Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

מערכי האפקט של קרני הרנטגן נאספו ב- beamline 7A של מעבדת ה- Pohang Accelerator (קוריאה). מחקר זה נתמך על ידי תוכנית המחקר הבסיסי למדע, אשר ניתנה באמצעות הקרן הלאומית למחקר של קוריאה (NRF), הממומנת על ידי משרד המדע, ICT &amp; תכנון עתידי (2015R1A1A01057574 ל- MH).

1. Recombinant חלבון ייצור וטיהור של rBC1531 <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכנת חלבון BC1531 רקומביננטי (rBC1531) - ביטוי פלסמיד <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכינו DNA גנומי של B. cereus 10 . </li><li style=";text-align:right;direction:rtl"> להגביר...

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

ביטוי חלבון רקומביננטי נעשה שימוש נרחב כדי להתגבר על בעיות הקשורות מקורות חלבון טבעי, כגון כמויות חלבון מוגבל זיהום מזיק. יתר על כן, במחקרים על גנים וחלבונים פתוגניים, ניתן לנצל זן מעבדה חלופי שאינו דורש אמצעי בטיחות נוספים. לדוגמה, Bacillus cereus הוא מודל שימושי לחקר Bacillus anthracis בשל הקשר האבולוציוני הקרוב שלהם 1 . B. anthracis הוא פתוגן מחייב שגורם לאנתרקס משאיפה קטלנית בבני אדם ובעלי חיים, והוא עשוי לשמש כ bioweapon 2 . לפיכך, מחקרים מעבדה על B. anthracis מוסדרים בקפדנות על ידי המרכזים האמריקאים לבקרת מחלות, המחייבים פרקטיקות של רמה 3 (BSL-3) של בטיחות ביולוגית, אשר קובעות כי אזור המעבדה יופרד עם לחץ שלילי בחדר. בניגוד ל- B. anthracis </eM&gt;, B. cereus מסווג כסוכן BSL-1 ולכן יש חששות בטיחות מינימליים. B. cereus הוא פתוגן אופורטוניסטי אשר, עם זיהום, גורם הרעלת מזון שניתן לטפל ללא סיוע רפואי. עם זאת, מכיוון שב &#39;cereus חולק גנים קריטיים רבים עם B. anthracis , ניתן לבדוק את הפונקציות של חלבונים אנתראקיס באמצעות ההומולוגים המתאימים של B. cereus 1 . Ba1554 - ba1558 אשכול גנים של B. anthracis הוא שמר מאוד עם bc1531 - bc1535 אשכול של B. cereus , וכן עם bt1364-bt1368 אשכול של Bacillus thuringiensis , במונחים של ארגון גנים ורצף. יתר על כן, הגנים הראשונים ( ba1554 , bc1531 , bt1364 ) של אשכולות בהתאמה משומרים לחלוטין ( כלומר, 100% רצף נוקלאוטיד זהות), implyiNg תפקיד קריטי של המוצר הגן במינים Bacillus . בשל מיקומה של אשכולות גנים אלה, ba1554 זוהה בטעות כווסת שעתוק משוער 3 . עם זאת, רצף חומצות אמינו ניתוח של המוצר ba1554 מציין כי היא שייכת למשפחת MazG, אשר יש פעילות pyrophosphohydrolase נוקלאוטיד אינו קשור עם גורם שעתוק פעילות 4 , 5 . למרות חלבונים השייכים למשפחת MazG הם מגוונים ביחס לרצף הכולל אורך, הם חולקים משותף ~ 100-שאריות MazG תחום מאופיין EXXE 12-28 EXXD מוטיב (&quot;X&quot; מייצג שאריות חומצות אמינו, ומספר מציין את מספר שאריות X). תחום ה- MazG לא תמיד מייצג באופן ישיר פעילות קטליטית מסוימת. חבר MazG מ Escherichia coli (EcMazG) בעל שני תחומים MazG, אבל בLy מסוף C- תחום MazG הוא פעיל enzymatically 6 . יתר על כן, הספציפי המצע של אנזימים MazG משתנה מ nonphoside nucleoside שאינם ספציפיים (עבור EcMazG) ספציפיים dCTP / dATP (עבור integrin הקשורים מזג) ו DUTP (עבור dUTPases) 6 , 7 , 8 , 9 . לכן, מנתח biophysicochemical של החלב BA1554 יש צורך לאשר פעילות NTPase שלה לפענח את הספציפיות המצע שלה. כאן, אנו מספקים פרוטוקול צעד אחר צעד כי מעבדות ביותר ללא מתקן BSL-3 יכול לעקוב כדי לאפיין את המוצר חלבון של הגן bc1531 B. cereus , שהוא אורתולוג של B. anthracis ba1554 , ברמה המולקולרית. בקצרה, רקומביננטי BC1531 (rBC1531) התבטא ב coli ו מטוהרים באמצעות תג זיקה. עבור ניסויים קריסטלוגרפיים רנטגן, קריסטליZation התנאים של חלבון rBC1531 הוקרנו אופטימיזציה. כדי להעריך את הפעילות האנזימטית של rBC1531, פעילות NTPase היה פיקוח colorimetrically כדי למנוע רדיואקטיבי שכותרתו נוקליאוטידים כי כבר בשימוש מקובל. לבסוף, ניתוחים של הנתונים biophysicochemical שהושגו אפשרה לנו לקבוע את המדינה oligomerization ופרמטרים קטליטי של rBC1531, כמו גם להשיג נתונים עקיפה רנטגן מן גביש rBC1531.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

כדי להתגבר על הגבלות בטיחות ותקנות בעת לימוד גנים וחלבונים מפני פתוגנים אמיתיים, הומולוגים שלהם ניתן ללמוד. Bacillus anthracis הוא פתוגן מחייב שגורם לאנתרקס שאיפה קטלני. Bacillus cereus נחשב מודל שימושי ללימוד ב &#39;אנתרקיס בשל הקשר האבולוציוני הקרוב שלה. אשכול הגנים ba1554 - ba1558 של B. anthracis נשמר מאוד עם אשכול bc1531 - bc1535 ב- B. cereus , וכן עם bt1364-bt1368 באשכול ב- Bacillus thuringiensis, המציין את התפקיד הקריטי של הגנים המשויכים לסוג Bacillus . כתב היד מתאר שיטות להכנת ואפיון של מוצר חלבון של הגן הראשון ( ba1554 ) מקבוצת גנים ב B. anthracis באמצעות חלבון רקומביננטי של אורתולוג ב B. cereus , bc1531.

אפיון של חלבון העניין במחקר זה החל על ידי הכנת כמות מספקת של רקומביננטי B. B. creus bc1531 (rBC1531) חלבון, רצוי יותר ממספר מיליגרם. קטע ה- DNA המקודד את החלבון BC1531 הוכן על ידי PCR באמצעות הדנ&quot;א הגנומי של B. cereus כתבנית, שכן הוא מכיל גנים אורתולוגים זהים ba...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis הוא הפתוגן המחייב של אנתרקס משאיפת קטלני, ולכן מחקרים על הגנים והחלבונים שלהם מוסדרים בקפידה. גישה חלופית היא ללמוד גנים אורתולוגיים. אנו מתארים מחקרים biophysicochemical של B. אנתרקיס אורת&#39;ולוג ב B. cereus , bc1531, הדורש ציוד ניסיוני מינימלי וחסרים בעיות בטיחות חמורות.

ביטוי חלבון רקומביננטי, התגבשות, מחקרים ביופיסיקליים של א<em&gt; Bacillus</em&gt; -שמר Nucleotide Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, ביטוי, טיהור, התגבשות של Transporter סרוטונין האדם Bound כדי<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

הפקה, התגבשות וקביעת מבנה<em&gt; C. difficile</em&gt; PPEP-1 באמצעות Microseeding ואבץ-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

ביטוי, טיהור, התגבשות ואנזים אנזימים המכילים חלבונים בתחום הידרוקלז

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

עיבוד מלא של רקומביננטי KRAS4b: בידוד ואפיון של חלבון הפרג והמתילנטי

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

PCR מוטגנסיס, שיבוט, ביטוי, פרוטוקולי טיהור חלבונים מהירים והתגבשות של סוג הבר וצורות מוטציה של טריפטופן סינתאז

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

ייצור חלבוני PRMT רקומביננטיים באמצעות מערכת וקטור הביטוי של Baculovirus

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

בדיקת סידן פלואורסצנטית "דו-תוספת" לבדיקת תפוקה גבוהה של קולטנים מצומדים לחלבון G רקומביננטי

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Protein Crystallization via Microdialysis

התגבשות חלבון בתפוקה גבוהה באמצעות מיקרודיאליזה

Understanding the structure-function relationships of macromolecules, such as proteins, at the molecular level is vital for biomedicine and modern drug ...

High-Throughput Screening for Protein Crystallization

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography (Video) | JoVE 

סינון בתפוקה גבוהה להשגת פגיעות קריסטליות לקריסטלוגרפיה של חלבונים

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...