Name: studying cell cycle-regulated gene expression by two complementary cell synchronization protocols
Uploaded: 2017-06-06T15:45:00
Description: Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Agradecemos a los miembros de los laboratorios Zubiaga y Altmeyer por sus útiles debates y por su apoyo técnico. Este trabajo ha contado con el apoyo del Ministerio Español (SAF2015-67562-R, MINECO / FEDER, UE), el Gobierno Vasco (IT634-13 y KK-2015/89) y la Universidad del País Vasco UPV / EHU UFI11 / 20).

1. Sincronización Celular, Liberación y Monitoreo de la Progresión del Ciclo Celular <ol><li> Timidina y nocodazol (Thy-Noc) sincronización y liberación de células U2OS de la mitosis <ol><li> Preparar el medio de cultivo celular requerido. Las células U2OS se cultivan rutinariamente en medio DMEM-Glutamina complementado con FBS al 10% (vol / vol) (opcional: penicilina al 1% / estreptomicina). Realizar toda la preparación y manipulación del medio en condiciones estériles y calentar el medio c...

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

El análisis de la regulación fina de los genes regulados implicados en papeles transitorios y específicos en el ciclo celular requiere una población celular uniforme. Muchos investigadores usan rutinariamente líneas de células tumorales establecidas desde hace mucho tiempo para estos propósitos, y se han desarrollado una variedad de métodos para obtener poblaciones de células síncronas (o parcialmente sincrónicas), con el objetivo de acumular tantas células como sea posible en fases definidas de ciclo celula...

La transición a través de todas las fases del ciclo celular se acopla a un programa de expresión génica fuertemente regulado. Se supone que esta coordinación &quot;en y fuera&quot; de la transcripción de genes a lo largo del ciclo celular está bajo el control de sistemas reguladores transcripcionales complejos, regulando no sólo el momento sino también los niveles de expresión génica. Se sabe que la desregulación de los componentes clave del ciclo celular contribuye al desarrollo de varias enfermedades y es un sello bien establecido de la tumorigénesis 1 , 2 . Los análisis transcriptómicos de todo el genoma llevados a cabo en células de levadura y de mamífero han revelado que un gran número de genes exhiben patrones de expresión génica periódicos en el ciclo celular, lo que sugiere que la fluctuación transcripcional durante el ciclo celular es un reflejo del requisito temporal de un producto génico dado En una fase precisa 3 , 4 , </suP&gt; 5 . Una tarea importante en el estudio de la expresión de genes regulados por el ciclo celular es la sincronización de células en fases específicas del ciclo celular. La sincronización celular ayuda a interpretar la asociación de un patrón de expresión génica a una transición de fase particular del ciclo celular, y ha conducido a una mejor comprensión de la regulación y la función de numerosos genes. La sincronización celular también es importante para el estudio del mecanismo de acción de los fármacos contra el cáncer, ya que los agentes quimioterapéuticos se sabe que afectan tanto la expresión de genes, así como la cinética del ciclo celular [ 6 , 7] . Sin embargo, a menudo es difícil determinar si las diferencias de expresión génica resultantes del tratamiento con estos agentes son una respuesta directa al tratamiento o son meramente la consecuencia de cambios en los perfiles del ciclo celular. Para distinguir entre estas posibilidades, la expresión génica debe analizarse en células que han sido sYnchronized antes de la adición del fármaco quimioterapéutico. Con la excepción de algunas células primarias tales como células linfoides recién aisladas -que constituyen una población celular homogénea sincronizada en G08-, las líneas celulares establecidas in vitro crecen asincrónicamente en cultivo. Bajo condiciones de crecimiento regular, estas células de ciclo asincrónico se encuentran en todas las fases del ciclo celular, pero, preferentemente en G1 9 . Por lo tanto, este contexto no proporciona un escenario óptimo para el análisis funcional o de expresión génica en una fase específica del ciclo celular ( por ejemplo , G1, S, etc.). Las líneas celulares inmortalizadas no transformadas ( por ejemplo, fibroblastos) pueden sincronizarse con los llamados métodos fisiológicos 10 . Estos métodos se basan en las características de células primarias retenidas de las células no transformadas, tales como la inhibición del contacto celular y la dependencia del factor de crecimiento con el fin de continuar el ciclo. EliminaciónDe suero en combinación con inhibición de contacto hace que las células no transformadas sean detenidas en G0 / G1. Sin embargo, la sincronización del ciclo celular de entrada y la progresión a menudo requiere de subcultura, que también implica el desprendimiento artificial de las células y re-chapado [ 10] . Más importante aún, este método no es adecuado para la sincronización de líneas celulares transformadas, la gran mayoría de líneas celulares establecidas actualmente en uso, caracterizado por carecer de inhibición del crecimiento mediada por contacto celular o respuesta a la retirada del factor de crecimiento. Por lo tanto, es evidente que se requieren métodos alternativos para la sincronización celular eficiente en fases específicas del ciclo celular. En términos generales, los métodos de sincronización más utilizados se basan en la inhibición química o farmacológica transitoria de un punto definido del ciclo celular, típicamente síntesis de ADN o formación de huso mitótico. La inhibición de la síntesis de ADN sincroniza las células deteniéndolas en fase G1 tardía o temprana. Esto puede hacerse12 , aphidicolin, un inhibidor de ADN polimerasas 13 , 14 , hidroxiurea, un inhibidor de ribonucleotide reductasa 15 , 16 o por cantidades en exceso de timidina 17 , 18 . Por otra parte, los inhibidores de la polimerización de los microtúbulos, tales como la colchicina o el nocodazol, son capaces de bloquear la formación del huso mitótico que conduce a la sincronización celular a principios de la fase M 19 , 20 , 21 . En este trabajo se describe un método que implica dos protocolos de sincronización complementarios basados ​​en la inhibición química transitoria para el estudio de la expresión de los genes regulados por el ciclo celular en el mRNAnivel. Este método es fundamental para definir el papel de los genes del ciclo celular en procesos específicos del ciclo celular. Además, proporciona un marco general para estudiar el impacto de los tratamientos contra el cáncer con el fin de detectar con precisión genes fármacos sensibles y para minimizar las interpretaciones erróneas derivadas de las perturbaciones en la progresión del ciclo celular generado por estos fármacos.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DMEM, high glucose, GutaMAX supplement</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965-059</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, qualified, E.U.-approved, South America origin</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X), phenol red</td>
			<td>Thermo Fisher Scientific</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Thymidine</td>
			<td>SIGMA</td>
			<td>T1895-5G</td>
			<td>Freshly prepared. Slight warming might help dissolve thymidine.</td>
		</tr>
		<tr>
			<td>Nocodazole</td>
			<td>SIGMA</td>
			<td>M-1404</td>
			<td>Stock solution in DMSO stored at -20 &#186;C in small aliquots</td>
		</tr>
		<tr>
			<td>Hydroxyurea</td>
			<td>SIGMA</td>
			<td>H8627</td>
			<td>Freshly prepared</td>
		</tr>
		<tr>
			<td>Mitomycin C from Streptomyces caespitosus</td>
			<td>SIGMA</td>
			<td>M4287</td>
			<td>1.5mM stock solution in sterile H2O protected from light and stored at 4&#186;C</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide</td>
			<td>SIGMA</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>SIGMA</td>
			<td>P4170</td>
			<td>Stock solution in sterile PBS at 5 mg/ml, stored at 4&#186; C protected from light.</td>
		</tr>
		<tr>
			<td>PBS pH 7.6</td>
			<td></td>
			<td></td>
			<td>Home made</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>PANREAC</td>
			<td>A3678,2500</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C2432</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate</td>
			<td>PANREAC</td>
			<td>131655</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse A</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>LifeTechnologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>QIAGEN</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368814</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Cyclin E1 antibody</td>
			<td>Cell Signaling</td>
			<td>4129</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-Cyclin B1 antibody</td>
			<td>Cell Signaling</td>
			<td>4135</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-&#946;-actin</td>
			<td>SIGMA</td>
			<td>A-5441</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Anti-pH3 (Ser 10) antiboty</td>
			<td>Millipore</td>
			<td>06-570</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-rabbit AlexaFluor 488 antibody</td>
			<td>Invitrogen</td>
			<td>R37116</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-mouse-HRP antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-3697</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Forward E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGACATCACCAACGTCCTTGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; CTGTGCGAGGTCCTGGGTC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; GGAAAGGCAACAGCAAACTCT</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGGGAGAGCACCAAGAGTAGAAGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; AGCAGAGGAAGACCATGTGGAC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TTTCGACCCTGAGAGTCTCCAG</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward TBP antibody (human) reference gene&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse TBP antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward Oxa1L antibody (human) reference gene&#160;&#160; CACTTGCCAGAGATCCAGAAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse Oxa1L &#160;antibody (human)&#160;&#160;&#160; CACAGGGAGAATGAGAGGTTTATAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Power SYBRGreen PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368702</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS Tubes&#160;</td>
			<td>Sarstedt</td>
			<td>551578</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 96-Well Reaction Plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning 100mm TC-Treated Culture Dish</td>
			<td>Corning</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Costar cell culture plates 6 well</td>
			<td>Corning</td>
			<td>3506</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 R</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td>
			<td>Jouan</td>
			<td>743205604</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop Lite Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSCalibur Flow Cytometer</td>
			<td>BD Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 3 Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>A28567</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

El programa de expresión génica del ciclo celular representa un paso crítico para comprender los procesos dependientes del ciclo celular y su papel en enfermedades como el cáncer. El análisis de expresión de genes regulado por el ciclo celular depende de la sincronización celular en fases específicas. Aquí se describe un método que utiliza dos protocolos de sincronización complementarios que se utiliza comúnmente para estudiar la variación periódica de la expresión génica durante el ciclo celular. Ambos procedimientos se basan en el bloqueo transitorio del ciclo celular en un punto definido. El protocolo de sincronización mediante el tratamiento con hidroxiurea (HU) conduce a la detención celular en la fase tardía G1 / S temprana, y la liberación de la detención mediada por HU proporciona una población celular que progresa uniformemente a través de S y G2 / M. El protocolo de sincronización mediante el tratamiento con timidina y nocodazol (Thy-Noc) bloquea células en mitosis temprana y la liberación de la detención mediada por Thy-Noc proporciona una población celular sincronizada adecuada para la fase G1 y la fase SIntente estudios La aplicación de ambos procedimientos requiere la monitorización de los perfiles de distribución del ciclo celular, que se realiza típicamente después de la tinción con yoduro de propidio (PI) de las células y el análisis mediado por citometría de flujo del contenido de ADN. Se muestra que el uso combinado de dos protocolos de sincronización es un enfoque robusto para determinar claramente los perfiles transcripcionales de los genes que se regulan diferencialmente en el ciclo celular ( es decir, E2F1 y E2F7), y por lo tanto para tener una mejor comprensión de su papel en el ciclo celular Procesos. Además, se demuestra que este enfoque es útil para el estudio de los mecanismos subyacentes a las terapias basadas en fármacos ( es decir, la mitomicina C, un agente anticancerígeno), ya que permite discriminar los genes que responden al agente genotóxico de los afectados exclusivamente por las perturbaciones del ciclo celular Impuesto por el agente.

Representación esquemática de los protocolos Thy-Noc y HU para la sincronización celular. La Figura 1 resume los pasos requeridos para la sincronización de células U2OS y la posterior recogida de muestras con el fin de verificar la progresión a través del ciclo celular y realizar análisis de expresión génica. Phospho-H3 y tinción PI son buenos ...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

Presentamos dos protocolos de sincronización celular que proporcionan un contexto para el estudio de eventos relacionados con fases específicas del ciclo celular. Mostramos que este enfoque es útil para analizar la regulación de genes específicos en un ciclo celular no perturbado o en la exposición a agentes que afectan el ciclo celular.

Estudio de la expresión genética regulada por el ciclo celular mediante dos protocolos complementarios de sincronización celular

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

La medición paralela de la expresión de genes circadianos del reloj y Hormona en cultivos celulares primarios humanos

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Investigación

Genética

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

Una sola célula de la expresión génica utilizando multiplex RT-qPCR para caracterizar heterogeneidad de las poblaciones linfoides Raras

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

La cría y el doble-stranded RNA mediada gen desmontables en el Hide Escarabajo,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

Una sola célula de perfiles de expresión génica El uso de FACS y qPCR con las Normas Internas

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Generación dependiente de la selección y independiente de CRISPR / Cas9-mediada Gene Knockouts en células de mamíferos

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Escaneo Retroviral: Mapeo de sitios de integración MLV para definir regiones reguladoras específicas de células

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Cuantificación de la información codificada por el Gene expresión niveles durante la vida útil modulación bajo amplia gama dieta restricción en C. elegans

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

Un método de Optogenetic para controlar y analizar patrones de expresión génica en las interacciones célula a célula

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Interrupción génica altamente eficiente de las células progenitoras hematopoyéticas murinas y humanas por CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Explorar el microbioma de la raíz: extracción de datos de la comunidad bacteriana del suelo, rizosfera y raíz Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...