Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

우리는 필터링 된 초상 자성 나노 입자의 TEM 이미지를 획득과 자신의 X 선 분석을 수행하기에 기술 지원을위한 G. 풀다 (전자 현미경 센터, 로스 토크 대학, 독일)에 감사드립니다. RTC 로스 토크에서 수행 작업은 연방 교육 연구부 독일 (FKZ 0312138A, FKZ 316159 및 VIP + 03VP00241) 및 EU 구조 기금과 국가 메 클렌 부르크 - 서쪽 포메 라니아 (ESF / IV-WM-B34-에 의해 지원되었다 0030/10와 ESF / IV-BM-B35-0010 / 12) 및 DFG (DA 1296-1), 축축한 재단 및 독일 심장 재단 (F는 / 01 / 12)에 의해. 프랭크 위호스트 EU FP7 연구 프로그램 &quot;Nanomag&quot;FP7-NMP-2013-LARGE-7에 의해 지원되었다.

세포 분리를위한 인간 탯줄은 헬싱키 선언에 따라 연구를 위해이 물질의 사용에 자신의 서면 동의를 준 통보, 건강한 여성에서 분만을 얻었다. 로스 토크 대학의 윤리위원회는 제시된 연구 (REG. 호 2011 년 6 장기간 2013년 9월 23일)를 승인했다. 형질 착물의 제조 1 <ol><li> 폴리에틸렌 이민의 바이오 티 닐화 (PEI). <ol><li> 300에서 자기 교반하에 초순수에 용해 지형 PEI - 실온...

상기 자기 자신의 제어 지침 상자성 나노로드 유 전적으로 조작 된 세포의 제조는 현재의 프로토콜에 제공된다. 이 전략의 성공적인 응용 프로그램은 이식에 대한 타겟팅 전지 제품을 제공함으로써, 같은 부상 영역 2, 3, 4, 낮은 유지와 가난한 생착 등 세포 치료의 어려움의 해결을 위해 수 있습니다. 또한, 적절히 선택...

유전자 및 세포 치료는 CVD 처리에 현재의 문제를 해결할 가능성이있는 강력한 도구입니다. 이러한 접근 방법 모두 현재 임상 실험에서 테스트되고 있다는 사실에도 불구하고, 그들은 아직 다양한 임상 적 적용 일에 대한 준비가되지 않습니다. 특히, 유전자 및 세포 치료의 과제를 해결하는 일반적인 접근 방식은 임상 적 적용에 적합한 다기능 유전자 전달 벡터를 개발하는 것입니다. 안전하고 효율적인 유전자 전달 시스템의 부족은 유전자 치료의 주요 관심사입니다. 동시에, 세포 제품의 유전 공학 낮은 효율 (예를 들어, 심장 분야에서 기능 개선 만 ~ 5 % 달성 후 줄기 세포 이식 1과 세포 치료의 심각한 도전을 극복 할 수 이식에 앞서 시간 포 분 이내에 10 % -)와 가난한 유지 / 상해의 사이트에 생착이 (즉, 세포의 유지는 아래 5 방울세인트 애플리케이션, 투여 경로에 관계없이 2, 3, 4). 현재까지, 바이러스 벡터가 크게 임상 시험에서의 넓은 응용 가져왔다 효율의 관점에서 비 바이러스 시스템 (~ 67 %)를 초과 5. 그러나 바이러스 차량은 실시 유전 물질 (6)의 크기에 심각한 (심각한 합병증 및 후속 염증 반응) 등의 면역 원성 등의 위험, 관련한 종양 및 제한을 실시한다. 이러한 안전 문제 및 바이러스 벡터 생산의 높은 비용으로 인해, 비 바이러스 시스템의 사용은 어떤 경우 7, 8 바람직하다. 여기에는 (CVD 처리에 대한 예)를 제어 혈관 성장 인자의 발현 유전자로서 과도 보정을 필요 이상, 또는 대인 수수에 특히 적합백신의 스피. 우리 그룹에서, 전달 시스템은 지형 25 kDa의 폴리에틸렌 이민 (PEI)과 비오틴 - 스트렙 트 아비딘 상호 작용 (9)에 의해 함께 결합 초상 자성 산화철 나노 입자 (MNP)를 조합하여 설계되었다. 이 벡터는 이전의 이식에 대한 그들의 동시 자화를 허용 세포의 유전 공학에 대한 잠재적 인 도구입니다. 후자는 고급 자기 타겟팅 기술이 성공적으로 10을 개발하고 있습니다로, 요즘 특히 유망 자기 안내 / 보존을위한 기초를 제공한다. 또, 얻어진 자기 응답 세포가 될 가능성이있는 비 침습적으로 자기 공명 영상 (MRI) 또는 자기 입자 이미지 (11) (12)에 의해 모니터링. PEI는 / MNP 벡터의 경우에, 폴리아민은 분해 인자로부터 핵산 축합 따라서 보호를 보장<html> 의, 세포에서 벡터의 국제화 및 엔도 좀은 5 탈출. MNPS 자기 유도의 관점에서뿐만 아니라, 공지 된 PEI 중독 7, 13, 14을 감소시킴으로써뿐만 아니라, PEI의 특성을 보완. 이전 PEI / MNP 벡터 성질은 섬유 아세포와 인간 중간 엽 줄기 세포 (15, 16)를 사용하여 전달 효율 (즉,과의 pDNA의 miRNA) 및 안전성의 관점에서 조정 하였다. 이 논문에서 miRNA의 변성 세포의 발생에 대한 PEI / MNPS의 애플리케이션에 대한 상세한 프로토콜은 17을 설명한다. 이를 위해, HUVECs를 사용하고 체외 혈관 신생에 대한 확립 된 모델을 나타내고있다. 그들은 형질에 도전하고 독성 영향 (18), (19)에 취약엉덩이 = &quot;외부 참조&quot;&gt; 20. 또한, 우리는 그들의 타겟팅, 세포 간 통신 및 MRI 탐지를 포함하여 체외에서 이러한 세포를 평가하는 알고리즘을 제공한다.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

현재까지, 심혈관 질환에 사용할 수있는 수술 및 약물 치료 (CVD)는 제한적이며 종종 완화. 동시에, 유전자 및 세포 치료는 CVD 치료에 매우 유망한 대안 적 방법을 제공합니다. 그러나, 유전자 치료의 다양한 임상 적 적용이 매우 적합 유전자 전달 시스템의 부족에 의해 제한된다. 적절한 유전자 전달 벡터의 개발은 세포 치료의 현재 문제점에 대한 해결책을 제공 할 수있다. 등 부상 기관에 제한 효율성과 낮은 세포 유지와 같은 특히, 기존의 단점에서, 적절한 세포 공학에 의해 (즉, 유전) 이전에 이식에 극복 할 수있다. 제시된 프로토콜은 폴리에틸렌 초상 자성 나노 입자 (PEI / MNP) 기반 전달 벡터를 사용하여 내피 세포의 효율적이고 안전한 과도 변형 례를 설명한다. 또한, 알고리즘과 셀 특성화 방법이 정의되어있다. 성공적인 intracellu마이크로 RNA 인간 제대 정맥 내피 세포로 (은 miR) (HUVEC를)의 경 전달 세포 생존, 기능, 또는 간 통신에 영향을주지 않고 달성되었다. 또한,이 방법은 소개 외생은 miR에서 강력한 기능 효과를 일으킬 것으로 입증되었다. 중요한 것은,이 MNP 기반 벡터의인가는 자기 타겟팅 및 비 침습성 MRI 추적 가능성을 수반 셀 자화를 보장한다. 이것은 MRI와 비 침습적 모니터링 할 수있는 자기 유도, 유 전적으로 조작 된 세포 치료제를위한 기초를 제공 할 수있다.

제안 된 프로토콜의 주요 목적은 자기 반응은 miR-수정 세포를 생산하기 위해 자신의 정확한 특성 (그림 1)을 수행하는 것입니다. 따라서, MRI 자기장으로 선택하고 안내 및 검출 응답을 효율적으로 형질 감염된 세포를 수득한다. 먼저, 절연 된 HUVEC의 신원은 내피 세포 마커 CD31 전형적인 염색 (PECAM) (도 2a)에</s...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

이 원고는 PEI / MNP 벡터와 자신의 자화에 의해 내피 세포 수 미르 효율적인 비 바이러스 성 전달을 설명합니다. 따라서, 유전자 변형뿐만 아니라,이 방법은 자기 세포 안내와 MRI의 검출 능력 수 있습니다. 이 기술은 치료 세포 제품의 특성을 개선하는 데 사용할 수 있습니다.

준비 및<em&gt; 체외</em&gt; 자화 특성의 내피 세포를 미르 변성

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

내피 Keratoplasty을위한 각막 기증자 조직 준비

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

연구

의학

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

인간 치과 펄프의 줄기 세포의 분리, 특성화 및 비교 차별화 두 가지 방법을 사용하여 영구 치아에서 파생

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

로 뇌 미세 혈관 내피 세포 (CEnd를)에 기지개<em&gt; 체외</em혈액 뇌 장벽의&gt; 외상성 뇌 손상 모델

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

환자와 인간의 내피 세포에서 파생 된 전립선 순환 종양 세포 사이에 E-셀렉틴 매개 상호 작용을 관찰하는 시험 관내 방법에

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

데스 메막 내피 각막 이식을위한 각막 기증자의 조직 준비

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

마우스 대장 수입 성의 엔딩의 생체 기능 특성에

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

다중 매개 변수 형광 활성화 된 셀 정렬하여 인간의 림프 내피 세포의 분리

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

췌장암 새로운 치료 전략을 개발하기위한 전지 특성 줄기 공부

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

종양 특이 내피 세포의 분리 및 문화 확장

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

개 동맥과 정맥에서 차 내피 세포의 분리 및 문화

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...