Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

جمعت مجموعات بيانات حيود الأشعة السينية في خط الأشعة 7A لمختبر مسرع بوهانغ (كوريا). وقد تم دعم هذه الدراسة من قبل برنامج بحوث العلوم الأساسية التي تديرها المؤسسة الوطنية للبحوث في كوريا (نرف)، بتمويل من وزارة العلوم وتكنولوجيا المعلومات والاتصالات والتخطيط المستقبلي (2015R1A1A01057574 إلى م).

1. إنتاج البروتين المؤتلف وتنقية rc1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد البروتين المؤتلف BC1531 (rBC1531) -البلازميد التعبير <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد الحمض النووي الجيني من B. سيريوس 10 . </li><li style=";tex...

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

يستخدم تعبير البروتين المؤتلف على نطاق واسع للتغلب على المشاكل المرتبطة بمصادر البروتين الطبيعية، مثل كميات البروتين محدودة والتلوث الضارة. وعلاوة على ذلك، في دراسات الجينات المسببة للأمراض والبروتينات، سلالة المختبرات البديلة التي لا تتطلب احتياطات السلامة إضافية يمكن استخدامها. على سبيل المثال، عصية سيريوس هو نموذج مفيد لدراسة عصيات الجمرة الخبيثة بسبب العلاقة التطورية وثيقة 1 . B. الجمرة الخبيثة هو الممرض الملزم الذي يسبب الجمرة الخبيثة استنشاق قاتلة في البشر والماشية، ويمكن أن تستخدم كطائرة بيولوجية 2 . وهكذا، فإن الدراسات المختبرية على B. الخبيثة تخضع لرقابة صارمة من قبل المراكز الأمريكية لمكافحة الأمراض، والتي تتطلب ممارسات السلامة البيولوجية المستوى 3 (بسل-3)، التي تنص على فصل منطقة المختبر مع ضغط الغرفة السلبي. على النقيض من B. الجمرة الخبيثة </eم&gt;، يتم تصنيف B. سيريوس كعامل بسل-1 وبالتالي لديه الحد الأدنى من المخاوف المتعلقة بالسلامة. B. سيريوس هو الممرض الانتهازية التي، عند الإصابة، يسبب التسمم الغذائي التي يمكن علاجها دون مساعدة طبية. ومع ذلك، لأن B. سيريوس سهم العديد من الجينات الحرجة مع B. الجمرة الخبيثة ، وظائف B. البروتينات الجمرة الخبيثة يمكن دراستها باستخدام هومولوجس المقابلة من B. سيريوس 1 . يتم حفظ ba1554 - ba1558 مجموعة الجينات من B. الجمرة الخبيثة للغاية مع bc1531 - bc1535 العنقودية من B. سيريوس ، وكذلك مع مجموعة bt1364-bt1368 من عصيات ثورينجينزيس ، من حيث تنظيم الجينات وتسلسل. وعلاوة على ذلك، فإن الجينات الأولى ( ba1554 ، bc1531 ، و bt1364 ) من مجموعات كل الحفاظ عليها تماما ( أي 100٪ هوية تسلسل النوكليوتيدات)، إمبلينانوغرام دورا حاسما للمنتج الجين في الأنواع العصوية . نظرا لموقعها في هذه المجموعات الجينية، تم تعريف ba1554 خطأ كمنظم النسخ المفترضة 3 . ومع ذلك، تحليل تسلسل الأحماض الأمينية من المنتج ba1554 يشير إلى أنه ينتمي إلى عائلة مازغ، التي لديها نشاط النيوكليوتيدات بيروفوسفهيدرولاز ولا يرتبط مع نشاط عامل النسخ 4 ، 5 . على الرغم من أن البروتينات التي تنتمي إلى عائلة مازغ متنوعة فيما يتعلق بالتتابع الكلي والطول، فإنها تشترك في نطاق مازغ 100 ~ متبقي يتميز عزر إكس 12-28 إكسد (&quot;X&quot; يقف على أي بقايا حمض أميني، وعدد يشير إلى عدد من بقايا X). مجال مازغ لا دائما تمثل مباشرة لنشاط حفزي معين. عضو مازغ من الإشريكية القولونية (إكمازغ) تمتلك اثنين من المجالات مازغ، ولكن جرالي C- محطة مازغ المجال هو الأنزيمية نشطة 6 . وعلاوة على ذلك، فإن خصوصية الركيزة من إنزيمات مازغ يختلف من ثلاثي فوسفات النيوكليوسيد غير محددة (ل إكمازغ) إلى دكب / داتب محددة (للمازجين المرتبطة إنتغرين) و دوتب (ل دوتباسيس) 6 ، 7 ، 8 ، 9 . ولذلك، والتحليلات الفيزيائية الحيوية للبروتين BA1554 ضرورية لتأكيد نشاطها نتباز وفك خصوصية ركيزة لها. هنا، ونحن نقدم بروتوكول خطوة بخطوة أن معظم المختبرات دون مرفق بسل-3 يمكن أن يتبع لتوصيف المنتج البروتين من الجين B. سيريوس bc1531 ، وهو أورثولوغ من B. انثراسيس ba1554 ، على المستوى الجزيئي. باختصار، تم التعبير عن BC1531 المؤتلف (rBC1531) في E. القولونية وتنقيتها باستخدام علامة تقارب. للتجارب البلورية بالأشعة السينية، البلوريةتم فحص ظروف زاتيون من البروتين RBC1531 والأمثل. لتقييم النشاط الأنزيمي من RBC1531، تم رصد نشاط نتباز كولوريمتريكالي لتجنب نوكلأوتيدس المسمى إشعاعيا التي تم استخدامها تقليديا. وأخيرا، مكننا تحليل البيانات الفيزيائية الحيوية التي تم الحصول عليها من تحديد حالة أوليغوميريزاتيون والمعلمات الحفازة من rBC1531، وكذلك للحصول على بيانات حيود الأشعة السينية من الكريستال rc1531.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

للتغلب على القيود واللوائح السلامة عند دراسة الجينات والبروتينات من مسببات الأمراض الحقيقية، ويمكن دراسة مثيلاتها. عصيات الجمرة الخبيثة هو الممرض الملزم الذي يسبب الجمرة الخبيثة استنشاق قاتلة. عصية سيريوس يعتبر نموذجا مفيدا لدراسة B. الجمرة الخبيثة بسبب العلاقة التطورية وثيقة. يتم حفظ مجموعة الجينات ba1554 - ba1558 من B. الجمرة الخبيثة للغاية مع الكتلة bc1531 - bc1535 في B. سيريوس ، وكذلك مع الكتلة bt1364-bt1368 في عصيات ثورينجينزيس، مما يدل على الدور الحاسم للجينات المرتبطة في جنس عصيات . تصف هذه المخطوطة طرق إعداد وتوصيف منتج بروتين من الجين الأول ( ba1554 ) من مجموعة الجينات في B. انثراسيس باستخدام بروتين المؤتلف من أورثولوغ في B. سيريوس ، bc1531.

توصيف البروتين من الاهتمام في هذه الدراسة بدأت من خلال إعداد كمية كافية من المؤتلف B. سيريوس bc1531 (rBC1531) البروتين، ويفضل أكثر من عدة ملليغرام. تم إعداد جزء الحمض النووي ترميز البروتين BC1531 بواسطة ير باستخدام الحمض النووي الجيني من B. سيريوس كقا...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

عصيات الجمرة الخبيثة هو الممرض الملزم من الجمرة الخبيثة استنشاق قاتلة، لذلك يتم تنظيم دراسات جيناته والبروتينات بدقة. وثمة نهج بديل هو دراسة الجينات أورثولوغوس. نحن تصف الدراسات الفيزيائية الحيوية من B. انثراسيس أورثولوغ في B. سيريوس ، bc1531، التي تتطلب الحد الأدنى من المعدات التجريبية والافتقار إلى مخاوف تتعلق بالسلامة خطيرة.

تعبير البروتين المؤتلف، التبلور، والدراسات البيوفيزيائية ل<em&gt; العصوية</em&gt; -conserved النيوكليوتيد بيروفوسفوريلاس، بكمازغ

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization والتعبير وتنقية، وتبلور من السيروتونين الناقل الإنسان ملزمة ل<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

إنتاج وبلورة وتحديد هيكل<em&gt; C. صعب</em&gt; PPEP-1 عن طريق Microseeding والزنك والصحراء

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

التعبير، تنقية، تبلور، واختبارات إنزيم من البروتينات التي تحتوي على مجال الهيدرولاز اتاتس

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

KRAS4b المؤتلف المجهزة بالبالكامل: عزل وتوصيف البروتين فارنيسلاتيد وميثيل

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

PCR موتاجينيسيس، الاستنساخ، التعبير، بروتوكولات تنقية البروتين السريع وتبلور النوع البري وأشكال متحولة من التربتوفان سينتاس

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

إنتاج بروتينات PRMT المؤتلفة باستخدام نظام ناقلات التعبير عن فيروس باكولو

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

مقايسة مضان الكالسيوم "مزدوجة الإضافة" للفحص عالي الإنتاجية لمستقبلات البروتين G المؤتلف

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Protein Crystallization via Microdialysis

تبلور البروتين عالي الإنتاجية عن طريق غسيل الكلى

Understanding the structure-function relationships of macromolecules, such as proteins, at the molecular level is vital for biomedicine and modern drug ...

High-Throughput Screening for Protein Crystallization

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography (Video) | JoVE 

فحص عالي الإنتاجية للحصول على نتائج بلورية لعلم بلورات البروتين

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...