Name: studying cell cycle-regulated gene expression by two complementary cell synchronization protocols
Uploaded: 2017-06-06T15:45:00
Description: Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Yararlı tartışmalar ve teknik destek için Zubiaga ve Altmeyer laboratuvarlarının üyelerine teşekkür ediyoruz. Bu çalışma, İspanyol Bakanlığından (SAF2015-67562-R, MINECO / FEDER, UE), Bask Hükümeti&#39;nden (IT634-13 ve KK-2015/89) ve Bask Ülkesi UPV / EHU Üniversitesinden hibelerle desteklendi UFI11 / 20).

1. Hücresel Senkronizasyon, Hücre Döngüsü Progresyonunun Yayımı ve İzlenmesi <ol><li> Timidin ve nokodazol esaslı (Thy-Noc) senkronizasyon ve Mitozdan U2OS hücrelerinin salınımı <ol><li> Gerekli hücre kültürü ortamı hazırlayın. U2OS hücreleri,% 10 (hac / hac) FBS ile tamamlanan DMEM-Glutamine ortamında rastgele büyütülür (isteğe bağlı olarak:% 1 penisilin / streptomisin). Tüm orta hazırlama ve manipülasyonu steril koşullar altında gerçekleştirin ve tamamlanıp hazı...

<ol>
	<li>Beato, M., S&#225;nchez-Aguilera, A., Piris, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+cycle+deregulation+in+B-cell+lymphomas.">Cell cycle deregulation in B-cell lymphomas.</a> Blood. 101 (4), 1220-1235 (2003).</li><li>Chen, H. Z., Tsai, S. Y., Leone, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+roles+of+E2Fs+in+cancer:+an+exit+from+cell+cycle+control.">Emerging roles of E2Fs in cancer: an exit from cell cycle control.</a> Nat Rev Cancer. 9 (11), 785-797 (2009).</li><li>Cho, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+regulation+and+function+during+the+human+cell+cycle.">Transcriptional regulation and function during the human cell cycle.</a> Nat Genet. 27 (1), 48-54 (2001).</li><li>Pe&#241;a-Diaz, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+profiling+during+the+cell+cycle+shows+that+a+subset+of+Polycomb-targeted+genes+is+upregulated+during+DNA+replication.">Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication.</a> Nucleic Acids Res. 41 (5), 2846-2856 (2013).</li><li>Grant, G. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cell+cycle-regulated+genes+periodically+expressed+in+U2OS+cells+and+their+regulation+by+FOXM1+and+E2F+transcription+factors.">Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors.</a> Mol Biol Cell. 24 (23), 3634-3650 (2013).</li><li>Minderman, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+and+in+vivo+irinotecan-induced+changes+in+expression+profiles+of+cell+cycle+and+apoptosis-associated+genes+in+acute+myeloid+leukemia+cells.">In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells.</a> Mol Cancer Ther. 4 (6), 885-900 (2005).</li><li>McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistent+DNA+damage+caused+by+low+levels+of+mitomycin+C+induces+irreversible+cell+senescence.">Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence.</a> Cell Cycle. 11 (16), 3132-3140 (2012).</li><li>Infante, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F2+represses+cell+cycle+regulators+to+maintain+quiescence.">E2F2 represses cell cycle regulators to maintain quiescence.</a> Cell Cycle. 7 (24), 3915-3927 (2008).</li><li>Cecchini, M. J., Amiri, M., Dick, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+position+in+mammalian+cells.">Analysis of cell cycle position in mammalian cells.</a> J Vis Exp. (59), (2012).</li><li>Schorl, C., Sedivy, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+cell+cycle+phases+and+progression+in+cultured+mammalian+cells.">Analysis of cell cycle phases and progression in cultured mammalian cells.</a> Methods. 41 (2), 143-150 (2007).</li><li>Lalande, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+arrest+point+in+the+late+G1+phase+of+the+mammalian+cell+cycle.">A reversible arrest point in the late G1 phase of the mammalian cell cycle.</a> Exp Cell Res. 186 (2), 332-339 (1990).</li><li>Park, S. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mimosine+arrests+the+cell+cycle+prior+to+the+onset+of+DNA+replication+by+preventing+the+binding+of+human+Ctf4/And-1+to+chromatin+via+Hif-1&#945;+activation+in+HeLa+cells.">Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1&#945; activation in HeLa cells.</a> Cell Cycle. 11 (4), 761-766 (2012).</li><li>Ikegami, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphidicolin+prevents+mitotic+cell+division+by+interfering+with+the+activity+of+DNA+polymerase-alpha.">Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha.</a> Nature. 275 (5679), 458-460 (1978).</li><li>Baranovskiy, A. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+for+inhibition+of+DNA+replication+by+aphidicolin.">Structural basis for inhibition of DNA replication by aphidicolin.</a> Nucleic Acids Res. 42 (22), 14013-14021 (2014).</li><li>Adams, R. L., Lindsay, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hydroxyurea+reversal+of+inhibition+and+use+as+a+cell-synchronizing+agent.">Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent.</a> J Biol Chem. 242 (6), 1314-1317 (1967).</li><li>Mitxelena, J., Apraiz, A., Vallejo-Rodr&#237;guez, J., Malumbres, M., Zubiaga, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2F7+regulates+transcription+and+maturation+of+multiple+microRNAs+to+restrain+cell+proliferation.">E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation.</a> Nucleic Acids Res. , (2016).</li><li>Bootsma, D., Budke, L., Vos, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+synchronous+division+of+tissue+culture+cells+initiated+by+excess+thymidinE.">Studies on synchronous division of tissue culture cells initiated by excess thymidinE.</a> Exp Cell Res. 33, 301-309 (1964).</li><li>Galgano, P. J., Schildkraut, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=G1/S+Phase+Synchronization+using+Double+Thymidine+Synchronization.">G1/S Phase Synchronization using Double Thymidine Synchronization.</a> CSH Protoc. (2), (2006).</li><li>Edwin Taylor, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+inhibition+and+the+binding+of+h3-colchicine.">Kinetics of inhibition and the binding of h3-colchicine.</a> J Cell Biol. 25, 145-160 (1965).</li><li>Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+large+numbers+of+mitotic+mammalian+cells+by+use+of+the+reversible+microtubule+inhibitor+nocodazole.+Nocodazole+accumulated+mitotic+cells.">Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells.</a> Exp Cell Res. 126 (2), 397-405 (1980).</li><li>Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enrichment+of+cell+populations+in+metaphase,+anaphase,+and+telophase+by+synchronization+using+nocodazole+and+blebbistatin:+a+novel+method+suitable+for+examining+dynamic+changes+in+proteins+during+mitotic+progression.">Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression.</a> Eur J Cell Biol. 91 (5), 413-419 (2012).</li><li>Nolan, T., Hands, R. E., Bustin, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+mRNA+using+real-time+RT-PCR.">Quantification of mRNA using real-time RT-PCR.</a> Nat Protoc. 1 (3), 1559-1582 (2006).</li><li>Thornton, B., Basu, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+(qPCR)+primer+design+using+free+online+software.">Real-time PCR (qPCR) primer design using free online software.</a> Biochem Mol Biol Educ. 39 (2), 145-154 (2011).</li><li>Abbas, T., Dutta, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p21+in+cancer:+intricate+networks+and+multiple+activities.">p21 in cancer: intricate networks and multiple activities.</a> Nat Rev Cancer. 9 (6), 400-414 (2009).</li><li>Kung, A. L., Sherwood, S. W., Schimke, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+line-specific+differences+in+the+control+of+cell+cycle+progression+in+the+absence+of+mitosis.">Cell line-specific differences in the control of cell cycle progression in the absence of mitosis.</a> Proc Natl Acad Sci U S A. 87 (24), 9553-9557 (1990).</li><li>Borel, F., Lacroix, F. B., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prolonged+arrest+of+mammalian+cells+at+the+G1/S+boundary+results+in+permanent+S+phase+stasis.">Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis.</a> J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).</li><li>Knehr, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+critical+appraisal+of+synchronization+methods+applied+to+achieve+maximal+enrichment+of+HeLa+cells+in+specific+cell+cycle+phases).">A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases).</a> Exp Cell Res. 217 (2), 546-553 (1995).</li><li>Zhu, W., Giangrande, P. H., Nevins, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E2Fs+link+the+control+of+G1/S+and+G2/M+transcription.">E2Fs link the control of G1/S and G2/M transcription.</a> EMBO J. 23 (23), 4615-4626 (2004).</li><li>Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+control+of+S+phase+of+the+cell+cycle+by+ubiquitin-conjugating+enzyme+H7.">Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7.</a> Mol Biol Cell. 20 (1), 1-9 (2009).</li><li>Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bora+and+Aurora-A+continue+to+activate+Plk1+in+mitosis.">Bora and Aurora-A continue to activate Plk1 in mitosis.</a> J Cell Sci. 127, 801-811 (2014).</li><li>Thomas, D. B., Lingwood, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+cell+cycle+control:+effects+of+thymidine+on+synchronous+cell+cultures.">A model of cell cycle control: effects of thymidine on synchronous cell cultures.</a> Cell. 5 (1), 37-42 (1975).</li><li>Whitfield, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+genes+periodically+expressed+in+the+human+cell+cycle+and+their+expression+in+tumors.">Identification of genes periodically expressed in the human cell cycle and their expression in tumors.</a> Mol Biol Cell. 13 (6), 1977-2000 (2002).</li><li>Lim, S., Cdks Kaldis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cyclins+and+CKIs:+roles+beyond+cell+cycle+regulation.">cyclins and CKIs: roles beyond cell cycle regulation.</a> Development. 140 (15), 3079-3093 (2013).</li><li>Tapia, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two+mitosis-specific+antibodies,+MPM-2+and+phospho-histone+H3+(Ser28),+allow+rapid+and+precise+determination+of+mitotic+activity.">Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity.</a> Am J Surg Pathol. 30 (1), 83-89 (2006).</li><li>Andreassen, P. R., Martineau, S. N., Margolis, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+mitotic+checkpoint+override+in+mammalian+cells+results+in+aneuploidy+following+a+transient+tetraploid+state.">Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state.</a> Mutat Res. 372 (2), 181-194 (1996).</li><li>Wei, F., Xie, Y., He, L., Tao, L., Tang, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERK1+and+ERK2+kinases+activate+hydroxyurea-induced+S-phase+checkpoint+in+MCF7+cells+by+mediating+ATR+activation.">ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation.</a> Cell Signal. 23 (1), 259-268 (2011).</li><li>Kubota, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+prereplication+complex+is+blocked+by+mimosine+through+reactive+oxygen+species-activated+ataxia+telangiectasia+mutated+(ATM)+protein+without+DNA+damage.">Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage.</a> J Biol Chem. 289 (9), 5730-5746 (2014).</li><li>Hartwell, L. H., Weinert, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Checkpoints:+controls+that+ensure+the+order+of+cell+cycle+events.">Checkpoints: controls that ensure the order of cell cycle events.</a> Science. 246 (4930), 629-634 (1989).</li><li>St-Denis, N. A., Derksen, D. R., Litchfield, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+regulation+of+mitotic+progression+through+temporal+phosphorylation+and+dephosphorylation+of+CK2alpha.">Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha.</a> Mol Cell Biol. 29 (8), 2068-2081 (2009).</li><li>Min, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RAD51C-deficient+cancer+cells+are+highly+sensitive+to+the+PARP+inhibitor+olaparib.">RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib.</a> Mol Cancer Ther. 12 (6), 865-877 (2013).</li></ol>

Hücre döngüsünde geçici ve spesifik rollerde bulunan ince ayarlı regüle genlerin analizi, hücre popülasyonunun düzgünlüğünü gerektirir. Birçok araştırmacı, bu amaçlar için uzun süredir kurulmuş tümör hücresi çizgileri rutin olarak kullanmaktadır ve belirli hücre döngüsü evrelerinde mümkün olduğunca çok hücre biriktirmek amacıyla senkron (veya kısmen senkron) hücre popülasyonları elde etmek için çeşitli yöntemler geliştirilmiştir. Dahası, iyi kurulmuş senkronizasyon yakla...

Hücre döngüsünün tüm aşamalarına geçiş, sıkı düzenlenen bir gen ifade programı ile birleştirilir. Hücre döngüsü boyunca gen transkripsiyonunun &quot;açık ve kapalı&quot; koordine edilmesinin, kompleks transkripsiyon düzenleyici sistemlerin kontrolü altında olduğuna, sadece zamanlamayı değil aynı zamanda gen ifadesinin seviyelerini de düzenlediğine inanılmaktadır. Anahtar hücre döngüsü bileşenlerinin düzenlenmesinin çeşitli hastalıkların gelişimine katkıda bulunduğu bilinmektedir ve bu, tümörojenezin iyi bilinen bir özelliktir 1 , 2 . Maya ve memeli hücrelerinde gerçekleştirilen genom çapındaki transkriptomik analizler, çok sayıda genin hücre döngüsünde periyodik gen ekspresyonu modelleri sergilediğini ortaya koymuştur; bu, hücre döngüsü boyunca transkripsiyonel dalgalanmanın, belirli bir gen ürününün zamansal gereksiniminin bir yansıması olduğunu düşündürmektedir Kesin bir fazda 3 , 4 , </suP&gt; 5 . Hücre döngüsü düzenleyen gen ekspresyonu çalışmasında önemli bir görev, hücrelerin spesifik hücre döngüsü fazlarına senkronize edilmesidir. Hücre senkronizasyonu, bir gen ekspresyon modelinin belirli bir hücre döngüsü faz geçişine ilişkisini yorumlamaya yardımcı olur ve birçok genin düzenlenmesi ve işlevinin daha iyi anlaşılmasına yol açmıştır. Hücre senkronizasyonu, kemoterapötik ajanların hem gen ekspresyonunu hem de hücre döngüsü kinetiğini etkilediği için antikanser ilaçların etki mekanizmasını incelemek için de önemlidir 6 , 7 . Bununla birlikte, bu ajanlarla yapılan tedaviden kaynaklanan gen ekspresyon farklarının tedaviye doğrudan müdahale olup olmadığının veya sadece hücre döngüsü profillerinde meydana gelen değişimlerin sonucunun olup olmadığının belirlenmesi genellikle zordur. Bu olasılıkları birbirinden ayırmak için, gen ekspresyonu,Kemoterapötik ilacın ilavesinden önce senkronize edilmedi. G08&#39;de senkronize edilen homojen bir hücre popülasyonu oluşturan taze izole edilmiş lenfoid hücreler gibi bazı birincil hücreler dışında, in vitro olarak belirlenen hücre hatları kültürde eşzamansız olarak büyür. Normal büyüme koşulları altında, bu eşzamansız döngülü hücreler, hücre döngüsünün her aşamasında, ancak tercihen G1 9&#39;da bulunur . Dolayısıyla, bu bağlam belirli bir hücre döngüsü fazında ( örn. G1, S vb.) Fonksiyonel veya gen ekspresyon analizleri için optimal bir senaryo sağlamamaktadır. Dönüştürülmemiş ölümsüzleştirilmiş hücre çizgileri ( örneğin fibroblastlar), fizyolojik yöntemlerle senkronize edilebilir10. Bu yöntemler, bisiklet sürmeye devam etmek için, hücre teması inhibisyonu ve büyüme faktörü bağımlılığı gibi dönüştürülmemiş hücrelerin tutulan birincil hücre özelliklerine dayanır. uzaklaştırmaTemas inhibisyonu ile kombinasyon halinde, G0 / G1&#39;de tutulan transforme edilmemiş hücreler oluşturmaktadır. Bununla birlikte, senkronize hücre döngüsü girişi ve ilerlemesi, genellikle, hücrelerin yapay olarak ayrılması ve yeniden kaplama 10&#39;u içeren alt-kültürü gerektirir. En önemlisi, bu yöntem, halihazırda kullanımda olan ve hücre kontak aracılı büyüme inhibisyonu ya da büyüme faktörü geri çekilmesine tepki bulunmayan karakterize edilen transforme edilmiş hücre hatlarının senkronizasyonu için uygun değildir. Böylece, hücre döngüsünün spesifik evrelerinde etkin hücre senkronizasyonu için alternatif yöntemlerin gerekli olduğu açıktır. Genel olarak, en sık kullanılan senkronizasyon yöntemleri, tipik olarak DNA sentezi veya mitotik iğ oluşumu gibi hücre döngüsünün tanımlanmış bir noktasının geçici kimyasal veya farmakolojik inhibisyonuna dayanır. DNA sentezinin engellenmesi, onları geç G1 veya erken S evresinde tutarak hücreleri senkronize eder. Bu olabilir achiBir nükleotid biyosentezi 11,12, afidikolin, DNA polimeraz 13 , 14 inhibitörü, hidroksiüre, ribonükleotid redüktaz 15 , 16&#39;nın bir inhibitörü veya fazla miktarlarda timidin 17,18 ile imünosin gibi bileşiklerin ilavesi ile ortaya çıkar. Öte yandan, kolşisin ya da nokodazol gibi mikrotübül polimerizasyonu önleyicileri, M evresi 19 , 20 , 21&#39;in erken evrelerinde hücre senkronizasyonuna yol açan mitotik iğ oluşumunu bloke edebilir. Bu çalışmada mRNA&#39;da hücre döngüsü düzenleyen genlerin ekspresyonunu incelemek için geçici kimyasal inhibisyona dayalı iki tamamlayıcı senkronizasyon protokolünü içeren bir yöntemi açıkladıkseviyesi. Bu yöntem, belirli hücre döngüsü süreçlerinde hücre döngüsü genlerinin rolünün tanımlanması için temel önemdedir. Ayrıca, ilaçla tepki veren genleri doğru bir şekilde saptamak ve bu ilaçlar tarafından üretilen hücre döngüsü ilerlemesindeki pertürbasyonlardan kaynaklanan yanlış yorumlamaları en aza indirgemek için antikanser tedavilerinin etkisini incelemek için genel bir çerçeve sağlar.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>DMEM, high glucose, GutaMAX supplement</td>
			<td>Thermo Fisher Scientific</td>
			<td>61965-059</td>
			<td></td>
		</tr>
		<tr>
			<td>FBS, qualified, E.U.-approved, South America origin</td>
			<td>Thermo Fisher Scientific</td>
			<td>10270-106</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin-EDTA (1X), phenol red</td>
			<td>Thermo Fisher Scientific</td>
			<td>25200-072</td>
			<td></td>
		</tr>
		<tr>
			<td>Thymidine</td>
			<td>SIGMA</td>
			<td>T1895-5G</td>
			<td>Freshly prepared. Slight warming might help dissolve thymidine.</td>
		</tr>
		<tr>
			<td>Nocodazole</td>
			<td>SIGMA</td>
			<td>M-1404</td>
			<td>Stock solution in DMSO stored at -20 &#186;C in small aliquots</td>
		</tr>
		<tr>
			<td>Hydroxyurea</td>
			<td>SIGMA</td>
			<td>H8627</td>
			<td>Freshly prepared</td>
		</tr>
		<tr>
			<td>Mitomycin C from Streptomyces caespitosus</td>
			<td>SIGMA</td>
			<td>M4287</td>
			<td>1.5mM stock solution in sterile H2O protected from light and stored at 4&#186;C</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide</td>
			<td>SIGMA</td>
			<td>D2650</td>
			<td></td>
		</tr>
		<tr>
			<td>Propidium iodide</td>
			<td>SIGMA</td>
			<td>P4170</td>
			<td>Stock solution in sterile PBS at 5 mg/ml, stored at 4&#186; C protected from light.</td>
		</tr>
		<tr>
			<td>PBS pH 7.6</td>
			<td></td>
			<td></td>
			<td>Home made</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>PANREAC</td>
			<td>A3678,2500</td>
			<td></td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>SIGMA</td>
			<td>C2432</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate</td>
			<td>PANREAC</td>
			<td>131655</td>
			<td></td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>SIGMA</td>
			<td>T8787</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse A</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>LifeTechnologies</td>
			<td>15596018</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini kit</td>
			<td>QIAGEN</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>High-Capacity cDNA Reverse Transcription Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368814</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-Cyclin E1 antibody</td>
			<td>Cell Signaling</td>
			<td>4129</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-Cyclin B1 antibody</td>
			<td>Cell Signaling</td>
			<td>4135</td>
			<td>1:1000 dilution in 5% milk, o/n, 4 &#186;C</td>
		</tr>
		<tr>
			<td>Anti-&#946;-actin</td>
			<td>SIGMA</td>
			<td>A-5441</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Anti-pH3 (Ser 10) antiboty</td>
			<td>Millipore</td>
			<td>06-570</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-rabbit AlexaFluor 488 antibody</td>
			<td>Invitrogen</td>
			<td>R37116</td>
			<td>Specified in the protocol</td>
		</tr>
		<tr>
			<td>Secondary anti-mouse-HRP antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-3697</td>
			<td>1:3000 dilution in 5 % milk, 1 hr, RT</td>
		</tr>
		<tr>
			<td>Forward E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGACATCACCAACGTCCTTGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; CTGTGCGAGGTCCTGGGTC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; GGAAAGGCAACAGCAAACTCT</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse E2F7 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TGGGAGAGCACCAAGAGTAGAAGA</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; AGCAGAGGAAGACCATGTGGAC</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse p21Cip1 antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; TTTCGACCCTGAGAGTCTCCAG</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward TBP antibody (human) reference gene&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse TBP antibody (human)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Forward Oxa1L antibody (human) reference gene&#160;&#160; CACTTGCCAGAGATCCAGAAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Reverse Oxa1L &#160;antibody (human)&#160;&#160;&#160; CACAGGGAGAATGAGAGGTTTATAG&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>Biolegio</td>
			<td></td>
			<td>Designed by PrimerQuest tool (https://eu.idtdna.com/site)</td>
		</tr>
		<tr>
			<td>Power SYBRGreen PCR Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4368702</td>
			<td></td>
		</tr>
		<tr>
			<td>FACS Tubes&#160;</td>
			<td>Sarstedt</td>
			<td>551578</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 96-Well Reaction Plate</td>
			<td>Thermo Fisher Scientific</td>
			<td>N8010560</td>
			<td></td>
		</tr>
		<tr>
			<td>Corning 100mm TC-Treated Culture Dish</td>
			<td>Corning</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Corning Costar cell culture plates 6 well</td>
			<td>Corning</td>
			<td>3506</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 R</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerated Bench-Top Centrifuge Jouan CR3.12</td>
			<td>Jouan</td>
			<td>743205604</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop Lite Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>ND-LITE-PR</td>
			<td></td>
		</tr>
		<tr>
			<td>BD FACSCalibur Flow Cytometer</td>
			<td>BD Bioscience</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>QuantStudio 3 Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>A28567</td>
			<td></td>
		</tr>
	</tbody>
</table>

studying cell cycle-regulated gene expression by two complementary cell synchronization protocols

Hücre döngüsünün gen ekspresyon programı, hücre döngüsüne bağımlı süreçleri ve kanser gibi hastalıklarda rollerini anlamak için kritik bir aşamayı temsil eder. Hücre döngüsü düzenleyen gen ekspresyon analizi, belirli fazlara hücre senkronizasyonuna bağlıdır. Burada, hücre döngüsü boyunca gen ifadesinin periyodik değişimini incelemek için yaygın olarak kullanılan iki tamamlayıcı senkronizasyon protokolünü kullanan bir yöntemi açıklıyoruz. Her iki prosedür, tanımlanmış bir noktada hücre döngüsünün geçici olarak bloke edilmesine dayanır. Hidroksiüre (HU) muamelesiyle senkronizasyon protokolü geç G1 / erken S evresinde hücrenin durması ve HU aracılıklı tutuklamadan salınma, S ve G2 / M boyunca düzgün bir şekilde ilerleyen hücresel bir nüfusu sağlar. Timidin ve nokodazol (Thy-Noc) tedavisinin erken mitozda hücreleri bloke ettiği ve Thy-Noc aracılı arrestten salındığı senkronizasyon protokolü, G1 fazı ve S fazı için uygun senkronize edilmiş bir hücre popülasyonu sağlarÇalıştırmayı deneyin. Her iki prosedürün uygulanması, tipik olarak, hücrelerin propidyum iyodür (PI) boyaması ve akış sitometrisinin aracılık ettiği DNA içeriğinin analizinden sonra gerçekleştirilen hücre döngüsü dağıtım profillerinin izlenmesini gerektirir. İki senkronizasyon protokolünün kombine kullanımının, hücre döngüsünde ( örn. E2F1 ve E2F7) farklı şekilde regüle edilen genlerin transkripsiyonel profillerini açıkça belirlemek ve sonuç olarak hücre döngüsündeki rollerini daha iyi anlamak için sağlam bir yaklaşım olduğunu gösteriyoruz süreçler. Ayrıca, bu yaklaşımın, ilaç kökenli terapileri ( yani , bir anti-kanser ajanı olan mitomisin C) altında yatan mekanizmaların incelenmesi için yararlı olduğunu göstermekteyiz, çünkü genotoksik ajana yanıt veren genleri hücre döngüsünün bozulmalarından etkilenen genlerden ayırt etmeye imkan tanır Aracı tarafından dayatılan.

Hücre senkronizasyonu için Thy-Noc ve HU tabanlı protokollerin şematik gösterimi. Şekil 1 , hücre döngüsü boyunca ilerlemeyi doğrulamak ve gen ekspresyon analizleri gerçekleştirmek için U2OS hücre senkronizasyonu ve takip eden örnek toplanması için gerekli olan aşamaları özetlemektedir. Phospho-H3 ve PI boyama, senkronizasyon yönteml...

Watch this Scientific Journal Video about Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols at JoVE.com

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

Hücre döngüsünün belirli evreleriyle ilgili olayları incelemek için bir bağlam sağlayan iki hücre senkronizasyon protokolünü bildiriyoruz. Bu yaklaşımın, pertürbüssüz bir hücre döngüsünde spesifik genlerin düzenlenişini analiz etmek için veya hücre döngüsünü etkileyen maddelere maruz kaldığında yararlı olduğunu göstermektedir.

Hücre Çevrimiyle Düzenlenen Gen İfadesini İki Tamamlayıcı Hücre Senkronizasyon Protokolü İle Çalışmak

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

Research

Education

JoVE Journal

JoVE Core

Biology

Genetics

Cellular Processes

Cell Cycle and Division

SCIENTISTS IN ACTION

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

İnsan Primer Hücre Kültürleri içinde Sirkadyen Saat Gen İfade ve Hormon salgısını Paralel Ölçümü

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Single-cell Gene Expression Using Multiplex RT-qPCR to Characterize Heterogeneity of Rare Lymphoid Populations

Multiplex RT-qPCR kullanarak tek hücreli Gen İfadesi Nadir Lenfoid Populasyonlarının Farklılıkları karakterize etmek

Gene expression heterogeneity is an interesting feature to investigate in lymphoid populations. Gene expression in these cells varies during cell ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Yetiştirme ve Gizle böcek RNA aracılı gen demonte çift sarmallı,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Single-cell Gene Expression Profiling Using FACS and qPCR with Internal Standards

İç Standartları FACS ve qPCR kullanma Tek hücreli Gen İfadesi Profil

Gene expression measurements from bulk populations of cells can obscure the considerable transcriptomic variation of individual cells within those ...

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

Memeli Hücrelerinde CRISPR / Cas9 aracılı Gen Knockout&#39;larının Seçime Bağlı ve Bağımsız Üretimi

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Retroviral Tarama: Hücreye Özel Düzenleyici Bölgeleri Tanımlamak İçin MLV Entegrasyon Konumlarının Haritalandırılması

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

Quantification of Information Encoded by Gene Expression Levels During Lifespan Modulation Under Broad-range Dietary Restriction in C. elegans

C. elegans gen ifade seviyeleri sırasında ömrü modülasyon altında geniş menzilli diyet kısıtlama tarafından kodlanmış bilginin bir miktar

Sensory systems allow animals to detect, process, and respond to their environment. Food abundance is an environmental cue that has profound effects on ...

An Optogenetic Method to Control and Analyze Gene Expression Patterns in Cell-to-cell Interactions

Bir Optogenetic kontrol etmek ve hücre-hücre etkileşimleri gen ifade desenleri analiz yöntemi

Cells should respond properly to temporally changing environments, which are influenced by various factors from surrounding cells. The Notch signaling ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Fare ve insan hematopoetik progenitör hücre tarafından CRISPR/Cas9 yüksek verimli Gene bozulma

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

Kök Microbiome keşfetmek: toprak, rizosferde ve kök Endosphere bakteriyel topluluk verileri ayıklama

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...