Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Dit project werd gedeeltelijk gefinancierd met de federale middelen van het National Institute of Allergy and Infectious Diseases, het National Institutes of Health, Department of Health and Human Services, onder CEIRS contract HHSN272201400008C (F.K.); NIH U19AI109946-01 (F.K.); en P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

De auteurs verklaren geen belangenconflicten.

Hoewel de meerderheid van residuen geïdentificeerd met behulp van escape-mutanten nauwkeurig zijn, is een van het grote voorbehoud van deze aanpak dat puntmutaties van escape varianten, niet noodzakelijkerwijs binnen de moleculaire voetafdruk van het antilichaam toegewezen mogelijk zoals bepaald door structurele analyses. Dit is te wijten aan het vermogen van een mutatie op een bepaalde residu kan leiden tot een conformationele verandering distale naar de locatie van het gemuteerde residu, analoog aan een allosteric effect. Een andere beperking is dat deze methode kan alleen worden uitgevoerd voor het neutraliseren van antilichamen; antilichamen die in vitro selectieve druk ontbreken zal niet leiden tot het ontsnappen van mutanten. Echter kan deze beperking worden overwonnen met behulp van een panel van escape varianten gegenereerd door eerder gekarakteriseerd neutraliserende antilichamen. Tan et al. gebruikt een variant van de ontsnapping van een neutraliserende mAb aan het virus H7N9 voor het toewijzen van de epitoop van een niet-neutraliserende antilichamen7.
Echter biedt het ophelderen van de epitopes van antistoffen via de generatie van escape varianten een levensvatbaar alternatief voor kristallografie en cryo-Elektron microscopie, die beide een uitgebreide investeringen van apparatuur nodig. Andere alternatieven zijn om te bepalen van de minimale bindende regio van mAbs met behulp van alanine scannen of peptide scannen/truncatie mutanten. Alanine mutagenese scannen kan een aanzienlijke hoeveelheid werk bij het genereren van een groot aantal varianten tijdens screening van29, terwijl peptide scannen beperkt tot lineaire epitopes30 isvereisen. De in dit protocol beschreven methode vereist geen speciale apparatuur of techniek en in feite, maakt gebruik van bestaande in vitro neutralisatie tests bewerkt voor het genereren van escape varianten van de antilichamen van belang.
Het protocol voor genereren ontsnappen varianten die meerdere passages (b.v., stengel-specifieke antilichamen vereisen) is sterk afhankelijk van de beginconcentratie van antilichaam in passage 0. Het is beter om de onzekere en starten op een helft van een lager is dan de helft van de maximale remmende concentratie van een antilichaam logboek logboek en robuuste virus groei mogelijk. De onderzoeker kan speculeren dat een hoge titer virus cultuur in aanwezigheid van immunologische lagedruk een grote genetische variatie in de virale bevolking zullen hebben. Escape varianten kunnen worden geselecteerd voor door het geleidelijk aan verhogen van de antilichaam-concentratie in de volgende passages. In het geval dat de virus groei afneemt, kan de hoeveelheid virale supernatant kan worden verhoogd in de volgende passage met behoud van dezelfde hoeveelheid antilichaam concentratie in de vorige passage.
Een meerderheid van universele griepvaccins beoogt te verduidelijken met een robuuste antistofrespons op weg naar de regio van de stengel van de HA. De analyses van escape varianten aan stengel-specifieke antilichamen zijn belangrijk bij het bepalen van de relatie tussen influenza virus fitness en immunologische druk. Interessant, waren escape mutant virussen die voortvloeien uit de stengel-specifieke mAbs allemaal verzwakt in vivo in lymfkliertest LD50 studies4. Deze studies geven een sterke zaak voor vaccinatie stengel gebaseerde platforms. Bovendien, kan dit protocol worden gebruikt om te identificeren escape-mutanten aan andere anti-virale verbindingen, zoals klein molecuul remmers. Tenslotte, deze methode is niet beperkt tot influenza virus oppervlakte glycoproteïnen, maar ook grotere schaal kan worden toegepast om te bepalen van de epitopes van andere virale glycoproteïnen.

Gelijkaardig aan andere RNA-virussen, influenza A virussen bezitten een feilbare polymerase die het mogelijk voor het genereren van een veelheid van antigene varianten met elke ronde voor replicatie1,2,3 maakt. De griep een virus heeft een verbazingwekkend vermogen aan te passen en te onttrekken aan de menselijke immune reactie via antigene drift, die wordt bereikt door een accumulatie van mutaties op de oppervlakte glycoproteïnen die tot het verlies van antilichaam binding leidt. Antigene drift van de virale oppervlakte glycoproteïnen, HA en neuraminidase (NA), vereist de noodzaak te herformuleren en beheren van het vaccin jaarlijks.
Technologische vooruitgang in de isolatie en de generatie van antigeen-specifieke antilichamen hebben een groot aantal vaccin-geïnduceerde mAbs4,5,6,7,8opgeleverd. Op zijn beurt heeft de karakterisatie van de epitopes voor mAbs die in grote lijnen het neutraliseren van influenza A virussen sterk geholpen met de ontwikkeling van verschillende universele influenza vaccin kandidaten9,10,11, 12,13,14. Het ophelderen van de antigene voetafdruk van een mAb onthult de structurele determinanten neutralisatie en zorgt voor een weloverwogen aanpak van vaccin ontwerp. Echter, het is niet realistisch noch rendabel voor laboratoria te karakteriseren structureel uitgebreide panelen van mAbs door middel van röntgendiffractie of cryo-elektronenmicroscopie om kaart epitopes op de virale antigeen15, 16 , 17 , 18.
Röntgendiffractie of cryo-elektronenmicroscopie vereist dure apparatuur, gespecialiseerde technieken en potentieel een uitgebreide hoeveelheid tijd om gegevens te genereren. Een alternatieve en snellere aanpak is gebruik te maken van de snelle generatie van uiteenlopende virale bevolking via de foutgevoelige RNA-afhankelijke RNA-polymerase genereren escape-mutanten om te bepalen van de epitopes van mAbs19,20, 21,22,23. De generatie van escape varianten vereist geen speciale apparatuur of techniek en kan worden uitgevoerd met de conventionele laboratoriumreagentia en apparatuur.
Hier beschrijven we een methode die het mogelijk maakt voor de toewijzing van kritische residuen vereist voor mAb bindende die de influenza HA herkent.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Influenzavirussen vertonen een opmerkelijk vermogen tot aanpassing en de immuunrespons van de gastheer te omzeilen. Unidirectioneel is door antigene veranderingen die zich op de oppervlakte glycoproteïnen van het virus voordoen. De generatie van escape varianten is een krachtige methode in ophelderen hoe virussen ontsnappen immuun detectie en identificatie van kritieke residuen vereist voor antilichaam binding. Hier beschrijven we een protocol over het influenza-A virus ontsnappen varianten maken door gebruik te maken van menselijke of lymfkliertest monoclonal antilichamen (mAbs) gericht tegen de virale hemagglutinine (HA). Met het gebruik van onze techniek, we eerder gekenmerkt kritische residuen nodig zijn voor het binden van antistoffen gericht op het hoofd of de stengel van de roman aviaire H7N9 HA. Het protocol kan worden gemakkelijk aangepast voor andere virus-systemen. Analyses van escape varianten zijn belangrijk voor het modelleren van de antigene drift, bepalen van één nucleotidepolymorfisme (SNPs) verlenen weerstand en virus fitness, en bij het ontwerpen van vaccins en/of therapeutics.

Wij hebben vroeger variaties van deze methode voor het genereren van escape varianten aan menselijke en lymfkliertest mAbs geïnduceerd door de seizoensgebonden influenza virus vaccin, H7N9 vaccinatie of sequentiële DNA/recombinant HA eiwit vaccinatie4,5 ,6,7. Zoals hierboven beschreven, werden antilichamen eerst gekenmerkt met behulp van de HI en microneutralization testen om te vernemen welke specifieke protocol om door te gaan met de volgende4,5. Antilichamen 07-5D 03, 07-5F01, 07-5G 01, 07-4B03, 07-4E02 en 07-4D 05 bleken te hebben van HI en neutralisering activiteiten tegen het aviaire H7N9 virus (A/Shanghai/1/2013) (tabel 1), en dus de oorsprongsregels in protocol 1 (stap 2.1) werd gebruikt. Protocol 2 (stap 2.2) is voor mAbs met het neutraliseren van dat gebrek aan HI activiteit, zoals 41-5E04, 045-051310-2B06, 042-100809-2F04 en S6-B01 (tabel 1), gebruikt voor het genereren van escape varianten. Mutant toewijzing van de ontsnapping onthuld dat veel van de antistoffen kritische residuen op verschillende locaties op de virale HA4,5 (Figuur 4 herkennen). Terwijl de meerderheid van de HI-positieve antistoffen hebben mutant residuen in de buurt van reeds gerapporteerde antigene sites van de H7 HA ontsnappen, de HI-negatieve antilichamen escape-mutanten met puntmutaties gegenereerd in de stengel regio4,5 .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antilichaam</td>
			<td>Hallo activiteit</td>
			<td>NEUT activiteit</td>
		</tr>
		<tr>
			<td>07-5D 03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G 01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D 05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Tabel 1: Tabel van antilichaam HI en neutralisering activiteit. Tien H7-specifieke mAbs geïsoleerd uit personen die zijn ingeënt met een experimenteel vaccin H7N9 vertonen verschillende in vitro antivirale activiteiten5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">Voorwaartse Primer (5' naar 3')</td>
			<td colspan="4">Omgekeerde Primer (5' naar 3')</td>
			<td colspan="2">Thermocylcer voorwaarden</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">42 ° c gedurende 60 minuten, 94 ºC voor 2 min/5 cycli van 94 ºC voor 20 s, 50 ºC voor 30 s en 68 ° c voor 3 min 30 s, gevolgd door 40 cycli van 94 ºC voor 20 s, 58 ºC voor 30 s , en 68 ° c voor 3 min 30 s met een tijd van de laatste uitbreiding bij 68 ° c gedurende 10 minuten</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">45 ºC voor 60 min, 55 ºC voor 30 min, 94 ºC voor 2 min/5 cycli van 94 ºC voor 20 s, 40 ºC voor 30 s en 68 ° c voor 3 min 30 s, gevolgd door 40 cycli van 94 ºC voor 20 s , 58 ºC voor 30 s, en 68 ° c voor 3 min 30 s met een tijd van de laatste uitbreiding bij 68 ° c gedurende 10 minuten</td>
		</tr>
	</tbody>
</table>
Tabel 2: universele influenza virus inleidingen. Primerparen voor de versterking van de HA-segmenten van influenza-A27 B28 virussen en hun respectieve thermocycler voorwaarden.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
Figuur 1: HI assay. (A) A schema voor het opzetten van een HI-assay voor het testen van de activiteit van twee muis H1-specifieke mAbs 7B2 (hoofd-specifiek) en 6F12 (Steel-specifiek) met behulp van een 96-Wells-V-bodemplaat, en (B) een voorbeeld van de resultaten van een HI assay23. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
Figuur 2: Microneutralization assay. Een schema voor het opzetten van een microneutralization-assay voor het testen van de activiteit van twee menselijke mAbs 4 d 055 en CR911417. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
Figuur 3: generatie van escape-mutanten. De methodologie voorgesteld zal worden afhankelijk van de HI en de activiteit van de microneutralization tentoongesteld door het antilichaam. De generatie van escape-mutanten tegen (A) wellicht neutraliserende antilichamen van de HI-positieve één passage in de sector eieren, terwijl (B) neutraliserende antilichamen van HI-negatieve mogelijk meerdere passages met steeds grotere hoeveelheden van antilichaam in de cultuur van de weefsel van de cel. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
Figuur 4: een voorbeeld van een epitoop toewijzing van de roman aviaire H7N9 HA gegenereerd met escape mutant varianten. Vaccin-geïnduceerde antistoffen geïsoleerd van individuen ingeënt met een kandidaat H7N9 influenza een vaccin werden gebruikt voor het genereren van escape mutant varianten. Elke residu aangegeven in rood geeft de locatie van essentiële aminozuren nodig voor efficiënte binding van een mAb. Gegevens waren aangepast van Dunand-Henry et al., 20154. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Klik hier voor een grotere versie van dit cijfer.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Beschrijven we een methode waarmee we identificeren kritische residuen nodig zijn voor de binding van de mens of lymfkliertest monoclonal antilichamen die gericht zijn op de virale hemagglutinine van influenza A-virussen. Het protocol kan worden aangepast aan andere oppervlakte glycoproteïnen van virus en hun overeenkomstige neutraliserende antilichamen.

Generatie van Escape varianten van het Influenza Virus monoklonale antistoffen neutraliseren

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

Generatie van recombinant griepvirus uit plasmide-DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

Isolatie van Fidelity Varianten van RNA-virussen en Karakterisering van mutatie van de virussen Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

High-throughput Detection Methode voor Influenza Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Influenza Virus Voortplanting in bevruchte kippeneieren

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Generering van recombinant humaan IgG Monoclonal Antibodies uit Onsterfelijk gesorteerde B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Genereren van monoklonale muizenantilichamen door Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

Influenza-A Virus Studies in een muismodel van infectie

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Meten van Influenza neutraliserende antilichamen reacties op A(H3N2) virussen in menselijke Sera door Microneutralization testen met behulp van MDCK-SIAT1 cellen

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Generatie van discriminatoire menselijke monoklonale antistoffen uit zeldzame antigeen-specifieke B-cellen in bloed circuleert

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

Generatie van monoklonale antistoffen tegen natuurlijke producten

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...