Name: studying cell cycle-regulated gene expression by two complementary cell synchronization protocols
Uploaded: 2017-06-06T15:45:00
Description: Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

אנו מודים לחברי Zubiaga ומעבדות Altmeyer לדיונים מועילים ולתמיכה טכנית. עבודה זו נתמכה על ידי מענקים מהמשרד הספרדי (SAF2015-67562-R, MINECO / FEDER, UE), ממשלת הבאסקים (IT634-13 ו KK-2015/89), ואת אוניברסיטת המדינה הבסקית UPV / EHU ( UFI11 / 20).

1. סינכרון נייד, שחרור ומעקב של התקדמות מחזור התא <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> תימידין ו- nocodazole מבוססי (Thy-Noc) סינכרון ושחרור של תאים U2OS מ מיטוזה <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> הכינו המדיום הנדרש לתרבות תאים. תאים U2OS גדלים ?...

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

ניתוח גנים מווסתים עדינים המעורבים בתפקידים זמניים וספציפיים במחזור התא דורשים אוכלוסיית תאים אחידה. חוקרים רבים משתמשים באופן שגרתי בקווי תאים סרטניים ארוכי טווח למטרות אלו, ומספר שיטות פותחו כדי להשיג אוכלוסיות תאים סינכרוני (או סינכרוני), במטרה לצבור תאים רבים כ...

המעבר דרך כל השלבים של מחזור התא הוא מצורף לתוכנית ביטוי הגן מוסדר היטב. זה מתואמת &quot;לסירוגין&quot; של שעתוק גנים ברחבי מחזור התא הוא האמין להיות תחת שליטה של ​​מערכות תמלול מורכבות תעתיק, המסדיר לא רק את העיתוי, אלא גם את רמות ביטוי גנים. הדה-רגולציה של מרכיבי מחזורי התא העיקריים ידועה כתורמת להתפתחותן של מספר מחלות והיא סימן ההיכר המובהק של tumorigenesis 1 , 2 . ניתוחי גנום רחבי תמליל שבוצעו בתאי שמרים ותאי יונקים גילו שמספר רב של גנים מציגים דפוסי ביטוי גנטיים מחזוריים במחזור התא, דבר המצביע על כך שתנודות תעתיק במהלך מחזור התא משקפות את הדרישה הטמפורלית של מוצר גנטי נתון בשלב 3 , 4 , </suP&gt; 5 . משימה מרכזית בחקר מחזור גנים מוסדר במחזור גנים היא סינכרון של תאים לשלבים ספציפיים של מחזור התא. סינכרון תאים מסייע לפרש את ההתאמה של דפוס ביטוי גנטי לתא מסוים של מעבר מחזורי התא, והוא הוביל להבנה טובה יותר של הרגולציה והתפקוד של גנים רבים. סינכרון סלולרי חשוב גם לחקר מנגנון הפעולה של תרופות נגד סרטן, כמו סוכני כימותרפיה ידועים להשפיע הן ביטוי גנים כמו גם מחזור תאים קינטיקה 6 , 7 . עם זאת, לעתים קרובות קשה לקבוע אם הפרשי ביטוי גנים הנובעים מטיפול בסוכנים אלה הם תגובה ישירה לטיפול או שהם רק תוצאה של שינויים בפרופילי מחזור התא. כדי להבחין בין האפשרויות הללו, ביטוי גנים צריך להיות מנותח בתאים שהיו sYnchronized לפני תוספת של תרופה כימותרפית. למעט כמה תאים ראשוניים כגון תאים לימפואידים מבודדים טרי, אשר מהווים אוכלוסיית תאים הומוגנית מסונכרן G0 8 -, במבחנה הוקמה שורות תאים לגדול באופן אסינכרוני בתרבות. תחת תנאי צמיחה רגילים, אלה אופניים אסינכרוני אופניים נמצאים בכל השלבים של מחזור התא אבל, מעדיפים G1 9 . לכן, הקשר זה אינו מספק תרחיש אופטימלי עבור ניתוח פונקציונלי או ביטוי גנים בשלב מחזור תא מסוים ( לדוגמה , G1, S וכו &#39;). שורות תאים נצחיות שלא הוסבו ( כגון fibroblasts) ניתן לסנכרן עם מה שמכונה שיטות פיזיולוגיות 10 . שיטות אלה מבוססות על תכונות התא העיקרי שנשמר של תאים שאינם משנים, כגון עיכוב קשר עם תא ותלות גורם גדילה כדי להמשיך את רכיבה על אופניים. הֲסָרָהשל סרום בשילוב עם עיכוב מגע הופך תאים שאינם הופכים נעצרו ב G0 / G1. עם זאת, מסומן מחזור מחזור התא התקדמות לעתים קרובות דורש תת, אשר כרוך גם ניתוק מלאכותי של תאים מחדש ציפוי 10 . והכי חשוב, שיטה זו אינה מתאימה לסינכרון של שורות תאים שהשתנו, הרוב המכריע של שורות תאים מבוססות הנמצאות בשימוש, המאופיינות בחסרונם של עיכובים בצמיחת מגע בתא או בתגובה לנסיגת גורמי גדילה. לכן, ברור כי שיטות חלופיות נדרשים סינכרון תא יעיל בשלבים ספציפיים של מחזור התא. באופן כללי, שיטות הסינכרון הנפוצות ביותר מבוססות על עיכוב כימי זמני או פרמקולוגי של נקודה מוגדרת אחת של מחזור התא, בדרך כלל סינתזה של DNA או יצירת ציר מיטוטי. עיכוב של סינתזת דנ&quot;א מסנכרן תאים על ידי מעצר אותם בסוף G1 או בשלב S מוקדם. זה יכול להיות achiEved על ידי הוספת תרכובות כגון mimosine, מעכב של ביוטוסיזה של נוקליאוטיד 11 , 12 , aphidicolin, מעכב של פולימרים 13 , 14 , hydroxyurea, מעכב של ribonucleotide רדוקטאז 15 , 16 או על ידי כמויות עודפות של תימידין 17 , 18 . מצד שני, מעכבי פילמור microtubule, כגון קולצ&#39;יצין או nocodazole, מסוגלים לחסום היווצרות ציר מיטוטי המוביל סינכרון התא בשלב M מוקדם 19 , 20 , 21 . בעבודה זו אנו מתארים שיטה המערבת שני פרוטוקולים סינכרון משלימים המבוססים על עיכוב כימי חולף ללימוד הביטוי של גנים מחזורי מוסדר מחזור התא ב mRNAרָמָה. שיטה זו היא בסיסית להגדרת תפקידם של גנים במחזור תאים בתהליכי מחזור תאים ספציפיים. יתר על כן, הוא מספק מסגרת כללית לחקר ההשפעה של טיפולים נגד סרטן כדי לזהות במדויק את הגנים המגיבים לתרופות ולמזער הפרעות שגויות הנגזרות מהפרעות בתהליכי מחזור התא שנוצרו על ידי תרופות אלו.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DMEM, high glucose, GutaMAX supplement</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965-059</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, qualified, E.U.-approved, South America origin</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X), phenol red</td>
			<td>Thermo Fisher Scientific</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Thymidine</td>
			<td>SIGMA</td>
			<td>T1895-5G</td>
			<td>Freshly prepared. Slight warming might help dissolve thymidine.</td>
		</tr>
		<tr>
			<td>Nocodazole</td>
			<td>SIGMA</td>
			<td>M-1404</td>
			<td>Stock solution in DMSO stored at -20 &#186;C in small aliquots</td>
		</tr>
		<tr>
			<td>Hydroxyurea</td>
			<td>SIGMA</td>
			<td>H8627</td>
			<td>Freshly prepared</td>
		</tr>
		<tr>
			<td>Mitomycin C from Streptomyces caespitosus</td>
			<td>SIGMA</td>
			<td>M4287</td>
			<td>1.5mM stock solution in sterile H2O protected from light and stored at 4&#186;C</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide</td>
			<td>SIGMA</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>SIGMA</td>
			<td>P4170</td>
			<td>Stock solution in sterile PBS at 5 mg/ml, stored at 4&#186; C protected from light.</td>
		</tr>
		<tr>
			<td>PBS pH 7.6</td>
			<td></td>
			<td></td>
			<td>Home made</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>PANREAC</td>
			<td>A3678,2500</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C2432</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate</td>
			<td>PANREAC</td>
			<td>131655</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse A</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>LifeTechnologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>QIAGEN</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368814</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Cyclin E1 antibody</td>
			<td>Cell Signaling</td>
			<td>4129</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-Cyclin B1 antibody</td>
			<td>Cell Signaling</td>
			<td>4135</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-&#946;-actin</td>
			<td>SIGMA</td>
			<td>A-5441</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Anti-pH3 (Ser 10) antiboty</td>
			<td>Millipore</td>
			<td>06-570</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-rabbit AlexaFluor 488 antibody</td>
			<td>Invitrogen</td>
			<td>R37116</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-mouse-HRP antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-3697</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Forward E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGACATCACCAACGTCCTTGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; CTGTGCGAGGTCCTGGGTC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; GGAAAGGCAACAGCAAACTCT</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGGGAGAGCACCAAGAGTAGAAGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; AGCAGAGGAAGACCATGTGGAC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TTTCGACCCTGAGAGTCTCCAG</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward TBP antibody (human) reference gene&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse TBP antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward Oxa1L antibody (human) reference gene&#160;&#160; CACTTGCCAGAGATCCAGAAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse Oxa1L &#160;antibody (human)&#160;&#160;&#160; CACAGGGAGAATGAGAGGTTTATAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Power SYBRGreen PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368702</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS Tubes&#160;</td>
			<td>Sarstedt</td>
			<td>551578</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 96-Well Reaction Plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning 100mm TC-Treated Culture Dish</td>
			<td>Corning</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Costar cell culture plates 6 well</td>
			<td>Corning</td>
			<td>3506</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 R</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td>
			<td>Jouan</td>
			<td>743205604</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop Lite Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSCalibur Flow Cytometer</td>
			<td>BD Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 3 Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>A28567</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

התוכנית ביטוי גנים של מחזור התא מייצג צעד קריטי להבנת התהליכים תלוי מחזור התא ואת תפקידם במחלות כגון סרטן. התא מחזור מוסדר ניתוח ביטוי גנים תלוי בסנכרון התא לשלבים ספציפיים. כאן אנו מתארים שיטה ניצול שני פרוטוקולים סינכרון משלימים כי הוא נפוץ בחקר וריאציה תקופתית של ביטוי גנים במהלך מחזור התא. שני ההליכים מבוססים על חסימה זמנית של מחזור התא בנקודה אחת מוגדרת. פרוטוקול הסינכרון על ידי הידרוקסיאורה (HU) מוביל לתא סלולרי בסוף שלב G1 / מוקדם S, ושחרור ממעצר HU מתווך מספק אוכלוסייה סלולרית מתקדם באופן אחיד באמצעות S ו- G2 / M. פרוטוקול הסינכרון על-ידי טיפול ב- thymidine ו- nocodazole (Thy-Noc) חוסם תאים במיטוזה מוקדמת, ושחרור ממעצר Thy-Noc בתיווך מספק אוכלוסיה סלולרית מסונכרנת המתאימה לשלב G1 ו- S שלבEvacpid יישום של שני הליכים דורש ניטור של פרופילי הפצה מחזור התא, אשר מבוצעת בדרך כלל לאחר propidium יודיד (PI) מכתים של התאים זרימת cytometry בתיווך ניתוח של תוכן ה- DNA. אנו מראים שהשימוש המשולב בשני פרוטוקולי סינכרון הוא גישה חזקה לבירור ברור של הפרוטוקולים התעתיקיים של גנים המווסתים באופן דיפרנציאלי במחזור התא ( כלומר E2F1 ו- E2F7), וכתוצאה מכך יש הבנה טובה יותר של תפקידם במחזור התא תהליכים. יתר על כן, אנו מראים כי גישה זו שימושית עבור מחקר של מנגנונים המבוססים על תרופות מבוססות תרופה ( כלומר, mitomycin C, סוכן antiancer), משום שהוא מאפשר להפלות גנים כי מגיבים סוכן genotoxic מאלה שהושפעו רק על ידי הפרעות מחזור התא שהוטל על ידי הסוכן.

ייצוג סכמטי של פרוטוקולים Thy-Noc ו- HU עבור סינכרון תאים. איור 1 מסכם את הצעדים הנדרשים עבור סינכרון תא U2OS ואת אוסף המדגם הבאים על מנת לאמת את ההתקדמות דרך מחזור התא ולבצע ניתוח ביטוי גנים. </p...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

אנו מדווחים על שני פרוטוקולים של סינכרון תאים המספקים הקשר ללימוד אירועים הקשורים לשלבים ספציפיים של מחזור התא. אנו מראים כי גישה זו שימושית לניתוח הרגולציה של גנים ספציפיים במחזור תאים לא מופרע או בחשיפה לסוכנים המשפיעים על מחזור התא.

לימוד מחזור גנים ביטוי מוסדר על ידי שני פרוטוקולי סינכרון התא

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

מדידה במקביל של ביטוי גנים השעון הביולוגי ואת הפרשת הורמון בתרביות תאים ראשוניים אדם

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

ביטוי גנים תא בודד באמצעות Multiplex RT-qPCR לאפיון הטרוגניות של אוכלוסיות הלימפה נדירים

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

התרומם על רגליו אחורי פעמים תקועות מציאת גן בתיווך רנ&quot;א סתר החיפושית,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

תאים יחידים Gene Expression Profiling שימוש FACS ו qPCR עם סטנדרטים פנימיים

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

הבחירה תלויה עצמאית הדור של CRISPR / Cas9 בתיווך גין Knockouts בתאי יונקים

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Retroviral סריקה: מיפוי MLV אתרי אינטגרציה להגדרת אזורים רגולטוריים ספציפיים לתא

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

כימות של מידע מקודד על ידי גנים ביטוי רמות במהלך תוחלת החיים אפנון תחת הגבלת תזונה מגוון רחב C . elegans

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

שיטת Optogenetic לשלוט ולנתח ג'ין תבניות ביטוי באינטראקציות לתא

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

שיבוש גנטי יעילים ביותר מאתר ואנושי Hematopoietic ובתאים מאת CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

לחקור את השורש Microbiome: שליפת נתונים הקהילה חיידקי מן האדמה, Rhizosphere, Endosphere שורש

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...