Name: studying cell cycle-regulated gene expression by two complementary cell synchronization protocols
Uploaded: 2017-06-06T15:45:00
Description: Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Zubiaga 및 Altmeyer 연구소의 구성원에게 도움이되는 토론과 기술 지원에 감사드립니다. 이 작업은 바스크 정부 (IT634-13 및 KK-2015 / 89)와 바스크 국 UPV / EHU (바스크 정부)의 스페인 교육부 (SAF2015-67562-R, MINECO / FEDER, UE) UFI11 / 20).

1. 세포주기의 세포 동조, 방출 및 모니터링 <ol><li> 유사 분열에서 U2OS 세포의 Thymidine- 및 nocodazole- 기반 (Thy-Noc) 동기화 및 방출 <ol><li> 필요한 세포 배양 배지를 준비하십시오. U2OS 세포는 10 % (vol / vol) FBS (선택 : 1 % 페니실린 / 스트렙토 마이신)로 보충 된 DMEM- 글루타민 배지에서 일상적으로 성장시킨다. 멸균 조건에서 모든 배지 준비 및 조작을 수행하고 사용하기 전에 보완 된 배지 (?...

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

세포주기에서 일시적인 역할과 특정 역할에 관여하는 미세 조정 된 유전자의 분석에는 균일 한 세포 집단이 필요합니다. 많은 연구자들은 이러한 목적을 위해 오래 동안 종양 세포주를 일상적으로 사용하고 있으며 정의 된 세포주기 단계에서 가능한 한 많은 세포를 축적하려는 목적으로 동기식 (또는 부분적으로 동시적인) 세포군을 얻기위한 다양한 방법이 개발되었습니다. 더욱이, 잘 확립 된 ?...

세포주기의 모든 단계를 통한 전이는 엄격하게 조절 된 유전자 발현 프로그램과 결합됩니다. 세포주기를 통한 유전자 전사의 &quot;온 오프&quot;는 타이밍뿐 아니라 유전자 발현 수준을 조절하는 복잡한 전사 조절 시스템의 제어하에 있다고 믿어진다. 주요 세포주기 구성 요소의 조절 해제는 여러 질병의 발병에 기여하는 것으로 알려져 있으며 종양 형성의 확실한 특징입니다 1 , 2 . 효모 및 포유 동물 세포에서 수행 된 게놈 - 전 사체 해독 분석 결과 많은 유전자가 세포주기에서주기적인 유전자 발현 양상을 보임으로써 세포주기 동안의 전사 변동이 주어진 유전자 산물의 일시적인 필요성을 반영한다는 것을 보여 주었다 정확한 단계 3 , 4 , </sup&gt; 5 . 세포주기 조절 유전자 발현 연구의 주요 과제는 세포주기를 특정 세포주기 단계로 동기화시키는 것입니다. 세포 동기화는 특정 세포주기 위상 전이에 대한 유전자 발현 패턴의 연관성을 해석하는 데 도움을 주며 수많은 유전자의 조절과 기능에 대한 더 나은 이해를 이끌어 냈습니다. 세포 동기화는 항암제의 작용 메커니즘을 연구하는 데에도 중요합니다. 화학 요법 제는 유전자 발현뿐만 아니라 세포주기 동역학 6,7 에도 영향을 미치는 것으로 알려져 있습니다. 그럼에도 불구하고 이러한 약제를 사용한 치료로 인한 유전자 발현의 차이가 치료에 대한 직접적인 반응인지 아니면 단지 세포주기 프로파일의 변화의 결과인지 결정하는 것은 종종 어렵습니다. 이러한 가능성을 구별하기 위해, 유전자 발현은 s화학 요법 약물을 첨가하기 전에 미리 채웠다. 갓 분리 된 림프 세포 (G08에 동 기적으로 동질 된 세포 집단을 구성하는)와 같은 일부 초기 세포를 제외하면 시험관 내 확립 된 세포주는 배양 물에서 비동기 적으로 성장합니다. 정상적인 성장 조건에서 이러한 비동기 사이클링 세포는 세포주기의 모든 단계에서 발견되지만, G1 9 에서 우선적으로 발견됩니다. 따라서이 문맥은 특정 세포주기 단계 ( 예 : G1, S 등)에서 기능적 또는 유전자 발현 분석을위한 최적의 시나리오를 제공하지 않습니다. 비 형질 전환 불멸화 세포주 ( 예 : 섬유 아세포)는 소위 생리적 방법 10 과 동기화 될 수 있습니다. 이러한 방법은 사이클을 계속하기 위해 세포 접촉 억제 및 성장 인자 의존성과 같은 비 형질 전환 세포의 유지 된 일차 세포 특징에 기초한다. 제거접촉 억제와 병용 된 혈청의 혈청 농도는 G0 / G1에서 정지 된 비 형질 전환 세포를 만든다. 그러나 동기화 된 세포주기 진입 및 진행은 종종 계대 배양을 필요로하며, 이는 또한 세포의 인공적인 분리 및 재 - 도금 10을 포함 한다. 가장 중요하게는,이 방법은 세포 접촉 - 매개 성장 억제 또는 성장 인자 금기에 대한 반응이 결여 된 형질 전환 세포주, 현재 사용중인 확립 된 세포주의 대다수에 적합하지 않다. 따라서, 세포주기의 특정 단계에서 효율적인 세포 동기화를 위해 대안적인 방법이 필요하다는 것이 명백하다. 일반적으로 가장 자주 사용되는 동기화 방법은 DNA주기 또는 유사 분열 스핀들 형성과 같은 세포주기의 한 지점에 대한 일시적인 화학적 또는 약리학 적 억제를 기반으로합니다. DNA 합성의 억제는 G1 또는 늦은 S 단계에서 세포를 정지시킴으로써 세포를 동기화시킨다. 이것은 아치 일 수있다.미오신, 뉴클레오티드 생합성 저해제 11,12 , 아피 디 콜린, DNA 폴리머 라제 13,14 , 히드 록시 우레아 억제제, 리보 뉴클레오타이드 리덕 타제 저해제 15,16 또는 과량의 티미 딘 17,18과 같은 화합물의 첨가에 의해 치료 될 수있다. 한편, 콜히친이나 노코 다졸과 같은 미세 소관 중합 억제제는 초기 M 단계에서 세포 동기화를 유도하는 유사 분열 스핀들 형성을 차단할 수 있습니다 19 , 20 , 21 . 이 연구에서 우리는 mRNA에서 세포주기 조절 유전자의 발현을 연구하기 위해 일시적 화학 저해에 기초한 두 개의 보완적인 동기화 프로토콜을 포함하는 방법을 기술한다수평. 이 방법은 특정 세포주기 과정에서 세포주기 유전자의 역할을 정의하는 기본입니다. 또한 항암 치료법의 영향을 연구하여 약물 반응 유전자를 정확하게 검출하고 이러한 약물에 의해 생성 된 세포주기 진행의 혼란으로 인한 잘못된 해석을 최소화하기위한 일반적인 프레임을 제공합니다.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DMEM, high glucose, GutaMAX supplement</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965-059</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, qualified, E.U.-approved, South America origin</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X), phenol red</td>
			<td>Thermo Fisher Scientific</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Thymidine</td>
			<td>SIGMA</td>
			<td>T1895-5G</td>
			<td>Freshly prepared. Slight warming might help dissolve thymidine.</td>
		</tr>
		<tr>
			<td>Nocodazole</td>
			<td>SIGMA</td>
			<td>M-1404</td>
			<td>Stock solution in DMSO stored at -20 &#186;C in small aliquots</td>
		</tr>
		<tr>
			<td>Hydroxyurea</td>
			<td>SIGMA</td>
			<td>H8627</td>
			<td>Freshly prepared</td>
		</tr>
		<tr>
			<td>Mitomycin C from Streptomyces caespitosus</td>
			<td>SIGMA</td>
			<td>M4287</td>
			<td>1.5mM stock solution in sterile H2O protected from light and stored at 4&#186;C</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide</td>
			<td>SIGMA</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>SIGMA</td>
			<td>P4170</td>
			<td>Stock solution in sterile PBS at 5 mg/ml, stored at 4&#186; C protected from light.</td>
		</tr>
		<tr>
			<td>PBS pH 7.6</td>
			<td></td>
			<td></td>
			<td>Home made</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>PANREAC</td>
			<td>A3678,2500</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C2432</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate</td>
			<td>PANREAC</td>
			<td>131655</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse A</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>LifeTechnologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>QIAGEN</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368814</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Cyclin E1 antibody</td>
			<td>Cell Signaling</td>
			<td>4129</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-Cyclin B1 antibody</td>
			<td>Cell Signaling</td>
			<td>4135</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-&#946;-actin</td>
			<td>SIGMA</td>
			<td>A-5441</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Anti-pH3 (Ser 10) antiboty</td>
			<td>Millipore</td>
			<td>06-570</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-rabbit AlexaFluor 488 antibody</td>
			<td>Invitrogen</td>
			<td>R37116</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-mouse-HRP antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-3697</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Forward E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGACATCACCAACGTCCTTGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; CTGTGCGAGGTCCTGGGTC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; GGAAAGGCAACAGCAAACTCT</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGGGAGAGCACCAAGAGTAGAAGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; AGCAGAGGAAGACCATGTGGAC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TTTCGACCCTGAGAGTCTCCAG</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward TBP antibody (human) reference gene&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse TBP antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward Oxa1L antibody (human) reference gene&#160;&#160; CACTTGCCAGAGATCCAGAAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse Oxa1L &#160;antibody (human)&#160;&#160;&#160; CACAGGGAGAATGAGAGGTTTATAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Power SYBRGreen PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368702</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS Tubes&#160;</td>
			<td>Sarstedt</td>
			<td>551578</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 96-Well Reaction Plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning 100mm TC-Treated Culture Dish</td>
			<td>Corning</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Costar cell culture plates 6 well</td>
			<td>Corning</td>
			<td>3506</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 R</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td>
			<td>Jouan</td>
			<td>743205604</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop Lite Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSCalibur Flow Cytometer</td>
			<td>BD Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 3 Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>A28567</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

세포주기의 유전자 발현 프로그램은 세포주기 의존적 과정과 암과 같은 질병에서의 그 역할을 이해하는 중요한 단계입니다. 세포주기 조절 유전자 발현 분석은 특정 단계로의 세포 동기화에 달려있다. 여기서 우리는 세포주기 동안 유전자 발현의주기적인 변이를 연구하는데 일반적으로 사용되는 두 개의 보완적인 동기화 프로토콜을 이용하는 방법을 설명한다. 두 절차 모두 하나의 정의 된 지점에서 세포주기를 일시적으로 차단하는 것에 기반합니다. Hydroxyurea (HU) 처리에 의한 동기화 프로토콜은 G1 / 초기 S 기 후반에 세포질 체포를 유도하고, HU- 매개 체포로부터의 방출은 S 및 G2 / M을 통해 균일하게 진행하는 세포 집단을 제공한다. thymidine과 nocodazole (Thy-Noc) 처리에 의한 동기화 프로토콜은 초기 유사 분열에서 세포를 차단하고 Thy-Noc에 의한 체전으로부터의 방출은 G1 기 및 S기에 적합한 동기 세포 집단을 제공한다공부 해봐. 두 절차의 적용은 일반적으로 세포의 프로피 디움 아이오다 이드 (PI) 염색 및 유동 세포 계측법 - 중재 된 DNA 함량 분석 후에 수행되는 세포주기 분포 프로파일의 모니터링을 필요로합니다. 우리는 두 가지 동기화 프로토콜의 결합 된 사용이 세포주기 ( 즉, E2F1 및 E2F7)에서 차별적으로 조절되는 유전자의 전사 프로파일을 명확하게 결정하고 결과적으로 세포주기에서 그들의 역할에 대해 더 잘 이해할 수있는 강력한 접근 방법이라는 것을 보여줍니다 프로세스. 또한,이 접근법은 세포주기 섭동에 의해서만 영향을받는 유전 독성 물질과 유전 독성 물질에 반응하는 유전자를 구별 할 수 있기 때문에 약물 기반 치료법 ​​( 즉, 항암제 인 mitomycin C)의 기초가되는 연구에 유용함을 보여줍니다 대리인에 의해 부과 된

세포 동기화를위한 Thy-Noc 및 HU 기반 프로토콜의 도식적 표현. 그림 1 은 U2OS 세포 동기화 및 후속 샘플 수집에 필요한 단계를 요약하여 세포주기를 통한 진행을 확인하고 유전자 발현 분석을 수행합니다. Phospho-H3 및 PI 염색은 동기화 방법을 선택하는 좋은 평가 변수입니?...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

우리는 세포주기의 특정 단계와 관련된 사건을 연구하기위한 배경 정보를 제공하는 두 가지 세포 동기화 프로토콜을보고합니다. 우리는이 접근법이 교란되지 않은 세포주기 또는 세포주기에 영향을 미치는 약물에 노출되었을 때 특정 유전자의 조절을 분석하는데 유용하다는 것을 보여준다.

두 개의 상보적인 세포 동기화 프로토콜에 의한 세포주기 조절 유전자 발굴 연구

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

인간의 기본 세포 배양의 일주기 시계 유전자 발현 및 호르몬 분비의 병렬 측정

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

연구

유전학

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

멀티 플렉스 RT-qPCR에 사용 단일 세포 유전자 발현은 희귀 림프 인구의 이질성의 특성을

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

양육 및 숨기기 비틀에 RNA 매개 유전자 최저를 두 번 좌초,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

내부 기준에 FACS 및 qPCR에 사용 단일 세포 유전자 발현 프로파일 링

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

포유류 세포에서 CRISPR / Cas9 매개 유전자 knockouts의 선택 의존 및 독립적 생성

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

레트로 바이러스 스캐닝 : MLV 통합 사이트 맵핑으로 세포 특정 규제 지역 정의

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

C. 선 충 에서 광범위 한 범위 식이 제한 유전자 식 수준 동안 수명 변조에서 인코딩된 정보의 정량화

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

제어 하 고 셀 상호 작용에서 유전자 표현 패턴을 분석 하는 Optogenetic 메서드

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

루트 미생물 탐색: 토양, Rhizosphere, 및 루트 Endosphere에서 세균성 지역 사회 데이터 추출

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...