Name: recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg
Uploaded: 2017-05-16T13:00:00
Description: Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Os conjuntos de dados de difracção de raios X foram recolhidos na linha 7A do Laboratório de Aceleração de Pohang (Coreia). Este estudo foi apoiado pelo Programa de Investigação Científica Básica administrado através da Fundação Nacional de Investigação da Coreia (NRF), financiado pelo Ministério da Ciência, TIC e Planeamento do Futuro (2015R1A1A01057574 a MH).

1. Produção e Purificação de Proteína Recombinante de rBC1531 <ol><li> Preparaï¿½o de um plasmï¿½eo de expressï¿½ da proteï¿½a BC1531 recombinante (rBC1531) <ol><li> Preparar DNA genômico de B. cereus 10 . </li><li> Amplificar o gene bc1531 a partir de um molde de ADN genómico de B. cereus por reacção em cadeia com polimerase (PCR), utilizando iniciadores directos e inversos (ver a Lista de Materiais) para criar locais de...

<ol>
	<li>Ivanova, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+Bacillus+cereus+and+comparative+analysis+with+Bacillus+anthracis.">Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis.</a> Nature. 423, 87-91 (2003).</li><li>Spencer, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacillus+anthracis.">Bacillus anthracis.</a> J Clin Pathol. 56, 182-187 (2003).</li><li>Deli, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LmbE+proteins+from+Bacillus+cereus+are+de-N-acetylases+with+broad+substrate+specificity+and+are+highly+similar+to+proteins+in+Bacillus+anthracis.">LmbE proteins from Bacillus cereus are de-N-acetylases with broad substrate specificity and are highly similar to proteins in Bacillus anthracis.</a> FEBS J. 277, 2740-2753 (2010).</li><li>Gross, M., Marianovsky, I., Glaser, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MazG+--+a+regulator+of+programmed+cell+death+in+Escherichia+coli.">MazG -- a regulator of programmed cell death in Escherichia coli.</a> Mol Microbiol. 59, 590-601 (2006).</li><li>Galperin, M. Y., Moroz, O. V., Wilson, K. S., Murzin, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=House+cleaning,+a+part+of+good+housekeeping.">House cleaning, a part of good housekeeping.</a> Mol Microbiol. 59, 5-19 (2006).</li><li>Lee, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+Escherichia+coli+MazG,+the+regulator+of+nutritional+stress+response.">Crystal structure of Escherichia coli MazG, the regulator of nutritional stress response.</a> J Biol Chem. 283, 15232-15240 (2008).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dimeric+dUTPases,+HisE,+and+MazG+belong+to+a+new+superfamily+of+all-alpha+NTP+pyrophosphohydrolases+with+potential+&amp;#34;house-cleaning&amp;#34;+functions.">Dimeric dUTPases, HisE, and MazG belong to a new superfamily of all-alpha NTP pyrophosphohydrolases with potential &amp;#34;house-cleaning&amp;#34; functions.</a> J Mol Biol. 347, 243-255 (2005).</li><li>Robinson, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+putative+house-cleaning+enzyme+encoded+within+an+integron+array:+1.8+A+crystal+structure+defines+a+new+MazG+subtype.">A putative house-cleaning enzyme encoded within an integron array: 1.8 A crystal structure defines a new MazG subtype.</a> Mol Microbiol. 66, 610-621 (2007).</li><li>Moroz, O. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+crystal+structure+of+a+complex+of+Campylobacter+jejuni+dUTPase+with+substrate+analogue+sheds+light+on+the+mechanism+and+suggests+the+&amp;#34;basic+module&amp;#34;+for+dimeric+d(C/U)TPases.">The crystal structure of a complex of Campylobacter jejuni dUTPase with substrate analogue sheds light on the mechanism and suggests the &amp;#34;basic module&amp;#34; for dimeric d(C/U)TPases.</a> J Mol Biol. 342, 1583-1597 (2004).</li><li>Green, M., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning: A laboratory Manual. 1, (2012).</li><li>Brown, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Gene cloning an introduction. , (1986).</li><li>Kim, M. I., Hong, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Crystal+structure+of+the+Bacillus-conserved+MazG+protein,+a+nucleotide+pyrophosphohydrolase.">Crystal structure of the Bacillus-conserved MazG protein, a nucleotide pyrophosphohydrolase.</a> Biochem Biophys Res Commun. 472, 237-242 (2016).</li><li>Sheehan, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Physical biochemistry: Principles and applications. , (2009).</li><li>Lesley, S. A., Wilson, I. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+crystallization+at+the+joint+center+for+structural+genomics.">Protein production and crystallization at the joint center for structural genomics.</a> J Struct Funct Genomics. 6, 71-79 (2005).</li><li>Jeon, Y. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+and+biochemical+characterization+of+bacterial+YpgQ+protein+reveals+a+metal-dependent+nucleotide+pyrophosphohydrolase.">Structural and biochemical characterization of bacterial YpgQ protein reveals a metal-dependent nucleotide pyrophosphohydrolase.</a> J Struct Biol. 195, 113-122 (2016).</li></ol>

Studies of true pathogens are limited due to safety restrictions and regulations. Alternatively, pathogens can be studied using evolutionarily related non-pathogens or less pathogenic species. The ba1554 gene is considered a critical gene in B. anthracis. Fortunately, an identical gene is present in nonclinical B. cereus. Thus, without serious safety concerns, recombinant BC1531 protein can be used for biophysical and enzymatic characterization. Here, we described detailed procedures, moving fr...

A expressão de proteína recombinante é amplamente utilizada para superar problemas associados a fontes de proteína naturais, tais como quantidades limitadas de proteínas e contaminação prejudicial. Além disso, nos estudos de genes patogénicos e proteínas, uma estirpe laboratorial alternativa que não requer precauções adicionais de segurança pode ser utilizada. Por exemplo, Bacillus cereus é um modelo útil para estudar Bacillus anthracis devido à sua estreita relação evolutiva 1 . B. anthracis é um agente patogénico obrigatório que provoca o antraz mortal por inalação em seres humanos e gado e pode potencialmente ser utilizado como arma biológica 2 . Assim, os estudos laboratoriais sobre B. anthracis são rigorosamente regulados pelos Centros de Controle de Doenças dos Estados Unidos, exigindo práticas de nível 3 de biossegurança (BSL-3), que determinam que a área do laboratório seja segregada com pressão negativa. Em contraste com B. anthracis </eM&gt;, B. cereus é categorizado como um agente BSL-1 e, portanto, tem preocupações mínimas de segurança. B. cereus é um patógeno oportunista que, após a infecção, provoca intoxicação alimentar que pode ser tratada sem assistência médica. No entanto, uma vez que B. cereus partilha muitos genes críticos com B. anthracis , as funções das proteínas de B. anthracis podem ser estudadas utilizando os correspondentes homólogos de B. cereus 1 . O agrupamento de genes ba1554 - ba1558 de B. anthracis é altamente conservado com o agrupamento bc1531 - bc1535 De B. cereus , bem como com o grupo bt1364-bt1368 de Bacillus thuringiensis , em termos de organização e sequência de genes. Além disso, os primeiros genes ( ba1554 , bc1531 e bt1364 ) dos respectivos clusters são absolutamente conservados ( isto é, 100% de identidade de sequência de nucleótidos), implyiUm papel crítico do produto gênico nas espécies de Bacillus . Devido à sua localização nestes agrupamentos de genes, ba1554 foi mal identificado como um suposto transcrição regulador [ 3] . No entanto, a análise da sequência de aminoácidos do produto ba1554 indica que pertence à família MazG, que tem actividade de nucleótido pirofosfoidrolase e não está associada à actividade do factor de transcrição 4 , 5 . Embora as proteínas pertencentes à família MazG sejam diversas em relação à sequência e ao comprimento globais, partilham um domínio MazG comum de ~ 100 resíduos caracterizado por um motivo EXXE 12-28 EXXD (&quot;X&quot; significa qualquer resíduo de aminoácido e o número Indica o número de resíduos X). O domínio MazG nem sempre representa diretamente uma determinada atividade catalítica. Um membro MazG de Escherichia coli (EcMazG) possui dois domínios MazG, mas emO domínio MazG C-terminal é enzimaticamente activo 6 . Além disso, a especificidade do substrato de enzimas MazG varia de nucleosídeos trifosfatos não específicos (para EcMazG) para dCTP / dATP específicos (para integrados MazG) e dUTP (para dUTPases) 6 , 7 , 8 , 9 . Por conseguinte, são necessárias análises biofísicoquímicas da proteína BA1554 para confirmar a sua actividade NTPase e para decifrar a sua especificidade de substrato. Aqui, fornecemos um protocolo passo a passo que a maioria dos laboratórios sem uma instalação BSL-3 pode seguir para caracterizar o produto proteico do gene B. cereus bc1531 , que é um ortholog de B. anthracis ba1554 , a nível molecular. Resumidamente, BC1531 recombinante (rBC1531) foi expresso em E. coli e purificado utilizando um marcador de afinidade. Para experimentos cristalográficos de raios X,Zação da proteína rBC1531 foram selecionadas e otimizadas. Para avaliar a actividade enzimática de rBC1531, a actividade de NTPase foi monitorizada colorimetricamente para evitar nucleótidos marcados radioactivamente que foram convencionalmente utilizados. Finalmente, as análises dos dados biofísico-químicos obtidos nos permitiram determinar o estado de oligomerização e os parâmetros catalíticos de rBC1531, bem como obter dados de difração de raios X a partir do cristal rBC1531.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Bacillus cereus ATCC14579</td>
			<td>Korean Collection for Tissue Culture</td>
			<td>3624</td>
			<td></td>
		</tr>
		<tr>
			<td>Genomic DNA prep kit</td>
			<td>GeneAll</td>
			<td>106-101</td>
			<td>Genomic DNA preparation</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>Macrogen</td>
			<td>GAAGGATCCGGAAGCAAAAA 
			CGATGAAAGATATGCA</td>
			<td>BamHI site is underlined</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>Macrogen</td>
			<td>CTTGTCGACTTATTCTTTCTCT 
			CCCTCATCAATACGTG</td>
			<td>SalI site is underlined</td>
		</tr>
		<tr>
			<td>nPfu-Forte</td>
			<td>Enzynomics</td>
			<td>P410</td>
			<td>PCR polymerase</td>
		</tr>
		<tr>
			<td>BamHI</td>
			<td>Enzynomics</td>
			<td>R003S</td>
			<td></td>
		</tr>
		<tr>
			<td>SalI</td>
			<td>Enzynomics</td>
			<td>R009S</td>
			<td></td>
		</tr>
		<tr>
			<td>pET49b expression vector</td>
			<td>Novagen</td>
			<td>71463</td>
			<td>Expression vector was modified to add affinity tags and BamHI/SalI sites10</td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Enzynomics</td>
			<td>M001S</td>
			<td></td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>18265017</td>
			<td></td>
		</tr>
		<tr>
			<td>Dry block heater</td>
			<td>JSR</td>
			<td>JSBL-02T</td>
			<td></td>
		</tr>
		<tr>
			<td>LB broth (Luria-Bertani)</td>
			<td>LPS solution</td>
			<td>LB-05</td>
			<td></td>
		</tr>
		<tr>
			<td>LB Agar, Miller (Luria-Bertani)</td>
			<td>Becton, Dickinson and Company</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>LPS solution</td>
			<td>KAN025</td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-prep kit</td>
			<td>Favorgen</td>
			<td>FAPDE300</td>
			<td>Plasmid DNA preparation</td>
		</tr>
		<tr>
			<td>BL21(DE3) Competent cell</td>
			<td>Novagen</td>
			<td>69450-3CN</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG)</td>
			<td>Fisher BioReagents</td>
			<td>50-213-378</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride</td>
			<td>Daejung</td>
			<td>7548-4100</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium chloride</td>
			<td>Daejung</td>
			<td>6566-4405</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Potassium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>PB0445</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Sodium phosphate</td>
			<td>Bio Basic Inc</td>
			<td>S0404</td>
			<td>PBS material</td>
		</tr>
		<tr>
			<td>Imidazole</td>
			<td>Bio Basic Inc</td>
			<td>IB0277</td>
			<td></td>
		</tr>
		<tr>
			<td>Sonicator</td>
			<td>Sonics</td>
			<td>VCX 130</td>
			<td></td>
		</tr>
		<tr>
			<td>Ni-NTA agaros</td>
			<td>Qiagen</td>
			<td>30210</td>
			<td>Nickel bead</td>
		</tr>
		<tr>
			<td>Rotator</td>
			<td>Finepcr</td>
			<td>AG</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Dual Color Standards</td>
			<td>Bio-rad</td>
			<td>1610374</td>
			<td>SDS-PAGE protein standard</td>
		</tr>
		<tr>
			<td>Coonmassie Brilliant Blue R-250</td>
			<td>Fisher BioReagents</td>
			<td>BP101-25</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Methyl alcohol</td>
			<td>Samchun chemical</td>
			<td>M0585</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Acetic acid</td>
			<td>Daejung</td>
			<td>1002-4105</td>
			<td>Coomassie staining solution</td>
		</tr>
		<tr>
			<td>Dialysis memebrane</td>
			<td>Thermofisher</td>
			<td>68035</td>
			<td></td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>Sigma-aldrich</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>Thrombin</td>
			<td>Merckmillipore</td>
			<td>605157-1KUCN</td>
			<td>Prepare aliquots of 20 &#956;l (1 Unit per &#956;l) and store at 70 &#176;C and thaw before use</td>
		</tr>
		<tr>
			<td>Superdex 200 16/600</td>
			<td>General Electric</td>
			<td>28989335</td>
			<td>Size exclusion chromatography</td>
		</tr>
		<tr>
			<td>Gel filtration standard</td>
			<td>Bio-rad</td>
			<td>151-1901</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifugal filter</td>
			<td>Amicon</td>
			<td>UFC800396</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystralization plates</td>
			<td>Hampton research</td>
			<td>HR3-083</td>
			<td>96-well sitting drop plate</td>
		</tr>
		<tr>
			<td>The JCSG core suite I-IV</td>
			<td>Qiagen</td>
			<td>130924-130927</td>
			<td>Crystallization secreening solution</td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>SMZ745T</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryschem plates</td>
			<td>Hampton research</td>
			<td>HR3-158</td>
			<td>24-well sitting drop plate</td>
		</tr>
		<tr>
			<td>Inorganic pyrophosphatase</td>
			<td>Sigma</td>
			<td>10108987001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ammonium molybdate solution</td>
			<td>Sigma</td>
			<td>13106-76-8</td>
			<td></td>
		</tr>
		<tr>
			<td>L-ascorbic acid</td>
			<td>Sigma</td>
			<td>50-81-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NTP substrate</td>
			<td>Startagene</td>
			<td>200415-51</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Biotek</td>
			<td>SynergyH1</td>
			<td>microplate reader</td>
		</tr>
		<tr>
			<td>GraphPad Prism 5</td>
			<td>GraphPad</td>
			<td>Prism 5 for Window</td>
			<td></td>
		</tr>
	</tbody>
</table>

recombinant protein expression, crystallization, and biophysical studies of a bacillus-conserved nucleotide pyrophosphorylase, bcmazg

Para superar as restrições e regulamentações de segurança ao estudar genes e proteínas de patógenos verdadeiros, seus homólogos podem ser estudados. Bacillus anthracis é um agente patogénico obrigatório que provoca o antraz mortal por inalação. Bacillus cereus é considerado um modelo útil para estudar B. anthracis devido à sua estreita relação evolutiva. O grupo de genes ba1554 - ba1558 de B. anthracis é altamente conservado com o cluster bc1531 - bc1535 em B. cereus , bem como com o cluster bt1364 - bt1368 em Bacillus thuringiensis, indicando o papel crítico dos genes associados no gênero Bacillus . Este manuscrito descreve métodos para preparar e caracterizar um produto proteico do primeiro gene ( ba1554 ) do grupo genético em B. anthracis usando uma proteína recombinante de seu ortholog em B. cereus , bc1531.

A caracterização da proteína de interesse neste estudo começou por preparar uma quantidade suficiente de proteína Bc1531 (rBC1531) recombinante de B. cereus , de preferência mais do que vários miligramas. O fragmento de ADN que codifica a proteína BC1531 foi preparado por PCR utilizando o ADN genómico de B. cereus como molde, uma vez que contém genes ortólogos idênticos a ba1554 . RBC1531 foi sobre-expresso como uma proteína solúvel em c?...

Watch this Scientific Journal Video about Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG at JoVE.com

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Bacillus anthracis é o agente patogénico obrigatório do antraz mortal por inalação, pelo que os estudos dos seus genes e proteínas são rigorosamente regulados. Uma abordagem alternativa é estudar genes ortólogos. Descrevemos estudos biofísico-químicos de um ortólogo de B. anthracis em B. cereus , bc1531, requerendo equipamento experimental mínimo e sem preocupações de segurança graves.

Expressão de Proteína Recombinante, Cristalização e Estudos Biofísicos de<em&gt; Bacillus</em&gt; -conservado Nucleotide Pyrophosphorylase, BcMazG

To overcome safety restrictions and regulations when studying genes and proteins from true pathogens, their homologues can be studied. Bacillus anthracis ...

Research

JoVE Journal

Biochemistry

Recombinant Protein Expression, Crystallization, and Biophysical Studies of a Bacillus-conserved Nucleotide Pyrophosphorylase, BcMazG

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Thermostabilization, Expression, Purification, and Crystallization of the Human Serotonin Transporter Bound to S-citalopram

Termoestabilização, expressão, purificação e cristalização do transportador de serotonina humano Bound to<em&gt; S</em&gt; -citalopram

The serotonin transporter is a sodium and chloride-coupled transporter that &#34;pumps&#34; extracellular serotonin into cells. S-citalopram is a drug ...

Bioquímica

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Production, Crystallization and Structure Determination of C. difficile PPEP-1 via Microseeding and Zinc-SAD

Produção, cristalização e determinação da estrutura de<em&gt; C. difficile</em&gt; PPEP-1 via microdispersão e Zinco-SAD

New therapies are needed to treat Clostridium difficile infections that are a major threat to human health. The C. difficile metalloprotease PPEP-1 is a ...

Expression, Purification, Crystallization, and Enzyme Assays of Fumarylacetoacetate Hydrolase Domain-Containing Proteins

Expressão, purificação, cristalização e ensaios enzimáticos de proteínas contendo domínio de Fumarilacetoacetato de hidrolase

Fumarylacetoacetate hydrolase (FAH) domain-containing proteins (FAHD) are identified members of the FAH superfamily in eukaryotes. Enzymes of this ...

Fully Processed Recombinant KRAS4b: Isolating and Characterizing the Farnesylated and Methylated Protein

KRAS4b recombinante totalmente processado: Isolando e caracterizando a proteína farnesylated e metilada

Protein prenylation is a key modification that is responsible for targeting proteins to intracellular membranes. KRAS4b, which is mutated in 22% of human ...

PCR Mutagenesis, Cloning, Expression, Fast Protein Purification Protocols and Crystallization of the Wild Type and Mutant Forms of Tryptophan Synthase

PCR Mutagenesis, Clonagem, Expressão, Protocolos rápidos de purificação de proteínas e Cristalização do Tipo Selvagem e Formas Mutantes de Synthase Triptofano

Structural studies with tryptophan synthase (TS) bienzyme complex (&#945;2&#946;2 TS) from Salmonella typhimurium have been performed to better understand ...

Production of Recombinant PRMT Proteins using the Baculovirus Expression Vector System

Produção de Proteínas PRMT Recombinantes utilizando o Sistema Vetorial de Expressão baculovírus

Protein arginine methyltransferases (PRMTs) methylate arginine residues on a wide variety of proteins that play roles in numerous cellular processes. ...

A "Dual-Addition" Calcium Fluorescence Assay for the High-Throughput Screening of Recombinant G Protein-Coupled Receptors

Um ensaio de fluorescência de cálcio de "dupla adição" para a triagem de alto rendimento de receptores acoplados à proteína G recombinante

G protein-coupled receptors (GPCRs) represent the largest superfamily of receptors and are the targets of numerous human drugs. High-throughput screening ...

High-Throughput Protein Crystallization via Microdialysis

High-Throughput Protein Crystallization via Microdialysis

Cristalização de proteínas de alto rendimento via microdiálise

Understanding the structure-function relationships of macromolecules, such as proteins, at the molecular level is vital for biomedicine and modern drug ...

High-Throughput Screening for Protein Crystallization

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography

High-Throughput Screening to Obtain Crystal Hits for Protein Crystallography (Video) | JoVE 

Triagem de alto rendimento para obter hits de cristal para cristalografia de proteínas

X-ray crystallography is the most commonly employed technique to discern macromolecular structures, but the crucial step of crystallizing a protein into ...

Protein Sample Setup and Crystallization

Protein Sample Setup and Crystallization (Video) | JoVE 

Configuração e cristalização de amostras de proteína