Name: preparation and in vitro characterization of magnetized mir-modified endothelial cells
Uploaded: 2017-05-02T14:00:00
Description: Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Nos gustaría dar las gracias a G. Fulda (Microscopía Electrónica Center, Universidad de Rostock, Alemania) por el apoyo técnico en la adquisición de imágenes de TEM de nanopartículas superparamagnéticas filtrados y en la realización de sus análisis de rayos X. El trabajo llevado a cabo en el RTC Rostock fue apoyado por el Ministerio Federal de Educación e Investigación de Alemania (FKZ 0312138A, FKZ 316.159 y VIP + 03VP00241) y el Estado Mecklemburgo-Pomerania Occidental con fondos estructurales de la UE (FSE / IV-WM-B34- 0030/10 y ESF / IV-BM-B35-0010 / 12) y por la DFG (DA 1296-1), la humedad-Fundación, y la Fundación corazón alemán (F / 01/12). Frank Wiekhorst fue apoyado por el programa de investigación del 7PM de la UE &quot;Nanomag&quot; FP7-NMP-2013-LARGE-7.

Cordones umbilicales humanos para el aislamiento de células se obtuvieron a partir de posparto informados, mujeres sanas que dieron su consentimiento por escrito para el uso de este material para la investigación de acuerdo con la Declaración de Helsinki. El comité de ética de la Universidad de Rostock ha aprobado el estudio presentado (Reg. No. A 2011, 06, 23 de prolongada de septiembre de 2013). 1. Preparación de Transfección Complejos <ol><li> La biotinilación de poliet...

La producción de células genéticamente cargados con nanopartículas superparamagnéticas por su orientación más controlada magnéticamente se presenta en el protocolo actual. La aplicación exitosa de esta estrategia permite la resolución de algunas dificultades de la terapia celular, tales como baja retención y pobres injerto en el área lesionada 2, 3, 4, proporcionando un producto de células objeto de orientación pa...

Terapia génica y celular son herramientas poderosas que tienen el potencial para resolver los retos actuales en el tratamiento de las enfermedades cardiovasculares. A pesar de que estos dos enfoques actualmente se están probando en ensayos clínicos, que todavía no están listos para una amplia aplicación clínica 1. En particular, un enfoque común para hacer frente a los retos de la terapia génica y celular es el desarrollo de vectores de suministro de genes multifuncionales adecuados para la aplicación clínica. La falta de sistemas de administración de genes segura y eficiente es la preocupación principal de la terapia génica. Al mismo tiempo, la ingeniería genética de productos celulares antes del transplante podría superar los serios desafíos de la terapia celular, tales como la baja eficiencia (por ejemplo, en el campo cardiaco, solamente ~ 5% de mejoría funcional se logra post-trasplante de célula 1 ) y mala retención / injerto al sitio de la lesión (es decir, retención celular cae por debajo de 5 - 10% en cuestión de minutos a horas post-aplicación, independientemente de la vía de administración 2, 3, 4). Hasta la fecha, los vectores virales son muy superiores a los sistemas no virales en términos de eficiencia, que ha resultado en su aplicación más amplia en los ensayos clínicos (~ 67%) 5. Sin embargo, los vehículos virales conllevan riesgos graves, tales como la inmunogenicidad (y la respuesta inflamatoria posterior, con complicaciones graves), oncogenicidad, y las limitaciones en el tamaño del material genético llevado a 6. Debido a estas preocupaciones de seguridad y los altos costes de la producción del vector viral, el uso de sistemas no virales es preferible en ciertos casos 7, 8. Es especialmente adecuado para los trastornos que requieren corrección genética transitoria, tales como la expresión de factores de crecimiento que controlan la angiogénesis (por ejemplo, para el tratamiento CVD) o la deliveria de las vacunas. En nuestro grupo, un sistema de entrega se diseñó por combinación ramificado polietilenimina 25-kDa (PEI) y nanopartículas de óxido de hierro superparamagnéticas (MNP) unidas entre sí por la interacción biotina-estreptavidina 9. Este vector es una herramienta potencial para la ingeniería genética de las células, lo que permite su magnetización simultánea antes del trasplante. Este último proporciona una base para la orientación / retención magnética, que es particularmente prometedor hoy en día, como técnicas de segmentación magnéticas avanzadas están siendo desarrollados con éxito 10. Además, las células magnéticamente sensibles resultantes tienen el potencial de ser no invasiva monitoreado por resonancia magnética (MRI) o formación de imágenes de partículas magnéticas 11, 12. En el caso del vector de PEI / MNP, poliamina asegura de condensación de ácido nucleico y por lo tanto la protección de factor de degradantes<html> s, internalización vector en las células, y endosomal escapar 5. El MNPs complementar las propiedades de PEI, no sólo en términos de orientación magnética, sino también por la reducción de la conocida toxicidad PEI 7, 13, 14. Anteriormente, PEI / MNP propiedades vector se ajustaron en términos de eficiencia en la entrega (es decir, pDNA y los genes miARN) y la seguridad mediante el uso de fibroblastos y células madre mesenquimatosas humanas 15, 16. En este manuscrito, un protocolo detallado sobre la aplicación de PEI / MNPs para la generación de células miARN-modificado se describe 17. Para este propósito, HUVECs se utilizan y representan un modelo establecido para la angiogénesis in vitro. Son difíciles de transfectar y son susceptibles a la influencia tóxica 18, 19,culo = &quot;xref&quot;&gt; 20. Además, proporcionamos un algoritmo para evaluar dichas células in vitro, incluyendo su orientación, la comunicación intercelular, y la detección de MRI.

<table border="0" cellpadding="0" cellspacing="0" width="653">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PEI 25 kDa</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">408727</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">EZ-Link Sulfo-NHS-LC-Biotin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">21335</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">PD-10 Desalting Columns</td>
			<td style="width:159px;">GE Healthcare</td>
			<td style="width:119px;">17085101</td>
			<td style="width:179px;">Containing Sephadex G-25 Medium</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Ninhydrin Reagent solution 2%</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">7285</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Glycine</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">410225</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Pierce Biotin Quantitation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">28005</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">&#160;Microplate reader Model 680</td>
			<td style="width:159px;">Bio-Rad</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Streptavidin MagneSphere Paramagnetic Particles</td>
			<td style="width:159px;">Promega</td>
			<td style="width:119px;">Z5481</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Millex-HV PVDF Filter</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">SLHV013SL</td>
			<td style="width:179px;">0.45&#181;m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Libra 120 transmission electron microscope&#160;</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">Acceleration Voltage 120KV</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Sapphire X-ray detector</td>
			<td style="width:159px;">EDAX-Amatek</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cell culture plastic</td>
			<td style="width:159px;">TPP</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NHS-Esther Atto 488&#160;</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 488-31</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Cy5 miRNA Label IT kit</td>
			<td style="width:159px;">Mirus Bio</td>
			<td style="width:119px;">MIR 9650</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Biotin Atto 565</td>
			<td style="width:159px;">ATTO-TEC GmbH</td>
			<td style="width:119px;">AD 565-71</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Collagense Type IV Gibco</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">17104019</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Endothelial growth medium, EGM-2</td>
			<td style="width:159px;">Lonza</td>
			<td style="width:119px;">CC-3156 &#38; CC-4176</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Penicillin/Streptomycin</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">15140122</td>
			<td style="width:179px;">100 U/ml, 100&#181;g/ml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matrigel</td>
			<td style="width:159px;">BD Biosciences</td>
			<td style="width:119px;">356234</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">anti-PECAM-1 antibody</td>
			<td style="width:159px;">Santa Cruz</td>
			<td style="width:119px;">sc-1506</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MS MACS columns</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-042-201</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Near-IR Live/Dead Cell Stain Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">L10119</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Cy3 Dye-Labeled Pre-miR Negative Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17120</td>
			<td style="width:179px;">&#34;Cy3-miR&#34; or &#34;Cyanine-miR3&#34; in the manuscript</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Pre-miR miRNA Precursor Molecules - Negative Control&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM17110</td>
			<td style="width:179px;">&#34;scr-miR&#34; in the manuscript</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Anti-hsa-miR92a-3p synthetic Inhibitor&#160;</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM10916</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">LSM 780 ELYRA PS.1 system</td>
			<td style="width:159px;">Zeiss</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Paraformaldehyde</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">158127</td>
			<td style="width:179px;">4% solution in PBS</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">DAPI nuclear stain</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">D1306</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">NucleoSpin RNA isolation Kit</td>
			<td style="width:159px;">Machery-Nagel</td>
			<td style="width:119px;">740955</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">mirVana miRNA Isolation Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">AM1560</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">TaqMan MicroRNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4366596</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">StepOnePlus Real-Time PCR System</td>
			<td style="width:159px;">Applied Biosystems</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4368814</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">hsa-miR-92a TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">000431</td>
			<td style="width:179px;">Mature miRNA Sequence: UAUUGCACUUGUCCCGGCCUGU</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastGene Taq Ready Mix</td>
			<td style="width:159px;">Nippon Genetics</td>
			<td style="width:119px;">LS27</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">ITGA5 TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">Hs01547673_m1</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">RNU6B TaqMan assay</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">001093</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">18S rRNA Endogenous Control</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">4333760F</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Gelatin</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">G7041</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">CellTrace Calcein Red-Orange</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C34851</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">PBS</td>
			<td style="width:159px;">Pan Biotech</td>
			<td style="width:119px;">P04-53500</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">BSA</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MACS buffer</td>
			<td style="width:159px;">Miltenyi Biotec&#160;</td>
			<td style="width:119px;">130-091-221</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Agarose</td>
			<td style="width:159px;">Sigma Aldrich</td>
			<td style="width:119px;">A9539</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">7.1 Tesla animal MRI system</td>
			<td style="width:159px;">Bruker Corporation</td>
			<td style="width:119px;">A7906</td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">ImageJ software</td>
			<td style="width:159px;">National Institutes of Health</td>
			<td style="width:119px;"></td>
			<td style="width:179px;">upgraded with an AngiogenesisAnalyzer (NIH)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">MPS device</td>
			<td style="width:159px;">Bruker Biospin</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Matlab software</td>
			<td style="width:159px;">Mathworks</td>
			<td style="width:119px;"></td>
			<td style="width:179px;"></td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:197px;">Ring Neodym Magnet&#160;</td>
			<td style="width:159px;">magnets4you GmbH</td>
			<td style="width:119px;">RM-10x04x05-G</td>
			<td style="width:179px;">&#248; 10 mm; remanescence is ~1.3T, coercivity &#8805; 955 kA/m</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:197px;">Click-iT EdU Alexa Fluor 647 Imaging Kit</td>
			<td style="width:159px;">Thermo Scientific</td>
			<td style="width:119px;">C10340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">FluorSave Reagent</td>
			<td style="width:159px;">Merck</td>
			<td style="width:119px;">345789</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:197px;">Ultrasonic bath</td>
			<td style="width:159px;">Bandelin electronic</td>
			<td style="width:119px;">Type: RK 100 SH</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation and in vitro characterization of magnetized mir-modified endothelial cells

Hasta la fecha, los tratamientos quirúrgicos y farmacológicos disponibles para las enfermedades cardiovasculares (ECV) son limitados y a menudo paliativo. Al mismo tiempo, el gen de terapias con células y son enfoques alternativos muy prometedores para el tratamiento de enfermedades cardiovasculares. Sin embargo, la amplia aplicación clínica de la terapia génica está limitada en gran medida por la falta de sistemas de suministro de genes adecuados. El desarrollo de vectores de suministro de genes adecuados puede proporcionar una solución a los retos actuales en la terapia celular. En particular, los inconvenientes existentes, como la eficiencia limitada y retención celular bajo en el órgano lesionado, podría ser superado por ingeniería celular apropiada (es decir, genética) antes del trasplante. El protocolo presentado describe la modificación transitoria eficiente y seguro de las células endoteliales usando una nanopartícula polietilenimina superparamagnético magnético (PEI / MNP) basada en vector de administración. Además, el algoritmo y métodos para la caracterización de células se definen. El éxito intracelluentrega lar de microARN (MIR) en las células endoteliales de la vena umbilical humana (HUVECs) se ha logrado sin afectar la viabilidad celular, la funcionalidad, o la comunicación intercelular. Por otra parte, este enfoque se ha demostrado que causa un efecto funcional fuertes en exógeno introducido MIR. Es importante destacar que la aplicación de este vector basado en MNP asegura magnetización celular, con posibilidades de orientación magnética y rastreo MRI no invasiva de acompañamiento. Esto puede proporcionar una base para la terapéutica de células magnéticamente guiadas, por ingeniería genética que pueden ser monitoreados de manera no invasiva con MRI.

El objetivo principal del protocolo propuesto es producir células modificadas-MIR magnéticamente sensibles y para llevar a cabo su caracterización precisa (Figura 1). Como resultado, las células transfectadas de manera eficiente, que responden a la selección y orientación magnética y detectables con MRI, se deben obtener. En primer lugar, las identidades de HUVECs aisladas se confirmaron mediante tinci?...

Watch this Scientific Journal Video about Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells at JoVE.com

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Este manuscrito describe la entrega eficiente, no viral de miR a las células endoteliales por un vector de PEI / MNP y su magnetización. Por lo tanto, además de la modificación genética, este enfoque permite la orientación magnética de las células y de detección de MRI. La técnica se puede utilizar para mejorar las características de los productos de células terapéuticas.

Preparación y<em&gt; In Vitro</em&gt; Caracterización de Magnetized miR-modificado células endoteliales

To date, the available surgical and pharmacological treatments for cardiovascular diseases (CVD) are limited and often palliative. At the same time, gene ...

Research

JoVE Journal

Medicine

Preparation and In Vitro Characterization of Magnetized miR-modified Endothelial Cells

Corneal Donor Tissue Preparation for Endothelial Keratoplasty

Preparación del tejido corneal donante para la queratoplastia endotelial

Over the past ten years, corneal transplantation surgical techniques have undergone revolutionary changes1,2. Since its inception, traditional full ...

Investigación

Medicina

Isolation, Characterization and Comparative Differentiation of Human Dental Pulp Stem Cells Derived from Permanent Teeth by Using Two Different Methods

Diferenciación de aislamiento, caracterización y comparativo de las células madre derivadas de la Pulpa Dental de los dientes permanentes mediante dos métodos diferentes

Developing wisdom teeth are easy-accessible source of stem cells during the adulthood which could be obtained by routine orthodontic treatments. Human ...

Stretch in Brain Microvascular Endothelial Cells (cEND) as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Stretch in Brain Microvascular Endothelial Cells cEND as an In Vitro Traumatic Brain Injury Model of the Blood Brain Barrier

Estirar en Brain células endoteliales microvasculares (CEND) como<em&gt; In Vitro</em&gt; Lesión cerebral traumática Modelo de la barrera hematoencefálica

Due to the high mortality incident brought about by traumatic brain injury (TBI), methods that would enable one to better understand the underlying ...

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

In vitro Method to Observe E-selectin-mediated Interactions Between Prostate Circulating Tumor Cells Derived From Patients and Human Endothelial Cells

Método in vitro para observar interacciones mediadas por E-selectina Entre próstata células tumorales circulantes derivadas de pacientes y las células endoteliales humanas

Metastasis is a process in which tumor cells shed from the primary tumor intravasate blood vascular and lymphatic system, thereby, gaining access to ...

Corneal Donor Tissue Preparation for Descemet's Membrane Endothelial Keratoplasty

Córnea Preparación de Tejidos de Donantes para la Membrana de Descemet queratoplastia endotelial

Descemet&#8217;s Membrane Endothelial Keratoplasty (DMEK) is a form of corneal transplantation in which only a single cell layer, the corneal endothelium, ...

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Functional Characterization of Mouse Colorectal Afferent Endings

In vitro Caracterización funcional de ratón colorrectal aferente Endings

This video demonstrates in detail an in vitro single-fiber electrophysiological recording protocol using a mouse colorectum-nerve preparation. The ...

Isolation of Human Lymphatic Endothelial Cells by Multi-parameter Fluorescence-activated Cell Sorting

Aislamiento de células endoteliales linfático humano por Multi-parámetro de clasificación de células activadas por fluorescencia

Lymphatic system disorders such as primary lymphedema, lymphatic malformations and lymphatic tumors are rare conditions that cause significant morbidity ...

Studying Pancreatic Cancer Stem Cell Characteristics for Developing New Treatment Strategies

El estudio de cáncer de páncreas Tallo Características de las células para el desarrollo de nuevas estrategias de tratamiento

Pancreatic ductal adenocarcinoma (PDAC) contains a subset of exclusively tumorigenic cancer stem cells (CSCs) which have been shown to drive tumor ...

Isolation and Culture Expansion of Tumor-specific Endothelial Cells

Aislamiento y cultivo de expansión de las células endoteliales-tumorales específicas

Freshly isolated tumor-specific endothelial cells (TEC) can be used to explore molecular mechanisms of tumor angiogenesis and serve as an in vitro model ...

Isolation and Culture of Primary Endothelial Cells from Canine Arteries and Veins

Aislamiento y cultivo de células endoteliales primarias de las arterias y venas caninas

Cardiovascular disease is studied in both human and veterinary medicine. Endothelial cells have been used extensively as an in vitro model to study ...