Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Nós gostaríamos de agradecer G. Fulda (Electron Microscopy Center, Universidade de Rostock, Alemanha) para o suporte técnico em adquirir imagens TEM de nanopartículas superparamagnéticas filtrados e na realização de sua análise de raios-X. O trabalho realizado no RTC Rostock foi apoiado pelo Ministério Federal da Educação e Pesquisa da Alemanha (FKZ 0312138A, FKZ 316159 e VIP + 03VP00241) eo Estado Mecklemburgo-Pomerânia Ocidental, com fundos estruturais da UE (FSE / IV-WM-B34- 0030/10 e FSE / IV-BM-B35-0010 / 12) e pela DFG (dA 1296-1), a Humidade-fundação, e a fundação do coração alemão (F / 01/12). Frank Wiekhorst foi apoiado pelo programa de investigação FP7 UE &quot;NanoMag&quot; FP7-NMP-2013-GRANDE-7.

Cordões umbilicais humanos para isolamento de células foram obtidas pós-parto de informadas as mulheres saudáveis que deram o seu consentimento por escrito para o uso deste material para pesquisa de acordo com a Declaração de Helsinki. O comitê de ética da Universidade de Rostock aprovou o estudo apresentado (reg. Não. A 2011 06, prolongada 23 de setembro de 2013). 1. Preparação de Complexos de transfecção <ol><li> A biotinilação de polietilenoimina (PEI). <ol><li> ...

A produção de células geneticamente modificadas carregados com nanopartículas superparamagnéticas para a sua orientação mais magneticamente controlada é apresentado no protocolo corrente. A aplicação bem sucedida desta estratégia permite a resolução de algumas dificuldades de terapia celular, como uma baixa retenção e pobre enxerto no local da lesão 2, 3, 4, através do fornecimento de um produto celular segment...

Terapia genética e celular são ferramentas poderosas que têm o potencial para resolver os desafios atuais no tratamento de doenças cardiovasculares. Apesar do fato de que ambas as abordagens estão sendo testadas em ensaios clínicos, eles ainda não estão prontos para a ampla aplicação clínica 1. Notavelmente, uma abordagem comum para enfrentar os desafios de terapia genética e celular é desenvolver vectores de entrega de genes multifuncionais adequadas para aplicação clínica. A falta de sistemas de entrega de genes seguros e eficazes é a preocupação principal da terapia génica. Ao mesmo tempo, a engenharia genética de produtos celulares antes do transplante poderia superar os graves problemas de terapia celular, tais como a baixa eficiência (transplante de células pós-tronco, por exemplo, no campo cardíaca, apenas ~ 5% de melhoria funcional é conseguido um ) e a fraca retenção / enxerto no local da lesão (isto é, a retenção de célula cai abaixo de 5-10% dentro de minutos a horas por-aplicação, independentemente da via de administração 2, 3, 4). Até à data, os vectores virais exceder grandemente os sistemas n virais em termos de eficácia, o que resultou na sua mais ampla aplicação em ensaios clínicos (~ 67%) 5. No entanto, os veículos virais trazem riscos sérios, tais como a imunogenicidade (e a subsequente resposta inflamatória, com complicações graves), oncogenicidade, e limitações no tamanho do material genético transportado 6. Devido a estas preocupações de segurança e os elevados custos de produo do vector viral, o uso de sistemas não-virais é preferível em certos casos, 7, 8. É particularmente adequado para desordens que requerem correcção genética transiente, tal como a expressão de factores de crescimento controlam a angiogese (por exemplo, para o tratamento de doenças cardiovasculares) ou a DELIVEry de vacinas. No nosso grupo, um sistema de entrega foi concebido por combinação de polietilenoimina ramificada 25-kDa (PEI) e nanopartículas de óxido de ferro superparamagnético (MNP) ligadas entre si por interacção biotina-estreptavidina 9. Este vector é uma potencial ferramenta para a engenharia genética de células, permitindo a sua magnetização simultânea antes do transplante. Este último proporciona uma base para a orientação magnética / retenção, o que é particularmente promissora hoje em dia, como técnicas de segmentação magnéticas avançadas estão a ser desenvolvidas com êxito 10. Além disso, as células magneticamente responsivas resultantes têm o potencial de ser de forma não invasiva monitorizada por imagiologia por ressonância magnética (MRI) ou imagiologia de partículas magnéticas 11, 12. No caso do vector de PEI / MNP, poliamina assegura condensação de ácido nucleico e, assim, a protecção do factor degradantes<html> s, internalização vector em células, e endossomal escapar 5. O MNPs complementar as propriedades de PEI, não só em termos de orientação magnética, mas também pela redução da toxicidade conhecida PEI 7, 13, 14. Anteriormente, as propriedades vector PEI / MNP foram ajustadas em termos de eficiência de transferência (isto é, ADNp e miARN) e segurança usando fibroblastos mesenquimais humanas e células estaminais 15, 16. Neste texto, um protocolo detalhado no pedido de PEI / MNPs para a geração de células modificada-miARN é descrito 17. Para este fim, HUVECs são utilizados e representam um modelo estabelecido para a angiogênese in vitro. Eles são difíceis de transfectar e são susceptíveis a influência tóxico 18, 19,ass = &quot;xref&quot;&gt; 20. Além disso, nós fornecemos um algoritmo para avaliar tais células in vitro, incluindo a sua segmentação, a comunicação intercelular, e detecção de ressonância magnética.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

Até à data, os tratamentos cirúrgicos e farmacológicos disponíveis para doenças cardiovasculares (DCV) são limitados e frequentemente paliativo. Ao mesmo tempo, e de genes de células terapêuticas são abordagens alternativas altamente promissores para o tratamento de doenças cardiovasculares. No entanto, a vasta aplicação clínica da terapia genética é muito limitado pela falta de sistemas de distribuição de genes adequados. O desenvolvimento de vectores de entrega de genes adequados podem fornecer uma solução para os desafios actuais em terapia celular. Em particular, os inconvenientes existentes, tais como a eficiência limitada e retenção celular baixo no órgão lesionado, pode ser superado por engenharia celular apropriada (isto é, genética) antes do transplante. O protocolo apresentado descreve a modificação transiente eficiente e segura de células endoteliais utilizando uma nanopartícula magnética superparamagnético polietilenoimina (PEI / MNP) -based vector de entrega. Além disso, o algoritmo e métodos para a caracterização de células são definidas. O intracellu sucessoentrega lar de microARN (MIR) em células endoteliais da veia umbilical humana (HUVEC) foi alcançado sem afectar a viabilidade celular, a funcionalidade, ou comunicação intercelular. Além disso, esta abordagem foi comprovada a causar um efeito funcional forte em exógeno introduzido miR. Importante, a aplicação deste vector baseia-MNP assegura magnetização célula, com acompanhamento de possibilidades de direccionamento magnético e não-invasiva rastreio MRI. Isto pode fornecer uma base para magneticamente guiados terapêutica de células geneticamente modificadas, que podem ser monitorados de forma não invasiva com a RM.

O principal objectivo do protocolo proposto é produzir células miR-modificados magneticamente responsivas e para realizar a sua caracterização exacta (Figura 1). Como resultado, as células transfectadas de forma eficiente, que respondem à selecção e orientação magnética e detectáveis ​​com MRI, deve ser obtida. Em primeiro lugar, as identidades de HUVECs isolados foram confirmadas por coloraç?...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Este manuscrito descreve a entrega eficiente, não-viral de miR a células endoteliais por um vector de PEI / MNP e a sua magnetização. Assim, em adição à modificação genética, esta abordagem permite a orientação celular magnética e ressonância magnética detectabilidade. A técnica pode ser usada para melhorar as características de produtos de células terapêuticas.

preparação e<em&gt; In Vitro</em&gt; Caracterização de magnetizado miR-modificado Células Endoteliais

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Preparação do tecido da córnea Doadores de ceratoplastia endotelial

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Medicina

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Isolamento, caracterização e comparativa Diferenciação de células-tronco da polpa dentária Derivado de dentes permanentes usando dois métodos diferentes

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Estique em células cerebrais endoteliais microvasculares (cEnd) como um<em&gt; In Vitro</em&gt; Modelo de lesão cerebral traumática do cérebro Barreira Hemato

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Método in vitro para observar interações E-selectina mediadas entre próstata células tumorais circulantes derivadas de pacientes e células endoteliais humanas

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Preparação tecido doador de córnea para Membrana de Descemet endotelial Keratoplasty

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro caracterização funcional de Rato Colorretal Aferente Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

Isolamento de linfático humano endotelial por multi-parâmetro activadas por fluorescência celular

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

Estudar o cancro do pâncreas Stem características celulares para desenvolver estratégias Novo tratamento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Isolamento e Cultura de Expansão de células endoteliais específicos de tumores

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Isolamento e cultura de células endoteliais primárias de Artérias e Veias canina

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...