Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Vorremmo ringraziare G. Fulda (Microscopia Elettronica Center, Università di Rostock, Germania) per il supporto tecnico ad acquisire immagini TEM di nanoparticelle superparamagnetiche filtrati e nello svolgimento loro analisi ai raggi X. Il lavoro svolto presso la RTC Rostock è stato sostenuto dal Ministero federale dell&#39;Istruzione e della Ricerca Germania (FKZ 0312138A, FKZ 316159 e VIP + 03VP00241) e lo Stato Meclemburgo-Pomerania occidentale con i Fondi strutturali dell&#39;UE (FSE / IV-WM-B34- 0030/10 e FSE / IV-BM-B35-0010 / 12) e dalla DFG (dA 1296-1), l&#39;umidità-Fondazione, e la Heart Foundation tedesco (F / 01/12). Frank Wiekhorst è stato sostenuto dal programma di ricerca dell&#39;UE del 7 ° PQ &quot;NanoMag&quot; FP7-NMP-2013-LARGE-7.

Cordoni ombelicali umani per l&#39;isolamento delle cellule sono stati ottenuti dopo il parto dalla informati, donne sane che hanno dato il loro consenso scritto per l&#39;uso di questo materiale per la ricerca in base alla Dichiarazione di Helsinki. Il comitato etico dell&#39;Università di Rostock ha approvato lo studio presentato (reg. No. Un 2011 06, prolungato 23 settembre, 2013). 1. Preparazione di Transfection Complessi <ol><li> Biotinilazione di polietilenimmina (PEI). <ol...

La produzione di cellule geneticamente modificate cariche di nanoparticelle superparamagnetiche per la loro guida ulteriormente magneticamente controllato è presentato nel protocollo corrente. L&#39;applicazione di successo di questa strategia consente la risoluzione di alcune difficoltà di terapia cellulare, come la bassa ritenzione e poveri attecchimento nella zona lesa 2, 3, 4, realizzando un prodotto cellulare targeting p...

Terapia genica e cellulare sono strumenti potenti che hanno il potenziale per risolvere le sfide attuali nel trattamento CVD. Nonostante il fatto che entrambi questi approcci sono attualmente in fase di sperimentazione in studi clinici, non sono ancora pronti per una vasta applicazione clinica 1. In particolare, un approccio comune per affrontare le sfide della terapia genica e cellulare è quello di sviluppare vettori di trasferimento dei geni multifunzionali adatte per l&#39;applicazione clinica. La mancanza di sistemi di lancio gene sicuri ed efficienti è la preoccupazione principale della terapia genica. Allo stesso tempo, l&#39;ingegnerizzazione genetica di prodotti cellulari prima del trapianto potrebbe superare le gravi sfide della terapia cellulare, come la bassa efficienza (trapianto di cellule post-staminali per esempio, nel campo cardiaco, solo ~ 5% di miglioramento funzionale si ottiene 1 ) e la scarsa ritenzione / attecchimento presso il sito di lesione (ad esempio, la conservazione delle cellule scende sotto i 5 - 10% in pochi minuti a ore Post-applicazione, indipendentemente dalla via di somministrazione 2, 3, 4). Fino ad oggi, vettori virali superano notevolmente i sistemi non-virali in termini di efficienza, che ha portato nella loro più ampia applicazione negli studi clinici (~ 67%) 5. Tuttavia, i veicoli virali comportano rischi gravi, come immunogenicità (e la successiva risposta infiammatoria, con gravi complicazioni), oncogenesi e limitazioni nella dimensione del materiale genetico condotto 6. A causa di questi problemi di sicurezza e gli elevati costi di produzione vettore virale, l&#39;uso di sistemi non virali è preferibile in alcuni casi 7, 8. È particolarmente adatto per i disturbi che richiedono correzione genetica transitoria, come l&#39;espressione dei fattori di crescita che controllano l&#39;angiogenesi (ad esempio, per il trattamento CVD) o delivery di vaccini. Nel nostro gruppo, un sistema di erogazione creata da combinando ramificato polietilenimmina 25-kDa (PEI) e nanoparticelle di ossido di ferro superparamagnetiche (MNP) legati insieme da interazione biotina-streptavidina 9. Questo vettore è un potenziale strumento per l&#39;ingegneria genetica di cellule, consentendo loro magnetizzazione simultanea prima del trapianto. Quest&#39;ultimo fornisce una base per magnetico orientamento / ritenzione, che è particolarmente promettente al giorno d&#39;oggi, come tecniche avanzate di targeting magnetici si stanno sviluppando con successo 10. Inoltre, le risultanti cellule magneticamente sensibili hanno il potenziale di essere non invasivo monitorato da risonanza magnetica (MRI) o immagini di particelle magnetiche 11, 12. Nel caso del vettore PEI / MNP, poliammina assicura condensazione di acido nucleico e quindi la protezione dal fattore degradanti<html> s, vettore internalizzazione nelle cellule, e endosomali fuga 5. Il MNPs completano le proprietà di PEI, non solo in termini di orientamento magnetico, ma anche riducendo il noto tossicità PEI 7, 13, 14. In precedenza, PEI / MNP proprietà vettoriali sono stati regolati in termini di efficienza di consegna (cioè, pDNA e miRNA) e sicurezza utilizzando fibroblasti e cellule staminali mesenchimali umane 15, 16. In questo manoscritto, un protocollo dettagliato sull&#39;applicazione della PEI / MNPs per la generazione di cellule miRNA-modificata viene descritto 17. Per questo scopo, vengono utilizzate HUVEC e rappresentano un modello stabilito per l&#39;angiogenesi in vitro. Sono impegnativo per trasfettare e sono suscettibili di influenza tossica 18, 19,ass = &quot;xref&quot;&gt; 20. Inoltre, mettiamo a disposizione un algoritmo per valutare tali cellule in vitro, compresa la loro targeting, la comunicazione intercellulare, e la rilevazione risonanza magnetica.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

Fino ad oggi, i trattamenti chirurgici e farmacologici disponibili per le malattie cardiovascolari (CVD) sono limitati e spesso palliative. Allo stesso tempo, terapie geniche e cellulari sono approcci alternativi promettenti per il trattamento CVD. Tuttavia, l&#39;ampia applicazione clinica della terapia genica è fortemente limitato dalla mancanza di idonei sistemi di trasferimento genico. Lo sviluppo di adeguate vettori di trasferimento genico in grado di fornire una soluzione alle sfide attuali in terapia cellulare. In particolare, gli svantaggi esistenti, come l&#39;efficienza limitata e ritenzione delle cellule di basso nell&#39;organo danneggiato, potrebbero essere superati mediante l&#39;ingegneria cella appropriata (cioè, genetica) prima del trapianto. Il protocollo presentato descrive la modificazione transitoria efficiente e sicura delle cellule endoteliali mediante una nanoparticella polietilenimmina superparamagnetico magnetico (PEI / MNP) consegna basata su vettore. Inoltre, l&#39;algoritmo e metodi per la caratterizzazione delle cellule sono definite. Il successo intracelluconsegna LAR di microRNA (miR) nella vena ombelicale cellule endoteliali umane (HUVEC) è stato raggiunto senza compromettere la vitalità cellulare, la funzionalità, o comunicazione intercellulare. Inoltre, questo approccio è stato dimostrato di causare un forte effetto funzionale esogeno introdotto miR. È importante sottolineare che l&#39;applicazione di questo vettore MNP-based assicura magnetizzazione cella, con possibilità di targeting magnetico e non invasivo MRI tracing accompagnamento. Questo può fornire una base per magneticamente guidate, terapie cellulari geneticamente ingegnerizzati che possono essere monitorati in modo non invasivo con MRI.

Lo scopo principale del protocollo proposto è di produrre risposte magnetiche cellule miR-modificati e condurre loro caratterizzazione accurata (Figura 1). Di conseguenza, le cellule in modo efficiente trasfettate, sensibili alla selezione magnetica e di orientamento e rilevabili con la risonanza magnetica, devono essere ottenuti. In primo luogo, le identità di HUVEC isolati sono stati confermati mediante co...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells (Video) | JoVE

Questo manoscritto descrive l&#39;erogazione efficiente, non virale miR alle cellule endoteliali da un vettore PEI / MNP e la loro magnetizzazione. Così, oltre alla modificazione genetica, questo approccio consente di orientamento delle cellule magnetica e risonanza magnetica rilevabilità. La tecnica può essere utilizzata per migliorare le caratteristiche dei prodotti cellulari terapeutici.

preparazione e<em&gt; In Vitro</em&gt; Caratterizzazione di magnetizzato miR-modificato cellule endoteliali

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Corneal Donor Tissue Preparation for Endothelial Keratoplasty (Video) | JoVE

Preparazione del tessuto corneale dei donatori per Keratoplasty Endothelial

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Ricerca

Medicina

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods (Video) | JoVE

Differenziazione Isolamento, caratterizzazione e comparata delle cellule umane Dental Pulp staminali derivate da denti permanenti mediante due diversi metodi

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier (Video) | JoVE

Stretch in microvascolari cerebrali cellule endoteliali (CEND) come<em&gt; In Vitro</em&gt; Trauma cranico modello della barriera ematoencefalica

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells (Video) | JoVE

Nel metodo in vitro per osservare le interazioni E-selectina-mediata Tra prostata cellule tumorali circolanti derivate da pazienti e Cellule endoteliali umane

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty (Video) | JoVE

Corneale Preparazione donatore di tessuti per di Descemet Membrane Endothelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings (Video) | JoVE

In vitro Caratterizzazione funzionale del topo colorettale Afferent Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies (Video) | JoVE

Studiare cancro del pancreas staminali caratteristiche cellulari per lo sviluppo di nuove strategie di trattamento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Isolation and Culture Expansion of Tumor-specific Endothelial Cells (Video) | JoVE

Isolamento e cultura espansione delle cellule endoteliali tumore-specifici

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins (Video) | JoVE

Isolamento e coltura di cellule endoteliali primarie dalle arterie e vene Canine

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients

Forskolin-induced Swelling in Intestinal Organoids: An In Vitro Assay for Assessing Drug Response in Cystic Fibrosis Patients (Video) | JoVE

Forskolin indotta Gonfiore intestinale organoidi: An<em&gt; In Vitro</em&gt; Test per la valutazione della risposta farmacologica nella fibrosi cistica pazienti

Recently-developed cystic fibrosis transmembrane conductance regulator (CFTR)-modulating drugs correct surface expression and/or function of the mutant ...