados em água isenta de nuclease, a uma concentração final de 10 uM. iniciadores loja re-suspenso a -20 ° C. </li><li> Prepare ensaio de radioimunoprecipitação tampão (RIPA) (NaCl 150 mM, 0,5% de desoxicolato...

<ol>
	<li>Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition,+TGF-beta,+and+osteopontin+in+wound+healing+and+tissue+remodeling+after+injury.">Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury.</a> J Burn Care Res. 33 (3), 311-318 (2012).</li><li>Galichon, P., Finianos, S., Hertig, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMT-MET+in+renal+disease:+should+we+curb+our+enthusiasm.">EMT-MET in renal disease: should we curb our enthusiasm.</a> Cancer Lett. 341 (1), 24-29 (2013).</li><li>Carew, R. M., Wang, B., Kantharidis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+EMT+in+renal+fibrosis.">The role of EMT in renal fibrosis.</a> Cell Tissue Res. 347 (1), 103-116 (2012).</li><li>Willis, B. C., Borok, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TGF-beta-induced+EMT:+mechanisms+and+implications+for+fibrotic+lung+disease.">TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease.</a> Am J Physiol Lung Cell Mol Physiol. 293 (3), L525-L534 (2007).</li><li>Ye, X., Weinberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Plasticity:+A+Central+Regulator+of+Cancer+Progression.">Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression.</a> Trends Cell Biol. 25 (11), 675-686 (2015).</li><li>Li, L., Li, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+in+human+cancer:+comprehensive+reprogramming+of+metabolism,+epigenetics,+and+differentiation.">Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation.</a> Pharmacol Ther. 150, 33-46 (2015).</li><li>Tsai, J. H., Yang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+plasticity+in+carcinoma+metastasis.">Epithelial-mesenchymal plasticity in carcinoma metastasis.</a> Genes Dev. 27 (20), 2192-2206 (2013).</li><li>Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+epithelial+plasticity+in+prostate+cancer+dissemination+and+treatment+resistance.">The role of epithelial plasticity in prostate cancer dissemination and treatment resistance.</a> Cancer Metastasis Rev. 33 (2-3), 441-468 (2014).</li><li>Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+Migration+and+Invasion+Uncoupled:+Increased+Migration+Is+Not+an+Inexorable+Consequence+of+Epithelial-to-Mesenchymal+Transition.">Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition.</a> Mol Cell Biol. 34 (18), 3486-3499 (2014).</li><li>Mathow, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeb1+affects+epithelial+cell+adhesion+by+diverting+glycosphingolipid+metabolism.">Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism.</a> EMBO Rep. 16 (3), 321-331 (2015).</li><li>Ware, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mechanism+of+resistance+to+gefitinib+mediated+by+cellular+reprogramming+and+the+acquisition+of+an+FGF2-FGFR1+autocrine+growth+loop.">A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop.</a> Oncogenesis. 2, e39 (2013).</li><li>Yauch, R. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial+versus+mesenchymal+phenotype+determines+in+vitro+sensitivity+and+predicts+clinical+activity+of+erlotinib+in+lung+cancer+patients.">Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients.</a> Clin Cancer Res. 11 (24 Pt 1), 8686-8698 (2005).</li><li>Jolly, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+elucidating+the+connection+between+epithelial-mesenchymal+transitions+and+stemness.">Towards elucidating the connection between epithelial-mesenchymal transitions and stemness.</a> J R Soc Interface. 11 (101), 20140962 (2014).</li><li>Mani, S. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+epithelial-mesenchymal+transition+generates+cells+with+properties+of+stem+cells.">The epithelial-mesenchymal transition generates cells with properties of stem cells.</a> Cell. 133 (4), 704-715 (2008).</li><li>Chen, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metastasis+is+regulated+via+microRNA-200/ZEB1+axis+control+of+tumour+cell+PD-L1+expression+and+intratumoral+immunosuppression.">Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression.</a> Nat Commun. 5, 5241 (2014).</li><li>Nicolazzo, C., Gradilone, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Significance+of+circulating+tumor+cells+in+soft+tissue+sarcoma.">Significance of circulating tumor cells in soft tissue sarcoma.</a> Anal Cell Pathol (Amst). , 697395 (2015).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-epithelial+transition+in+sarcomas+is+controlled+by+the+combinatorial+expression+of+miR-200s+and+GRHL2.">Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2.</a> Mol Cell Biol. , (2016).</li><li>Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-Mesenchymal+Transition+Phenotype+Is+Associated+with+Clinicopathological+Factors+That+Indicate+Aggressive+Biological+Behavior+and+Poor+Clinical+Outcomes+in+Invasive+Breast+Cancer.">Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer.</a> J Breast Cancer. 18 (3), 256-263 (2015).</li><li>Humphries, B., Yang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microRNA-200+family:+small+molecules+with+novel+roles+in+cancer+development,+progression+and+therapy.">The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy.</a> Oncotarget. 6 (9), 6472-6498 (2015).</li><li>Renner, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+profiling+of+primary+high-grade+soft+tissue+sarcomas.">MicroRNA profiling of primary high-grade soft tissue sarcomas.</a> Genes Chromosomes Cancer. 51 (11), 982-996 (2012).</li><li>Petrof, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+GRHL2+result+in+an+autosomal-recessive+ectodermal+Dysplasia+syndrome.">Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome.</a> Am J Hum Genet. 95 (3), 308-314 (2014).</li><li>Werner, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+roles+of+the+transcription+factor+grainyhead-like+2+(GRHL2)+in+breast+cancer.">Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer.</a> J Biol Chem. 288 (32), 22993-23008 (2013).</li><li>Werth, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factor+grainyhead-like+2+regulates+the+molecular+composition+of+the+epithelial+apical+junctional+complex.">The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex.</a> Development. 137 (22), 3835-3845 (2010).</li><li>Somarelli, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal-Epithelial+Transition+in+Sarcomas+Is+Controlled+by+the+Combinatorial+Expression+of+MicroRNA+200s+and+GRHL2.">Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2.</a> Mol Cell Biol. 36 (19), 2503-2513 (2016).</li><li>Varma, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcription+factors+Grainyhead-like+2+and+NK2-homeobox+1+form+a+regulatory+loop+that+coordinates+lung+epithelial+cell+morphogenesis+and+differentiation.">The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation.</a> J Biol Chem. 287 (44), 37282-37295 (2012).</li><li>Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+fluorescent+protein+expressing+cells+by+flow+cytometry.">Analysis of fluorescent protein expressing cells by flow cytometry.</a> Methods Mol Biol. 263, 239-258 (2004).</li><li>Zhao, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-content+morphological+screen+identifies+novel+microRNAs+that+regulate+neuroblastoma+cell+differentiation.">A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation.</a> Oncotarget. 5 (9), 2499-2512 (2014).</li><li>Borowicz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+soft+agar+colony+formation+assay.">The soft agar colony formation assay.</a> J Vis Exp. (92), e51998 (2014).</li><li>Yang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+proteomics+and+genomics+analysis+reveals+a+novel+mesenchymal+to+epithelial+reverting+transition+in+leiomyosarcoma+through+regulation+of+slug.">Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug.</a> Mol Cell Proteomics. 9 (11), 2405-2413 (2010).</li><li>Alba-Castellon, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Snail1+expression+is+required+for+sarcomagenesis.">Snail1 expression is required for sarcomagenesis.</a> Neoplasia. 16 (5), 413-421 (2014).</li><li>Takaishi, M., Tarutani, M., Takeda, J., Sano, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mesenchymal+to+Epithelial+Transition+Induced+by+Reprogramming+Factors+Attenuates+the+Malignancy+of+Cancer+Cells.">Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells.</a> PLoS One. 11 (6), e0156904 (2016).</li></ol>

Sarcomas são cancros raros, mas altamente agressivas de uma linhagem mesenquimal. Apesar da sua linhagem mesenquimal, um subconjunto dos sarcomas parece sofrer uma transição fenotípica para um estado mais epitelial semelhante. Este interruptor MET-like tem relevância prognóstico, como pacientes com mais tumores epiteliais, como são menos agressivos 24. Apesar da sua relevância clínica, existem poucos estudos sobre os mecanismos moleculares de condução dessas transições fenotípicas e...

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.
One of the authors&#39; names was corrected from:
Shenghan Xu
to:
Shengnan Xu

An erratum was issued for: <a href="https://www.jove.com/video/55520/induction-of-mesenchymal-epithelial-transitions-in-sarcoma-cells">Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells</a>. An author name was updated.

Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

plasticidade fenotípica refere-se a uma transição reversível entre os fenótipos celulares, e é geralmente divididos em dois tipos, epitelial-a-mesenquimal (EMT) transições e transições mesenquimais-a-epitelial (MET). Esta plasticidade fenotípica desempenha um papel importante em processos normais de organismos multicelulares, tais como desenvolvimento e cicatrização de feridas 1; no entanto, estas mesmas vias e programas de expressão génica também pode levar a doenças, tais como fibrose (revisto em 2, 3, 4) e a metástase de carcinoma (revisto em referências 5, 6, 7, 8). Durante a metástase, por exemplo, EMT perturba polaridade celular, as interacções célula-célula, e promove a invasão 9, 10. Juntos, EMT contribuirs para um estado fenotípico que facilita a disseminação de células de cancro. Além disso, EMT também conduz a uma série de outras alterações fenotípicas que dirigem um fenipo agressivo, incluindo a desregulação do metabolismo celular de cancro 6, o desenvolvimento de resistência ao fármaco 11, 12, o aumento da capacidade do tumor-iniciação 13, 14 e 15 acolher evasão imune. plasticidade fenotípica tem sido bem estudada na progressão do carcinoma; no entanto, os sarcomas também exibem plasticidade fenotípica. Curiosamente, parece que alguns dos mesmos drivers de plasticidade fenotípica em carcinomas também contribuem para a plasticidade sarcoma e agressividade. Por exemplo, células tumorais circulantes (CTCs) a partir de pacientes de sarcoma foram mostrados para expressar o EpCAM, uma proteína da superfície celular que é tipicamente encontrado em culas epiteliais 16. Addicionalmente, 250 amostras de sarcoma dos tecidos moles foram categorizados como epitelial-mesenquimal como ou semelhantes com base na expressão do gene. Pacientes na assinatura biomarcador epitelial-like tiveram melhor prognóstico do que pacientes com a assinatura biomarcador mesenquimais-like 17. Isto é consistente com muitos carcinomas, em que os doentes com mais de carcinomas epiteliais semelhantes têm melhores resultados em comparação com os pacientes com mais do mesquima semelhante a tumores 18. Enquanto alguns sarcomas exibir biomarcadores e vias de expressão génica consistentes com MET, as bases moleculares da plasticidade fenotípica permanecem pouco compreendidos. Para estudar os mecanismos e os condutores de MET em sarcoma foi desenvolvido um modelo de indução MET utilizando dois factores específicos do epitélio, o microARN (MIR) -200 família e grainyhead-like 2 (GRHL2). Os miR-200 são uma família de pequenos RNAs não-codificantes que regulam a expressão de genes por ligao ao dos UTRs 3 de messenger ARN e evitando a tradução na proteína. A família de miR-200 consiste em dois sub-grupos - um contendo miR-141 e miR-200a, e o outro incluindo o miR-200b, miR-200c, e miR-429. Os membros da família de miR-200 são enriquecidos em tecidos epiteliais, e a perda de miR-200 está associado com a metástase em carcinomas 19. A família de miR-200 também é regulada negativamente nos sarcomas de tecidos moles em comparação com o tecido normal 20. Similar aos miR-200s, GRHL2 é um regulador chave que é importante para o desenvolvimento epitelial 21. O factor de transcrição GRHL2 actua em dois modos para regular positivamente genes epiteliais, tais como a E-caderina: 1) Em células epiteliais, GRHL2 reprime directamente o principal regulador EMT, ZEB1 22; e 2) GRHL2 activa directamente a transcrição de genes epiteliais 23. As nossas investigações anteriores mostraram que a expressão combinada de miR-200s e GRHL2 em células de sarcomainduz um fenótipo MET-24 como. Aqui, nós apresentamos um protocolo detalhado para criar um modelo in vitro de indução MET em células de sarcoma usando a expressão ectópica de miR-200s e GRHL2.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Countess automated counter</td>
			<td>Life technologies</td>
			<td>AMQAX1000</td>
			<td></td>
		</tr>
		<tr>
			<td>Countess cell counting chamber slides</td>
			<td>Invitrogen</td>
			<td>C10283</td>
			<td></td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher</td>
			<td>A24811</td>
			<td></td>
		</tr>
		<tr>
			<td>Odyssey Fc</td>
			<td>LI-COR Inc</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ViiA7 Real Time PCR System</td>
			<td>Thermo Fisher</td>
			<td>4453536</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR microplate</td>
			<td>Corning</td>
			<td>321-29-051</td>
			<td></td>
		</tr>
		<tr>
			<td>KAPA SYBR Fast Universal qPCR Kit</td>
			<td>KAPA Biosystems</td>
			<td>KK4602</td>
			<td></td>
		</tr>
		<tr>
			<td>Starting Block (PBS) Blocking Buffer</td>
			<td>Thermo Fisher</td>
			<td>37538</td>
			<td>BSA-based blocking buffer</td>
		</tr>
		<tr>
			<td>Agarose General Purpose LE</td>
			<td>Genesee Scientific</td>
			<td>20-102</td>
			<td></td>
		</tr>
		<tr>
			<td>10X Tris/Glycine/SDS Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0732</td>
			<td>Running buffer</td>
		</tr>
		<tr>
			<td>10X Tris/Glycine Buffer</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0734</td>
			<td>Transfer buffer</td>
		</tr>
		<tr>
			<td>RIPA Buffer</td>
			<td>Sigma Life Sciences</td>
			<td>SLBG8489</td>
			<td></td>
		</tr>
		<tr>
			<td>Amersham Protran 0.45 &#956;m nitrocellulose</td>
			<td>GE Healthcare Lifesciences</td>
			<td>10600012</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-RNA MiniPrep Kit</td>
			<td>Genesee Scientific</td>
			<td>11-358</td>
			<td></td>
		</tr>
		<tr>
			<td>Laemmli Sample Buffer (4X)</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1610747</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini Trans-Blot Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1703930</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Protean Tetra Cell</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>1658005EDU</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS</td>
			<td>Life technologies</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM</td>
			<td>Life technologies</td>
			<td>11995-065</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAi Max</td>
			<td>Thermo Fisher</td>
			<td>13778150</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine 2000 Ragents</td>
			<td>Thermo Fisher</td>
			<td>11668019</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin Streptomycin</td>
			<td>Life technologies</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>miRVana miRNA mimic negative control #1</td>
			<td>Thermo Fisher</td>
			<td>4464058</td>
			<td>neg miRNA</td>
		</tr>
		<tr>
			<td>hsa-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4464066</td>
			<td>miR200A</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200B</td>
		</tr>
		<tr>
			<td>has-miR-200 mirVana miRNA mimic</td>
			<td>Thermo Fisher</td>
			<td>4404066</td>
			<td>miR200C</td>
		</tr>
		<tr>
			<td>Opti-MEM</td>
			<td>Life technologies</td>
			<td>11088-021</td>
			<td>serum-free media</td>
		</tr>
		<tr>
			<td>anti-Ecadherin antibody</td>
			<td>BD Bioscience</td>
			<td>610182</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-beta actin</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-69879</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-EpCam</td>
			<td>Ab Serotec</td>
			<td>MCA18706</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-ZO1</td>
			<td>Invitrogen</td>
			<td>402200</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800W</td>
			<td>LI-COR Inc</td>
			<td>925-32210</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680</td>
			<td>LI-COR Inc</td>
			<td>926-32223</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-mouse AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>A211241</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-rabbit AlexaFluor 647</td>
			<td>Thermo Fisher</td>
			<td>ab150075</td>
			<td></td>
		</tr>
		<tr>
			<td>Halt Protease and Phosphatesse Inhibitor</td>
			<td>Thermo Fisher</td>
			<td>1861281</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color</td>
			<td>Bio-Rad Laboratories Inc</td>
			<td>161-0374</td>
			<td></td>
		</tr>
		<tr>
			<td>Partec CellTrics</td>
			<td>Sysmex</td>
			<td>04-004-2326</td>
			<td>30 &#956;m filter for flow</td>
		</tr>
		<tr>
			<td>GAPDH-F</td>
			<td>IDT</td>
			<td></td>
			<td>AGCCACATCGCTCAGACAC</td>
		</tr>
		<tr>
			<td>GAPDH-R</td>
			<td>IDT</td>
			<td></td>
			<td>GCCCAATACGACCAAATCC</td>
		</tr>
		<tr>
			<td>Ecadherin-F</td>
			<td>IDT</td>
			<td></td>
			<td>TGGAGGAATTCTTGCTTTGC</td>
		</tr>
		<tr>
			<td>Ecadherin-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGCTCTCCTCCGAAGAAAC</td>
		</tr>
		<tr>
			<td>ZEB1-F</td>
			<td>IDT</td>
			<td></td>
			<td>GCATACAGAACCCAACTTGAACGTC</td>
		</tr>
		<tr>
			<td>ZEB1-R</td>
			<td>IDT</td>
			<td></td>
			<td>CGATTACACCCAGACTGC</td>
		</tr>
		<tr>
			<td>NOTCH-F</td>
			<td>IDT</td>
			<td></td>
			<td>GGCAATCCGAGGACTATGAG</td>
		</tr>
		<tr>
			<td>NOTCH-R</td>
			<td>IDT</td>
			<td></td>
			<td>CTCAGAACGCACTCGTTGAT</td>
		</tr>
		<tr>
			<td>nitro blue tetrazolium&#160;</td>
			<td>Sigma</td>
			<td>N5514</td>
			<td></td>
		</tr>
		<tr>
			<td>hexadimethrine bromide</td>
			<td>Sigma</td>
			<td>H9268</td>
			<td>polybrene</td>
		</tr>
		<tr>
			<td>3 mL syringe</td>
			<td>BD Bioscience</td>
			<td>309657</td>
			<td></td>
		</tr>
		<tr>
			<td>Sterile syringe filter</td>
			<td>VWR</td>
			<td>28145-505</td>
			<td></td>
		</tr>
		<tr>
			<td>5mL polypropylene round-bottom tube</td>
			<td>352063</td>
			<td></td>
			<td>flow cytometry tubes</td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher</td>
			<td>4368814</td>
			<td>reverse transcription kit</td>
		</tr>
		<tr>
			<td>4% paraformaldyhyde</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-281612</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton-X100</td>
			<td>Sigma</td>
			<td>93443</td>
			<td></td>
		</tr>
		<tr>
			<td>bovine serum albumin</td>
			<td>Sigma</td>
			<td>A7906</td>
			<td></td>
		</tr>
	</tbody>
</table>

induction of mesenchymal-epithelial transitions in sarcoma cells

plasticidade fenotípica refere-se a um fenómeno no qual as células transitoriamente ganhar traços de outra linhagem. Durante a progressão do carcinoma, plasticidade fenotípica impulsiona invasão, disseminação e metástase. Com efeito, enquanto que a maioria dos estudos de plasticidade fenotípica têm sido no contexto de carcinomas epiteliais derivadas de, verifica-se os sarcomas, os quais são mesenquimal de origem, também exibem plasticidade fenotípica, com um subconjunto de sarcomas submetidos a um fenómeno que se assemelha a um mesenchymal- transição epitelial (MET). Aqui, nós desenvolvemos um método compreendendo a família de miR-200 e grainyhead-like 2 (GRHL2) para imitar este fenómeno MET-como observado no sarcoma paciente samples.We sequencialmente expressar GRHL2 e a família de miR-200 utilizando a transdução de células e transfecção, respectivamente , para compreender melhor as bases moleculares destas transições fenotípica em células de sarcoma. células de sarcoma que expressam miR-200s e GRHL2 demonstrado characterist epitelial aumentadaics na morfologia celular e alteração de biomarcadores epiteliais e mesenquimais. Estudos futuros utilizando estes métodos podem ser utilizados para compreender melhor as consequências fenotipicas de processos MET-como sobre células de sarcoma, tais como migração, invasão, propensão metastática, e resistência à terapia.

Esquema para a indução de MET em células de sarcoma Uma linha do tempo geral para a indução de alterações MET-como em células de sarcoma é mostrado na Figura 1. O protocolo começa por transdução GRHL2 (Figura 1A), seguido por transfecção da família miR-200 (Figura 1B). membros da família GRHL2 ou miR-200 não foram capazes de afectar a aparência de células RD qu...

Watch this Scientific Journal Video about Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells at JoVE.com

Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells

Apresentamos aqui um método de cultura de células para a indução de transições mesenquimais-epiteliais (MET) em células de sarcoma com base na expressão ectópica combinado de microARN-200 e os membros da família grainyhead-like 2 (GRHL2). Este método é adequado para a melhor compreensão do impacto biológico de plasticidade fenotípica sobre a agressividade e tratamentos do cancro.

A indução de transições mesenquimais-epiteliais em células de sarcoma

Phenotypic plasticity refers to a phenomenon in which cells transiently gain traits of another lineage. During carcinoma progression, phenotypic ...

Research

JoVE Journal

Developmental Biology

Direct Induction of Human Neural Stem Cells from Peripheral Blood Hematopoietic Progenitor Cells

Indução direta de Neurais Human células-tronco de sangue periférico células progenitoras hematopoéticas

Human disease specific neuronal cultures are essential for generating in vitro models for human neurological diseases. However, the lack of access to ...

Biologia do Desenvolvimento

Direct Induction of Hemogenic Endothelium and Blood by Overexpression of Transcription Factors in Human Pluripotent Stem Cells

A indução direta de hegemônicos endotélio e sangue por sobre-expressão de fatores de transcrição na pluripotentes humanas Células-Tronco

During development, hematopoietic cells arise from a specialized subset of endothelial cells, hemogenic endothelium (HE). Modeling HE development in vitro ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Condrogênica Diferenciação indução de células-tronco derivadas de tecido adiposo por gravidade centrífugas

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

Dirigido a diferenciação de progenitores hematopoiéticos primitivo e definitiva de células pluripotentes humanas

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Indução de hipóxia em sapos vivos e embriões de peixe-zebra

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Horizontal Whole Mount: A Novel Processing and Imaging Protocol for Thick, Three-dimensional Tissue Cross-sections of Skin

Horizontal Whole Mount: um protocolo de processamento e imagem de Novel para secções transversais grossas de tecidos tridimensionais

Processing a tissue of interest to generate a microscopic image that supports a scientific argument can be challenging. The acquisition of high-quality ...

Single-cell Photoconversion in Living Intact Zebrafish

Photoconversion de célula única no Zebrafish intacta vida

Animal and plant tissue is composed of distinct populations of cells. These cells interact over time to build and maintain the tissue and can cause ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

Análise computacional do Germline Caenorhabditis elegans , para estudar a distribuição de núcleos, as proteínas e o citoesqueleto

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Induction and Validation of Cellular Senescence in Primary Human Cells

Indução e validação da senescência celular em células humanas primárias

Cellular senescence is a state of permanent cell cycle arrest activated in response to different damaging stimuli. Activation of cellular senescence is a ...

Induction of Endothelial Differentiation in Cardiac Progenitor Cells Under Low Serum Conditions

Indução de diferenciação endotelial em células progenitoras cardíacas sob condições de baixo de soro

Cardiac progenitor cells (CPCs) may have therapeutic potential for cardiac regeneration after injury. In the adult mammalian heart, intrinsic CPCs are ...