Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

De röntgendiffractie-datasets werden verzameld bij beamline 7A van het Pohang Accelerator Laboratory (Korea). Deze studie werd ondersteund door het Basic Science Research Programma dat wordt beheerd door de National Research Foundation of Korea (NRF), gefinancierd door het ministerie van wetenschap, ICT &amp; toekomstige planning (2015R1A1A01057574 naar MH).

1. Recombinant eiwitproductie en zuivering van rBC1531 <ol><li> Bereiding van een recombinant BC1531 eiwit (rBC1531) -expressie plasmide <ol><li> Bereid het genomisch DNA van B. cereus 10 op . </li><li> Versterk het bc1531- gen uit een sjabloon van B. cereus genomisch DNA door polymerase kettingreactie (PCR), met behulp van voorwaartse en omgekeerde primers (zie de Materials List) om respectievelijk 10 Bam HI- en S...

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

Recombinant eiwit expressie wordt veel gebruikt om problemen die verband houden met natuurlijke eiwitbronnen, zoals beperkte eiwithoeveelheden en schadelijke verontreiniging te overwinnen. Bovendien kan bij studies van pathogene genen en eiwitten een alternatieve laboratoriumstam die geen aanvullende veiligheidsmaatregelen vereist, worden gebruikt. Bacillus cereus is bijvoorbeeld een bruikbaar model voor het bestuderen van Bacillus anthracis door hun nauwe evolutionaire relatie 1 . B. anthracis is een verplicht pathogeen dat dodelijke inademende miltvuur veroorzaakt bij mensen en vee en kan potentieel als bioweapon worden gebruikt 2 . Zo worden laboratoriumstudies op B. anthracis strikt gereguleerd door de Amerikaanse Centers for Disease Control, waarbij biosafety niveau 3 (BSL-3) praktijken vereist worden, waarbij wordt bepaald dat het laboratoriumgebied gescheiden wordt met negatieve kamerdruk. In tegenstelling tot B. anthracis </eM&gt;, B. cereus is gecategoriseerd als een BSL-1-agent en heeft derhalve minimale veiligheidskwesties. B. cereus is een opportunistisch pathogeen dat bij infectie voedselvergiftiging veroorzaakt die zonder medische hulp kan worden behandeld. Aangezien B. cereus veel kritische genen deelt met B. anthracis , kunnen de functies van B. anthracis eiwitten worden bestudeerd onder toepassing van de bijbehorende homologen van B. cereus 1 . De ba1554 - ba1558 gencluster van B. anthracis is sterk bewaard met het bc1531 - bc1535 cluster Van B. cereus , evenals met het bt1364-bt1368 cluster van Bacillus thuringiensis , in termen van genorganisatie en sequentie. Bovendien zijn de eerste genen ( ba1554 , bc1531 en bt1364 ) van de respectieve clusters absoluut behouden ( dwz 100% nucleotide sequentie identiteit), implicietNg een kritische rol van het genproduct in de Bacillus- soort. Vanwege de ligging in deze genclusters was ba1554 verkeerd geïdentificeerd als een vermoedelijke transcriptie regelaar 3 . Echter, aminozuursequentie analyse van het ba1554 product geeft aan dat het behoort tot de MazG familie, die nucleotide pyrofoshydrolase activiteit heeft en niet geassocieerd wordt met transcriptiefactor activiteit 4 , 5 . Hoewel eiwitten die behoren tot de MazG-familie verschillend zijn met betrekking tot de totale sequentie en lengte, delen ze een gemeenschappelijk MazG-domein van 100 resten, gekenmerkt door een EXXE 12-28 EXXD-motief (&quot;X&quot; staat voor elk aminozuurresidu en het getal Geeft het aantal X residuen aan). Het MazG domein vertoont niet altijd direct een bepaalde katalytische activiteit. Een MazG lid van Escherichia coli (EcMazG) bezit twee MazG domeinen, maar opHet C-terminale MazG-domein is enzymatisch actief 6 . Bovendien varieert de substraat specificiteit van MazG enzymen van niet-specifieke nucleoside trifosfaten (voor EcMazG) naar specifieke dCTP / dATP (voor integrin-geassocieerde MazG) en dUTP (voor dUTPases) 6 , 7 , 8 , 9 . Daarom zijn biofysicochemische analyses van het BA1554-eiwit nodig om zijn NTPase-activiteit te bevestigen en zijn substraatspecificiteit te ontcijferen. Hier geven we een stap-voor-stap protocol dat de meeste laboratoria zonder een BSL-3-faciliteit kunnen volgen om het eiwitproduct van het B. cereus bc1531- gen te karakteriseren , dat is een ortholoog van B. anthracis ba1554 , op het moleculaire niveau. In het kort werd recombinant BC1531 (rBC1531) uitgedrukt in E. coli en gezuiverd met behulp van een affiniteitstabel. Voor röntgenkristallografische experimenten, de kristallijZation voorwaarden van het rBC1531 eiwit werden gescreend en geoptimaliseerd. Om de enzymatische activiteit van rBC1531 te beoordelen, werd de NTPase-activiteit kleurimetrisch gecontroleerd om radioactief gemerkte nucleotiden die conventioneel zijn gebruikt te vermijden. Tenslotte maakten analyses van de verkregen biofysicochemische gegevens ons de oligomerisatietoestand en de katalytische parameters van rBC1531 mogelijk, evenals om röntgendiffractiedata van het rBC1531 kristal te verkrijgen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

Om veiligheidsbeperkingen en -regulaties te overwinnen bij het bestuderen van genen en eiwitten van echte pathogenen, kunnen hun homologen worden bestudeerd. Bacillus anthracis is een verplicht pathogeen dat dodelijke inhalatie miltbrand veroorzaakt. Bacillus cereus wordt beschouwd als een bruikbaar model voor het bestuderen van B. anthracis door zijn nauwe evolutionaire relatie. De gencluster ba1554 - ba1558 van B. anthracis wordt sterk bewaard met het bc1531 - bc1535 cluster in B. cereus , evenals met het bt1364-bt1368 cluster in Bacillus thuringiensis, wat de kritische rol van de geassocieerde genen in het Bacillus genus aangeeft. Dit manuscript beschrijft methoden voor het bereiden en karakteriseren van een eiwitproduct van het eerste gen ( ba1554 ) van het gencluster in B. anthracis met behulp van een recombinant eiwit van zijn ortholoog in B. cereus , bc1531.

Karakterisering van het eiwit van belang in deze studie begon door het bereiden van een voldoende hoeveelheid recombinant B. cereus bc1531 (rBC1531) eiwit, bij voorkeur meer dan meerdere milligram. Het DNA fragment dat codeert voor het BC1531 eiwit werd bereid door PCR met behulp van het genomische DNA van B. cereus als een sjabloon, omdat het orthologische genen identiek aan ba1554 bevat . RBC1531 werd overexpresseerd als een oplosbaar eiwit in E. coli</em...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis is het verplichte pathogeen van dodelijke inhalatie miltbrand, zodat studies van zijn genen en eiwitten strikt gereguleerd zijn. Een alternatieve benadering is het bestuderen van orthologische genen. We beschrijven biofysicochemische studies van een B. anthracis ortholog in B. cereus , bc1531, die minimale experimentele apparatuur vereisen en ernstige veiligheidsproblemen ontbreken.

Recombinant Proteïne Expressie, Kristallisatie en Biofysische Studies van a<em&gt; Bacillus</em&gt; -conserveerd nucleotide pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, expressie, zuivering en kristallisatie van het Human serotonine transporter Gebonden aan<em&gt; S</em&gt; citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Productie, kristallisatie en structuur bepalen van<em&gt; C. difficile</em&gt; PPEP-1 via Microseeding en zink-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Expressie, zuivering, kristallisatie, en enzym assays van Fumarylacetoacetate hydrolase domein-bevattende eiwitten

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

Volledig verwerkte recombinant KRAS4b: isoleren en karakteriseren van het Farnesylated en gemethyleerd eiwit

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

PCR Mutagenese, Klonen, Expressie, Snelle Eiwitzuiveringsprotocollen en Kristallisatie van het Wilde Type en Mutante Vormen van Tryptofaan Synthase

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Productie van recombinante PRMT-eiwitten met behulp van het Baculovirus Expression Vector System

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

Een "Dual-Addition" Calcium Fluorescentie Assay voor de High-Throughput Screening van Recombinant G Protein-Coupled Receptors

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Eiwitkristallisatie via microdialyse

Understanding the structure-function relationships of macromolecules, such as proteins, at the molecular level is vital for biomedicine and modern drug ...

High-Throughput Screening for Protein Crystallization

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography (Video) | JoVE 

High-throughput screening om kristalhits te verkrijgen voor eiwitkristallografie

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...