Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

ברצוננו להודות ג פולדה (מרכז מיקרוסקופי אלקטרונים, רוסטוק אונ&#39;, גרמניה) עבור התמיכה הטכנית ברכישת תמונות TEM של חלקיקים פאראמגנטי מסוננים בביצוע ניתוח רנטגן שלהם. העבודה מתבצעת על רוסטוק RTC נתמכה על ידי המשרד הפדרלי לחינוך ולמחקר גרמניה (FKZ 0312138A, FKZ 316,159 ו VIP + 03VP00241) ואת פומרניה מדינת מקלנבורג-מערב עם הקרנות המבניות של האיחוד האירופי (ESF / IV-WM-B34- 0030/10 ו ESF / IV-BM-B35-0010 / 12) ועל ידי DFG (DA 1296-1), ורטיבות-קרן, וקרן הלב גרמנית (F / 01/12). פרנק Wiekhorst נתמכה על ידי תוכנית המחקר FP7 האיחוד האירופי &quot;Nanomag&quot; FP7-NMP-2013-גדול 7.

מייתרי טבור אדם בידוד תא התקבלו לאחר לידה מ הודיעו, נשים בריאות שנתנו הסכימו בכתב אל השימוש בחומר זה לצורך המחקר על פי הצהרת הלסינקי. הוועדה האתית של אוניברסיטת רוסטוק אישרה את המחקר הציג (reg. מס &#39;2011 06, ממושכת 23 בספטמבר, 2013). 1. ה...

את ייצור תאי מהונדסים גנטית עמוסה חלקיקים פאראמגנטי לקבלת הנחיות נוספות מגנטית נשלטת שלהם מוצג בפרוטוקול הנוכחי. היישום המוצלח של אסטרטגיה זו מאפשר לפתרון קשיים מסוימים של טיפול בתא, כגון החזקה נמוכה engraftment העני באזור נפצע 2, 3, <s...

ג&#39;ין וטיפול תא הם כלים רבים עצמה יש פוטנציאל לפתור אתגרים נוכחיים בטיפול CVD. למרות העובדה כי הן הגישות הללו נבדקות כעת בניסויים קליניים, הם עדיין אינם מוכנים ליישום קליני רחב 1. יש לציין, גישה משותפת להתמודדות עם האתגרים של גן לבין טיפול בתא היא לפתח וקטורים למסירת גן רבים תכליתיים מתאימים ליישום קליני. היעדר מערכות למסירת הגן בטוחות ויעילות הוא הדאגה העיקרית של ריפוי גנטי. במקביל, ההנדסה הגנטית של מוצרי הסלולר לפני ההשתלה יכולה להתגבר על האתגרים הרציניים של טיפול בתא, כגון יעילות נמוכה (למשל, בתחום הלב, רק ~ 5% של שיפור תפקודי מושגת פוסט-תאי גזע להשתלת 1 ) ושימור / engraftment עני באתר של פציעה (כלומר, החזקת תא יורד מתחת 5 - 10% בתוך דקות עד שעות POst-יישום, ללא קשר לתוואי ממשל 2, 3, 4). נכון להיום, וקטורים ויראליים מאוד יעלו מערכות שאינן ויראליות במונחים של יעילות, אשר הביאה היישום הרחב יותר שלהם בניסויים קליניים (~ 67%) 5. עם זאת, כלי רכב ויראלי לשאת בסיכונים חמורים, כגון חיסוני (ואת התגובה הדלקתית שלאחר מכן, עם סיבוכים חמורים), oncogenicity, ומגבלות בגודל של החומר הגנטי הנישא 6. בשל חששות בטיחות אלה לבין העלויות הגבוהות של ייצור וקטור ויראלי, השימוש במערכות הלא-ויראלית עדיף במקרים מסוימים 7, 8. היא מתאימה במיוחד עבור הפרעות הדורשות תיקון גנטי חולף, כגון הביטוי של גורמי גדילה השליטה אנגיוגנזה (למשל, לטיפול CVD) או deliveר&quot;י של חיסונים. בקבוצה שלנו, מערכת מסירה תוכננה על ידי שילוב מסועף 25-kDa polyethyleneimine (תש&quot;ן) ואת חלקיקי תחמוצת ברזל פאראמגנטי (MNP) קשורים יחדיו על ידי האינטראקציה ביוטין- streptavidin 9. וקטור זה הוא כלי פוטנציאלי עבור הנדסה גנטית של תאי, המאפשר המגנטיזציה שלהם סימולטני לפני ההשתלה. זה האחרון מספק בסיס הדרכה / שימור מגנטי, אשר מבטיחה במיוחד בימינו, כמו טכניקות מיקוד מגנטיות מתקדמות מפותח בהצלחה 10. יתר על כן, התא מגנטי תגובה וכתוצאה מכך יש את הפוטנציאל להיות פולשני במעקב דימות בתהודה מגנטית (MRI) או הדמית חלקיקים מגנטית 11, 12. במקרה של וקטור PEI / MNP, polyamine מבטיח התעבות חומצות גרעין ובכך הגנה מפני גורם משפיל<html> ים, הפנמת וקטור בתאים, ו endosomal להימלט 5. MNPs משלימים את המאפיינים של PEI, לא רק במונחים של הדרכה מגנטי, אלא גם על ידי הפחתת הרעילות 7 הידוע PEI, 13, 14. בעבר, תש&quot;ן / נכסים וקטור MNP הותאמו מבחינת יעילות משלוח (כלומר, pDNA ו מירנה) ובטיחות באמצעות פיברובלסטים ותאי גזע mesenchymal אנושי 15, 16. בכתב היד הזה, פרוטוקול מפורט על היישום של PEI / MNPs עבור הדור של תאי-modified מירנה מתואר 17. לשם כך, HUVECs משמש ומהווה מודל הוקם עבור אנגיוגנזה במבחנה. הם מאתגר transfect והם רגישים השפעה רעילה 18, 19,התחת = &quot;Xref&quot;&gt; 20. בנוסף, אנו מספקים אלגוריתם להעריך תאים כאלה במבחנה, כולל מיקוד שלהם, תקשורת בין-תאית, וזיהוי MRI.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

נכון להיום, הטיפולים כירורגיים תרופתיים הזמינים עבור מחלות לב וכלי דם (CVD) מוגבלים ולעתים קרובות פליאטיבי. במקביל, טיפולי גני תא הם מאוד גישות חלופיות מבטיחות לטיפול CVD. עם זאת, היישום הקליני הרחב של ריפוי גנטי מוגבל מאוד על ידי חוסר מערכות למסירת הגן מתאימות. ההתפתחות של וקטורים למסירת הגן מתאימים יכולה לספק פתרון לאתגרים נוכחיים טיפול בתא. בפרט, חסרונות קיימים, כגון יעילות מוגבלת ושימור תאי נמוך ב האיבר נפצע, ניתן להתגבר על ידי הנדסת תא מתאימה (כלומר, גנטי) לפני ההשתלה. הפרוטוקול המובא מתאר את השינוי החולף היעיל ובטוח של תאי האנדותל באמצעות ננו-חלקיקים מגנטיים פאראמגנטי polyethyleneimine (PEI / MNP) וקטור משלוח מבוסס. כמו כן, האלגוריתם ושיטות לאפיון תאים מוגדרים. Intracellu המוצלחמסירה של microRNA (miR) לתוך האדם ורידים טבורי תאים אנדותל (HUVECs) הושגה מבלי להשפיע על כדאיות התא, פונקציונליות, או תקשורת בין תאיים. יתר על כן, גישה זו הוכחה לגרום השפעה תפקודית חזקה מיר exogenous הציג. חשוב לציין, היישום של וקטור זה מבוסס MNP מבטיח מגנטיזציה התא, עם אפשרויות נלוות של מיקוד מגנטי לא מעקב פולשני MRI. זה עשוי לספק בסיס מגנטי מונחה, מהונדס גנטית תרפויטים תא שניתן לפקח ללא פולשנית עם MRI.

המטרה העיקרית של הפרוטוקול המוצע היא לייצר מגנטי תגובת תאי miR-modified וכדי לנהל האפיון המדויק שלהם (איור 1). כתוצאה מכך, תאי transfected ביעילות, מגיבים בחירה מגנטית והדרכה לזיהוי באמצעות MRI, יש לקבל. <p class="jove_content" fo:keep-together.within-page="1" style=";text-align:right;directi...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

כתב היד הזה מתאר את משלוח יעיל, שאינו ויראלי של miR לתאי אנדותל ידי וקטור PEI / MNP ו המגנטיזציה שלהם. לכן, בנוסף שינוי גנטי, גישה זו מאפשרת להדרכת תא מגנטית ויכולת גילוי MRI. הטכניקה יכולה לשמש כדי לשפר את המאפיינים של מוצרי תא טיפוליים.

הכנה<em&gt; במבחנה</em&gt; אפיון ממוגנטים miR-modified לתאי אנדותל

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

קרנית התורם רקמות הכנה Keratoplasty האנדותל

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

בידוד, אפיון והשוואתי התמיינות של תאי גזע אנושיים שיניים זולות נגזרה שיניים קבועות על ידי שימוש בשתי שיטות שונות

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

למתוח בתאי אנדותל כלי הדם במוח (cEND) כ<em&gt; במבחנה</em&gt; פגיעה מוחי טראומטי דגם של מחסום דם המוח

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

בשיטה חוץ גופית כדי לבחון אינטראקציות בתיווך-E-selectin בין תאים סרטניים בערמונית מחזור שמקורם בתאי חולים ואנדותל האנושי

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

הכנת רקמות התורמות קרנית לממברנה האנדותל Keratoplasty של Descemet

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

באפיון פונקציונלי מבחנה של עכבר המעי הגס מביא Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

בידוד של תאי האנדותל אדם הלימפה על ידי מיון תא הקרינה המופעל Multi-פרמטר

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

לומד סרטן לבלב גזע מאפייני תא לפיתוח טיפול חדש אסטרטגיות

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

הרחבת בידוד והתרבות של תאי האנדותל גידול ספציפי

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

בידוד והתרבות של תאי האנדותל ראשיים מן העורקים וורידים לכלבים

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...