Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

X 선 회절 데이터 세트는 포항 가속기 연구소 (한국)의 빔라인 7A에서 수집되었다. 이 연구는 과학 기술부, ICT 및 미래 계획 (2015R1A1A01057574, MH)이 자금을 지원하는 국립 과학 재단 (NRF)을 통해 관리되는 기초 과학 연구 프로그램의 지원을 받았다.

1. rBC1531의 재조합 단백질 생산 및 정제 <ol><li> 재조합 BC1531 단백질 (rBC1531) - 발현 플라스미드 <ol><li> B. cereus 10 의 게놈 DNA를 준비합니다. </li><li> Bam HI 및 Sal I 제한 효소 부위를 각각 생성하기 위해 정방향 및 역방향 프라이머 (물질 목록 참조)를 사용하여 폴리머 라제 연쇄 반응 (PCR)에 의해 B. cereus 게놈 DNA의 템플레이트로부터 bc1531 ...

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

재조합 단백질 발현은 제한된 단백질 양 및 유해한 오염과 같은 천연 단백질 공급원과 관련된 문제점을 극복하기 위해 널리 사용됩니다. 또한 병원성 유전자와 단백질 연구에서 추가적인 안전 예방 조치가 필요없는 대체 실험실 균주를 이용할 수 있습니다. 예를 들어, Bacillus cereus 는 Bacillus anthracis 를 가까운 진화 적 관계 로 연구하는데 유용한 모델이다. B. 탄저균은 사람과 가축에서 치명적인 흡입 탄저병을 일으키는 필수 병원체이며 잠재적으로 생물 표지 2 로 사용될 수 있습니다. 따라서 B. anthracis 에 대한 실험실 연구는 BSL-3 (생물 안전성 수준 3) 관행을 요구하는 미국 질병 통제 센터 (Centers for Disease Control)에 의해 엄격히 규제되며 실험실 구역을 음의 실내 압력으로 격리하도록 요구합니다. B. anthracis 와는 대조적으로 </eB. cereus 는 BSL-1 약제로 분류되어 안전에 대한 염려가 거의 없다. B. cereus 는 감염시 식중독을 일으키는 기회 주의적 병원균으로 의료 지원없이 치료할 수 있습니다. 그러나 B. cereus 는 B. anthracis 와 많은 중요한 유전자를 공유하기 때문에 B. cereus 1의 동족체를 사용하여 B. anthracis 단백질의 기능을 연구 할 수 있습니다. B. anthracis 의 ba1554 - ba1558 유전자 클러스터는 bc1531 - bc1535 클러스터와 잘 보존되어있다. Bacillus thuringiensis 의 bt1364-bt1368 클러스터뿐만 아니라 B. cereus 의 유전자 조직 및 염기 서열에 관한 것이다. 또한, 각 클러스터의 첫 번째 유전자 ( ba1554 , bc1531 및 bt1364 )는 절대적으로 보존되어 있습니다 ( 예 : 100 % 염기 서열 동일성). implyiBacillus 종에서 유전자 산물의 결정적인 역할. 이러한 유전자 클러스터에서의 위치 때문에, ba1554 는 추정 전사 조절 자로 오인되었다. 그러나 ba1554 산물의 아미노산 서열 분석은 MazG family에 속하는 것으로 나타 났는데, 이는 nucleotide pyrophosphohydrolase 활성을 가지고 있으며 전사 인자 활성과 관련이 없다 4 , 5 . MazG 계열에 속하는 단백질은 전체 서열과 길이가 다양하지만 EXXE 12-28 EXXD 모티프로 특징 지워지는 ~ 100 잔기의 MazG 도메인을 공유합니다 ( &quot;X&quot;는 아미노산 잔기를 의미하고 번호 X 잔기의 수를 나타낸다). MazG 도메인은 특정 촉매 활동을 직접적으로 설명하지는 않습니다. Escherichia coli (EcMazG)의 MazG 구성원은 2 개의 MazG 도메인을 보유하고 있지만C 말단 MazG 도메인은 효소 적으로 활성이다 6 . 또한, MazG 효소의 기질 특이성은 비특이적 뉴 클레오 시드 트리 포스페이트 (EcMazG의 경우)에서 특정 dCTP / dATP (인테그린 관련 MazG의 경우) 및 dUTP (dUTPases의 경우) 6 , 7 , 8 , 9로 다양합니다. 따라서 BA1554 단백질의 생물 물리 화학적 분석은 NTPase 활성을 확인하고 기질 특이성을 해독하기 위해 필요하다. 여기에 BSL-3 시설이없는 대부분의 실험실이 분자 수준에서 B. anthracis ba1554 의 ortholog 인 B. cereus bc1531 유전자의 단백질 생성물을 특성화하기 위해 따라갈 수있는 단계별 프로토콜이 제공됩니다. 간단히, 재조합 BC1531 (rBC1531)을 대장균 에서 발현 시키고 친 화성 태그를 사용하여 정제 하였다. X 선 결정학 실험에서 결정rBC1531 단백질의 zation 조건을 스크리닝하고 최적화 하였다. rBC1531의 효소 활성을 평가하기 위해, NTPase 활성을 비색계로 모니터링하여 통상적으로 사용 된 방사성 표지 된 뉴클레오타이드를 회피 하였다. 마지막으로, 얻어진 생 물리 화학적 데이터의 분석은 rBC1531 결정으로부터 X- 선 회절 데이터를 얻는 것뿐만 아니라 rBC1531의 올리고머 화 상태 및 촉매 매개 변수를 결정할 수있게했다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

진정한 병원체에서 유전자와 단백질을 연구 할 때 안전 제한과 규제를 극복하기 위해 동질성을 연구 할 수 있습니다. Bacillus anthracis 는 치명적인 흡입 탄저병을 일으키는 절대 병원균입니다. Bacillus cereus 는 B. anthracis 를 가까운 진화 관계로 연구하는 데 유용한 모델로 간주됩니다. B. anthracis 의 유전자 클러스터 ba1554 - ba1558 은 Bacillus thuringiensis 의 bt1364 - bt1368 클러스터뿐만 아니라 B. cereus 의 bc1531 - bc1535 클러스터와 잘 보존되어 있으며 Bacillus 속의 관련 유전자의 중요한 역할을 나타낸다. 이 원고는 B. cereus , bc1531 에서 ortholog의 재조합 단백질을 사용하여 B. anthracis 의 유전자 클러스터에서 첫 번째 유전자 ( ba1554 )의 단백질 생성물을 준비하고 특성화하는 방법을 설명합니다.

본 연구에서 목적 단백질의 특성화는 충분한 양의 재조합 B. cereus bc1531 (rBC1531) 단백질을, 바람직하게는 수 밀리그램 이상으로 제조함으로써 시작되었다. BC1531 단백질을 코딩하는 DNA 단편은 B. cereus 의 게놈 DNA를 주형으로 사용하는 PCR 법으로 ba1554와 동일한 orthologous gene을 포함하고 있으므로 준비 하였다. rBC1531은 대장균 에서 가용성 단백질로 과...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis 는 치명적인 흡입 탄저의 병원성 물질이기 때문에 유전자와 단백질에 대한 연구가 엄격히 규제됩니다. 또 다른 접근법은 orthologous 유전자를 연구하는 것이다. B. cereus 의 B. anthracis ortholog (bc1531)에 대한 생물학적 물리 화학적 연구는 최소한의 실험 장비를 필요로하며 심각한 안전 문제가 없다고 설명합니다.

재조합 단백질 발현, 결정화 및 생물 물리학 연구<em&gt; 바실러스</em&gt; 보존 된 뉴클레오티드 피로 인산화 효소, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

항온, 발현, 정제, 인간 세로토닌 전달체 결정화 바운드<em&gt; S</em&gt; 시탈 로프 람

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

연구

생화학

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

생산, 결정화 및 구조 결정의<em&gt; C. 남과 어울리지 않는</em&gt; PPEP-1 Microseeding 및 아연 SAD를 통해

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Fumarylacetotate 하이드로 아세테이트 도메인 함유 단백질의 발현, 정제, 결정화 및 효소 어세포

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

완전히 가공된 재조합 KRAS4b: 판자및 메틸화 단백질을 분리하고 특성화

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

PCR 돌연변이 발생, 복제, 발현, 빠른 단백질 정화 프로토콜 및 트립토판 신타제의 야생 유형 및 돌연변이 형태의 결정화

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

바쿨로바이러스 발현 벡터 시스템을 이용한 재조합 PRMT 단백질 생산

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

재조합 G 단백질 결합 수용체의 고처리량 스크리닝을 위한 "이중 첨가" 칼슘 형광 분석

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Protein Crystallization via Microdialysis

Microdialysis를 통한 High-Throughput Protein Crystallization

Understanding the structure-function relationships of macromolecules, such as proteins, at the molecular level is vital for biomedicine and modern drug ...

High-Throughput Screening for Protein Crystallization

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography (Video) | JoVE 

단백질 결정학을 위한 결정 적중을 얻기 위한 고처리량 스크리닝

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...

Protein Sample Setup and Crystallization

Protein Sample Setup and Crystallization (Video) | JoVE 