Name: studying cell cycle-regulated gene expression by two complementary cell synchronization protocols
Uploaded: 2017-06-06T15:45:00
Description: Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

ونشكر أعضاء مختبرات زوبياغا ومختبرات ألتمير على المناقشات المفيدة والدعم التقني. وأيد هذا العمل من خلال منح مقدمة من الوزارة الإسبانية (SAF2015-67562-R، مينيكو / فيدر، إي)، وحكومة الباسك (IT634-13 و كك-2015/89)، وجامعة الباسك أوب / إهو ( UFI11 / 20).

1. الخلوية التزامن والإفراج عن ورصد دورة الخلية التقدم <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> Thymidine- و نوكودازول القائم (ثي-نوك) تزامن والإفراج عن خلايا U2OS من ميتوسيس <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد المطلوبة وسط ثقافة الخلية. ...

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

ويتطلب تحليل الجينات المنظمة الدقيقة التي تنطوي على أدوار عابرة ومحددة في دورة الخلية وجود خلية موحدة. يستخدم العديد من الباحثين بشكل روتيني خطوط الخلايا السرطانية الطويلة الأمد لهذه الأغراض، وقد تم تطوير مجموعة متنوعة من الأساليب للحصول على سكان الخلية المتزامنة ...

يقترن الانتقال من خلال جميع مراحل دورة الخلية إلى برنامج التعبير الجيني منظم بإحكام. ويعتقد أن هذا التنسيق &quot;داخل وخارج&quot; من النسخ الجيني في جميع أنحاء دورة الخلية لتكون تحت سيطرة النظم التنظيمية النسخي المعقدة، وتنظيم ليس فقط توقيت ولكن أيضا مستويات التعبير الجيني. ومن المعروف أن إزالة الضوابط من مكونات دورة الخلية الرئيسية للمساهمة في تطوير العديد من الأمراض وهو سمة راسخة جيدا من الأورام 1 ، 2 . كشفت التحاليل ترانسكريبتوميك على نطاق الجينوم التي أجريت في الخميرة وخلايا الثدييات أن عددا كبيرا من الجينات تظهر أنماط التعبير الجيني الدوري في دورة الخلية، مما يشير إلى أن التذبذب النسخي خلال دورة الخلية هو انعكاس للمتطلبات الزمنية لمنتج معين الجينات في مرحلة دقيقة 3 ، 4 ، </sup&gt; 5 . وهناك مهمة رئيسية في دراسة التعبير الجيني تنظيم دورة الخلية هو تزامن الخلايا في مراحل دورة الخلية محددة. تزامن الخلية يساعد على تفسير ارتباط نمط التعبير الجيني إلى مرحلة معينة مرحلة الانتقال الخلية، وقد أدى إلى فهم أفضل لتنظيم ووظيفة العديد من الجينات. تزامن الخلية هو أيضا مهم لدراسة آلية عمل الأدوية المضادة للسرطان، كما هي معروفة وكلاء العلاج الكيميائي لتؤثر على كل من التعبير الجيني وكذلك حركية دورة الخلية 6 ، 7 . ومع ذلك، فإنه غالبا ما يكون من الصعب تحديد ما إذا كانت الاختلافات التعبير الجيني الناتجة عن العلاج مع هذه العوامل هي استجابة مباشرة للعلاج أو هي مجرد نتيجة للتغيرات في ملامح دورة الخلية. للتمييز بين هذه الاحتمالات، يجب تحليل التعبير الجيني في الخلايا التي تم قينكرونيزد قبل إضافة الدواء العلاج الكيميائي. وباستثناء بعض الخلايا الأولية مثل الخلايا اللمفاوية المعزولة حديثا، والتي تشكل خلية متجانسة من السكان متزامنة في G08 -، في المختبر أنشئت خطوط الخلايا تنمو بشكل غير متزامن في الثقافة. في ظل ظروف النمو العادية، يتم العثور على هذه الخلايا الدراجات غير متزامنة في جميع مراحل دورة الخلية ولكن، بشكل تفضيلي في G1 9 . ولذلك، فإن هذا السياق لا يوفر سيناريو الأمثل لتحليل وظيفي أو التعبير الجيني في مرحلة دورة الخلية محددة (على سبيل المثال G1، S الخ). خطوط الخلايا الخلود غير المتحولة ( مثل الخلايا الليفية) يمكن أن تكون متزامنة مع ما يسمى الأساليب الفسيولوجية 10 . وتستند هذه الأساليب على ميزات الخلية الأولية الاحتفاظ الخلايا غير المحولة، مثل تثبيط الاتصال الخلية وعامل الاعتماد الاعتماد من أجل مواصلة ركوب الدراجات. إزالةمن المصل في تركيبة مع تثبيط الاتصال يجعل الخلايا غير المحولة القبض على G0 / G1. ومع ذلك، متزامن دخول دورة الخلية والتقدم غالبا ما يتطلب ثقافة فرعية، والذي ينطوي أيضا انفصال الاصطناعي من الخلايا وإعادة طلاء 10 . الأهم من ذلك، هذه الطريقة ليست مناسبة لمزامنة خطوط الخلايا المحولة، فإن الغالبية العظمى من خطوط الخلايا المعمول بها في الوقت الحاضر في الاستخدام، تتميز لعدم وجود خلية الاتصال بوساطة تثبيط النمو أو الاستجابة لانسحاب عامل النمو. وبالتالي، فمن الواضح أن هناك حاجة إلى أساليب بديلة لتزامن الخلايا كفاءة في مراحل محددة من دورة الخلية. وبصفة عامة، فإن أساليب المزامنة الأكثر استخداما تعتمد على تثبيط كيميائي أو دوائي عابر لنقطة واحدة محددة من دورة الخلية، وعادة ما تكون تخليق الحمض النووي أو تشكيل المغزل الانقسامي. تثبيط تخليق الحمض النووي تزامن الخلايا عن طريق اعتقالهم في أواخر G1 أو مرحلة S في وقت مبكر. هذا يمكن أن يكون أتشيالتي تم تثبيتها من خلال إضافة مركبات مثل ميموسين، مثبط من النيوكليوتيدات الحيوي 11 ، 12 ، أفيديكولين، مثبط من بوليمراتس الحمض النووي 13 ، 14 ، هيدروكسيوريا، مثبط ريبوكتاز ريبونوكليوتيد 15 ، 16 أو كميات زائدة من ثيميدين 17 ، 18 . من ناحية أخرى، مثبطات البلمرة أنيبيب، مثل الكولشيسين أو نوكودازول، قادرة على منع تشكيل المغزل الانقسامية مما يؤدي إلى تزامن الخلية في وقت مبكر M المرحلة 19 ، 20 ، 21 . في هذا العمل وصفنا طريقة تنطوي على اثنين من بروتوكولات التزامن التكميلية على أساس تثبيط الكيميائية عابرة لدراسة التعبير عن الجينات تنظيم دورة الخلية في مرنامستوى. هذه الطريقة أساسية لتحديد دور الجينات دورة الخلية في عمليات دورة الخلية محددة. وعلاوة على ذلك، فإنه يوفر إطارا عاما لدراسة تأثير العلاجات المضادة للسرطان من أجل الكشف بدقة عن الجينات التي تستجيب المخدرات والتقليل من التفسيرات الخاطئة المستمدة من الاضطرابات في تطور دورة الخلية الناتجة عن هذه الأدوية.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DMEM, high glucose, GutaMAX supplement</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965-059</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, qualified, E.U.-approved, South America origin</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X), phenol red</td>
			<td>Thermo Fisher Scientific</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Thymidine</td>
			<td>SIGMA</td>
			<td>T1895-5G</td>
			<td>Freshly prepared. Slight warming might help dissolve thymidine.</td>
		</tr>
		<tr>
			<td>Nocodazole</td>
			<td>SIGMA</td>
			<td>M-1404</td>
			<td>Stock solution in DMSO stored at -20 &#186;C in small aliquots</td>
		</tr>
		<tr>
			<td>Hydroxyurea</td>
			<td>SIGMA</td>
			<td>H8627</td>
			<td>Freshly prepared</td>
		</tr>
		<tr>
			<td>Mitomycin C from Streptomyces caespitosus</td>
			<td>SIGMA</td>
			<td>M4287</td>
			<td>1.5mM stock solution in sterile H2O protected from light and stored at 4&#186;C</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide</td>
			<td>SIGMA</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>SIGMA</td>
			<td>P4170</td>
			<td>Stock solution in sterile PBS at 5 mg/ml, stored at 4&#186; C protected from light.</td>
		</tr>
		<tr>
			<td>PBS pH 7.6</td>
			<td></td>
			<td></td>
			<td>Home made</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>PANREAC</td>
			<td>A3678,2500</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C2432</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate</td>
			<td>PANREAC</td>
			<td>131655</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse A</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>LifeTechnologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>QIAGEN</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368814</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Cyclin E1 antibody</td>
			<td>Cell Signaling</td>
			<td>4129</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-Cyclin B1 antibody</td>
			<td>Cell Signaling</td>
			<td>4135</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-&#946;-actin</td>
			<td>SIGMA</td>
			<td>A-5441</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Anti-pH3 (Ser 10) antiboty</td>
			<td>Millipore</td>
			<td>06-570</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-rabbit AlexaFluor 488 antibody</td>
			<td>Invitrogen</td>
			<td>R37116</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-mouse-HRP antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-3697</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Forward E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGACATCACCAACGTCCTTGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; CTGTGCGAGGTCCTGGGTC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; GGAAAGGCAACAGCAAACTCT</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGGGAGAGCACCAAGAGTAGAAGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; AGCAGAGGAAGACCATGTGGAC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TTTCGACCCTGAGAGTCTCCAG</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward TBP antibody (human) reference gene&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse TBP antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward Oxa1L antibody (human) reference gene&#160;&#160; CACTTGCCAGAGATCCAGAAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse Oxa1L &#160;antibody (human)&#160;&#160;&#160; CACAGGGAGAATGAGAGGTTTATAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Power SYBRGreen PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368702</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS Tubes&#160;</td>
			<td>Sarstedt</td>
			<td>551578</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 96-Well Reaction Plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning 100mm TC-Treated Culture Dish</td>
			<td>Corning</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Costar cell culture plates 6 well</td>
			<td>Corning</td>
			<td>3506</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 R</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td>
			<td>Jouan</td>
			<td>743205604</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop Lite Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSCalibur Flow Cytometer</td>
			<td>BD Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 3 Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>A28567</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

يمثل برنامج التعبير الجيني لدورة الخلية خطوة حاسمة لفهم العمليات المعتمدة على دورة الخلية ودورها في أمراض مثل السرطان. وينظم تحليل التعبير الجيني خلية تنظيم دورة على تزامن الخلية في مراحل محددة. نحن هنا وصف طريقة باستخدام اثنين من بروتوكولات التزامن التكميلية التي تستخدم عادة لدراسة الاختلاف الدوري للتعبير الجيني خلال دورة الخلية. ويستند كلا الإجراءين على عرقلة عابرة دورة الخلية في نقطة واحدة محددة. بروتوكول التزامن من قبل العلاج هيدروكسي يوريا (هو) يؤدي إلى الاعتقال الخلوي في أواخر G1 / مرحلة مبكرة S، والإفراج عن اعتقال بوساطة هو يوفر السكان الخلوية تتقدم بشكل موحد من خلال S و G2 / M. بروتوكول التزامن من قبل ثيميدين و نوكودازول (ثي-نوك) خلايا كتل العلاج في الانقسام المبكر، والإفراج عن ثي-نوك بوساطة اعتقال يوفر السكان الخلوية متزامنة مناسبة ل G1 المرحلة و S المرحلة إنحاول الدراسات. تطبيق كلا الإجراءين يتطلب رصد ملامح توزيع دورة الخلية، والتي يتم تنفيذها عادة بعد بروديبيوم يوديد (بي) تلطيخ الخلايا وتدفق الخلوي تحليل بوساطة محتوى الحمض النووي. وتبين لنا أن الجمع بين استخدام اثنين من بروتوكولات التزامن هو نهج قوي لتحديد واضح ملامح النسخي من الجينات التي تنظم بشكل مختلف في دورة الخلية ( أي E2F1 و E2F7)، وبالتالي للحصول على فهم أفضل لدورها في دورة الخلية العمليات. وعلاوة على ذلك، وتبين لنا أن هذا النهج هو مفيد لدراسة الآليات الكامنة وراء العلاجات القائمة على المخدرات ( أي ميتوميسين C، عامل مضاد للسرطان)، لأنه يسمح للتمييز الجينات التي تستجيب لعامل السمية الجينية من تلك المتضررة فقط من اضطرابات دورة الخلية التي يفرضها الوكيل.

تمثيل تخطيطي للبروتوكولات الخاصة بك و هي-هو لتزامن الخلية. يلخص الشكل 1 الخطوات المطلوبة لتزامن خلية U2OS وجمع العينات اللاحقة من أجل التحقق من التقدم من خلال دورة الخلية وإجراء تحليلات ا...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

نحن تقرير بروتوكولات مزامنة الخلية التي توفر سياق لدراسة الأحداث المتعلقة مراحل محددة من دورة الخلية. وتبين لنا أن هذا النهج مفيد لتحليل تنظيم جينات محددة في دورة الخلية غير المضطربة أو عند التعرض للعوامل التي تؤثر على دورة الخلية.

دراسة الخلية التعبير عن تنظيم دورة الجينات من قبل اثنين من بروتوكولات التزامن الخلية التكميلية

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

قياس موازية التعبير الإيقاعية جين ساعة وهرمون إفراز في مزارع الخلايا الأولية البشرية

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

وحيدة الخلية التعبير الجيني عن طريق المتعددة RT-QPCR لتوصيف عدم التجانس من السكان اللمفاوية نادر

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

تربية ومزدوجة الذين تقطعت بهم السبل بوساطة الحمض النووي الريبي الجينات ضربة قاضية في إخفاء بيتل،<em&gt; Dermestes المبقعة</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

وحيدة الخلية التعبير الجيني التنميط عن طريق نظام مراقبة الأصول الميدانية وQPCR مع المعايير الداخلية

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

جيل يعتمد على الاختيار ومستقل من كريسبر / كاس 9 بوساطة جين نوكوتس في خلايا الثدييات

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

ريتروفيرال المسح الضوئي: تعيين مواقع تكامل ملف لتحديد المناطق التنظيمية الخاصة بالخلية

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

التحديد الكمي "المعلومات المشفرة" واسطة الجينات التعبير مستويات خلال عمر التحوير تحت نطاق واسع "الغذائية التقييد" في C. ايليجانس

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

أسلوب أوبتوجينيتيك لمراقبة وتحليل أنماط التعبير الجيني في تفاعلات الخلية للخلية

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

تعطيل الجينات ذات كفاءة عالية من الخلايا السلف مورين والبشرية المكونة للدم قبل كريسبر/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

استكشاف ميكروبيومي الجذر: استخراج البيانات المجتمع البكتيرية من التربة، ورهيزوسفيري، واندوسفيري الجذر

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...