Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

ونود أن نشكر G. فولدا (مركز المجهر الإلكتروني، جامعة روستوك، ألمانيا) للدعم الفني في الحصول على الصور TEM النانوية مغنطيسية مسايرة فائقة superparamagnetic تصفيتها وفي إجراء تحليل الأشعة السينية الخاصة بهم. وأيد الأعمال التي تقوم بها في RTC روستوك من قبل الوزارة الاتحادية للتعليم والبحوث ألمانيا (FKZ 0312138A، FKZ 316159 وVIP + 03VP00241) والدولة كروا مكلنبورغ الغربية مع الصناديق الهيكلية للاتحاد الأوروبي (ESF / IV-WM-B34- 0030/10 وكلية العلوم التربوية / IV-BM-B35-0010 / 12) والتي DFG (DA 1296-1)، والرطوبة، مؤسسة، ومؤسسة القلب الألمانية (F / 01/12). وأيد فرانك ويخورست من قبل برنامج أبحاث الاتحاد الأوروبي FP7 &quot;Nanomag&quot; FP7-NMP-2013-الكبيرة-7.

وقد تم الحصول على الحبل السري الإنسان لعزل الخلايا بعد الولادة من علم والنساء الأصحاء الذين أعطى موافقتهم الخطية على استخدام هذه المواد لأغراض البحث وفقا لإعلان هلسنكي. وافقت لجنة أخلاقية من جامعة روستوك الدراسة التي قدمت (ريج. رقم أ 2011 06، لفترة طويلة 23 سبتمبر 201...

يتم تقديم إنتاج خلايا معدلة وراثيا محملة النانوية مغنطيسية مسايرة فائقة superparamagnetic لتوجيهاتهم مزيد من التحكم مغناطيسيا في البروتوكول الحالي. التطبيق الناجح لهذه الاستراتيجية تسمح لتسوية بعض الصعوبات من العلاج بالخلايا، مثل انخفاض الاحتفاظ والفقراء engraftment في المنط?...

الجينات والعلاج بالخلايا هي أدوات قوية لديها القدرة على حل التحديات الراهنة في علاج الأمراض القلبية الوعائية. وعلى الرغم من أن كلا من هذين النهجين يجري حاليا اختبارها في التجارب السريرية، فهي ليست مستعدة بعد للالتطبيق السريري واسعة 1. والجدير بالذكر أن نهج مشترك لمواجهة التحديات من الجينات والعلاج بالخلايا هو تطوير ناقلات توصيل الجينات متعددة الوظائف مناسبة لتطبيق السريرية. عدم وجود أنظمة توصيل الجينات آمنة وفعالة هو مصدر القلق الرئيسي من العلاج الجيني. في الوقت نفسه، والهندسة الوراثية من المنتجات الخلوية قبل الزرع يمكن التغلب على التحديات الخطيرة للعلاج الخلايا، مثل انخفاض الكفاءة (على سبيل المثال، في مجال القلب، ويتحقق فقط ~ 5٪ من تحسين وظيفي بعد الخلايا الجذعية زرع 1 ) وضعف الاحتفاظ / engraftment في موقع الإصابة (أي الاحتفاظ خلية تنخفض 5-10٪ في غضون دقائق إلى ساعات بوالحادي والتطبيق، بغض النظر عن مسار إدارة 2، 3، 4). حتى الآن، ناقلات فيروسية تتجاوز الى حد كبير أنظمة غير الفيروسية من حيث الكفاءة، مما أدى إلى تطبيقها على نطاق أوسع في التجارب السريرية (~ 67٪) 5. ومع ذلك، والمركبات الفيروسية تحمل مخاطر جسيمة، مثل المناعية (والاستجابة الالتهابية لاحقة، مع مضاعفات خطيرة)، قدرة التوريم، والقيود في حجم المادة الوراثية تنفيذ 6. بسبب هذه المخاوف المتعلقة بالسلامة وارتفاع تكاليف الإنتاج ناقلات فيروسية، واستخدام أنظمة غير الفيروسية هو الأفضل في بعض الحالات 7 و 8. انها مناسبة خاصة للاضطرابات التي تتطلب التصحيح الجيني عابرة، مثل التعبير عن عوامل النمو السيطرة على الأوعية الدموية (على سبيل المثال، لعلاج الأمراض القلبية الوعائية) أو deliveراي من اللقاحات. في مجموعتنا، تم تصميم نظام التسليم عن طريق الجمع بين تشعبت 25 كيلو دالتون polyethyleneimine (PEI) وجزيئات أكسيد الحديد مغنطيسية مسايرة فائقة superparamagnetic (MNP) تربطهم البيوتين streptavidin التفاعل 9. هذه النواقل هو أداة محتملة للهندسة الوراثية للخلايا، مما يسمح للمغنطة في وقت واحد من قبل الزرع. يوفر هذا الأخير أساسا لالمغناطيسي التوجيه / الاحتفاظ بها، وهي واعدة خاصة في الوقت الحاضر، وأساليب الاستهداف المتقدمة المغناطيسي ويجري حاليا وضع بنجاح (10). وعلاوة على ذلك، مما أدى الخلايا تستجيب مغناطيسيا لديها القدرة على أن تكون غير جراحية رصدها بواسطة التصوير بالرنين المغناطيسي (MRI) أو التصوير الجسيمات المغناطيسية 11 و 12. في حالة حدوث الموجه PEI / MNP، البولي أمينات يضمن التكثيف الحمض النووي، وبالتالي الحماية من عامل المهينة<html> الصورة، استيعاب ناقلات في الخلايا، وendosomal الهروب 5. وMNPs تكمل خصائص جزيرة الأمير إدوارد، وليس فقط من حيث التوجيه المغناطيسي، ولكن أيضا عن طريق الحد من المعروف PEI سمية 7 و 13 و 14. سابقا، تم تعديل PEI / MNP خصائص ناقلات من حيث الكفاءة والتسليم (أي PDNA وميرنا) والسلامة باستخدام الخلايا الليفية والخلايا الجذعية الوسيطة الإنسان 15 و 16. في هذه المخطوطة، يوصف بروتوكول مفصلة على تطبيق مبادرة التعليم الفلسطينية / MNPs لتوليد الخلايا المعدلة ميرنا 17. لهذا الغرض، وتستخدم HUVECs وتمثل نموذجا أنشئت لفي المختبر الأوعية الدموية. فهي صعبة ل transfect وعرضة للتأثير السام 18، 19،الحمار = &quot;XREF&quot;&gt; 20. وبالإضافة إلى ذلك، ونحن نقدم خوارزمية لتقييم مثل هذه الخلايا في المختبر، بما في ذلك الاستهداف، والاتصالات بين الخلايا، وكشف التصوير بالرنين المغناطيسي.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

حتى الآن، فإن العلاجات الجراحية والدوائية المتاحة لأمراض القلب والأوعية الدموية (الأمراض القلبية الوعائية) محدودة وغالبا ما الملطفة. وفي الوقت نفسه، الجينات والخلايا العلاجات هي النهج البديلة واعدة للغاية لعلاج الأمراض القلبية الوعائية. ومع ذلك، فإن التطبيق السريري واسعة من العلاج الجيني يقتصر إلى حد كبير بسبب عدم وجود أنظمة توصيل الجينات المناسبة. تطوير ناقلات توصيل الجينات المناسبة يمكن أن توفر حلا للتحديات الراهنة في العلاج بالخلايا. وعلى وجه الخصوص، السلبيات الموجودة، مثل كفاءة محدودة ومنخفضة الاحتفاظ الخلايا في الجهاز المصاب، يمكن التغلب عليها عن طريق الهندسة الخلية المناسبة (أي الوراثية) قبل الزرع. يصف بروتوكول المعروضة تعديل عابر فعالة وآمنة من الخلايا البطانية باستخدام جسيمات متناهية الصغر polyethyleneimine مغنطيسية مسايرة فائقة superparamagnetic المغناطيسي (PEI / MNP) المستندة إلى متجه التسليم. أيضا، يتم تعريف خوارزمية والأساليب لتوصيف الخلية. وintracellu ناجحةوقد حقق تسليم لار من الرنا الميكروي (مير) في الوريد السري الخلايا البطانية الإنسان (HUVECs) دون التأثير على بقاء الخلية، وظائف، أو الاتصالات بين الخلايا. وعلاوة على ذلك، فقد أثبت هذا النهج لإحداث تأثير وظيفي قوي في خارجية المنشأ قدم مير. الأهم من ذلك أن تطبيق هذا ناقل القائمة MNP-يضمن مغنطة الخلية، مع المرافق إمكانيات استهداف المغناطيسي MRI وتتبع غير الغازية. وهذا قد تقدم أساسا لتسترشد مغناطيسيا، علاجات الخلايا المعدلة وراثيا التي يمكن رصدها غير جراحية مع التصوير بالرنين المغناطيسي.

والغرض الرئيسي من البروتوكول المقترح هو إنتاج الخلايا المستجيبة مغناطيسيا مير المعدلة وإجراء توصيف دقيق لها (الشكل 1). ونتيجة لذلك، والخلايا transfected بكفاءة، تستجيب لاختيار المغناطيسية والتوجيه وكشف مع التصوير بالرنين المغناطيسي، يجب الحص?...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

توضح هذه المخطوطة كفاءة، والتسليم غير فيروسي مير إلى الخلايا البطانية التي كتبها ناقل PEI / MNP ومغنطة بهم. وهكذا، بالإضافة إلى التعديل الوراثي، ويسمح هذا النهج لتوجيه الخلايا المغناطيسي MRI والكشف. هذه التقنية يمكن استخدامها لتحسين خصائص المنتجات خلية العلاجية.

إعداد و<em&gt; في المختبر</em&gt; توصيف ممغنط مير تعديل الخلايا البطانية

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

القرنية تحضير الأنسجة من الجهات المانحة لغشائي keratoplasty

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

العزلة، وتوصيف المقارن التمييز بين الخلايا الجذعية البشرية الأسنان اللب المستمدة من الأسنان الدائمة باستخدام طريقتين مختلفتين

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

تمتد في الدماغ الخلايا البطانية الاوعية الدموية الدقيقة (cEND) بوصفه<em&gt; في المختبر</em&gt; صدمة إصابات الدماغ نموذج من حاجز الدم في الدماغ

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

في الطريقة المختبر لمراقبة التفاعلات بوساطة selectin E-البروستاتا بين الخلايا السرطانية المنتشرة المستمدة من المرضى والبطانية الإنسان خلايا

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

القرنية تحضير الأنسجة المانحة لديسميه غشاء القرنية غشائي

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

في المختبر توصيف الوظيفي للماوس القولون والمستقيم وارد النهايات

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

عزل خلايا الإنسان اللمفاوي البطانية التي كتبها متعدد المعلمة تنشيط الإسفار الفرز خلية

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

دراسة سرطان البنكرياس الجذعية خصائص الخلايا لتطوير استراتيجيات علاجية جديدة

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

العزلة وثقافة توسيع ورم محددة الخلايا البطانية

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

العزلة والثقافة من الخلايا البطانية الأولية من الشرايين والأوردة الكلاب

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...