Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Dieses Projekt wurde teilweise mit Bundesmitteln aus dem National Institute of Allergy and Infectious Diseases finanziert, National Institutes of Health, Department of Health And Human Services, unter CEIRS Vertrag HHSN272201400008C (F.K.); NIH-U19AI109946-01 (F.K.); und P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

Die Autoren erklären keine Interessenkonflikte.

Obwohl die Mehrheit der Rückstände über Escape-Mutanten identifiziert präzise gewesen, ist eines der großen Vorbehalte dieses Ansatzes, dass Punktmutationen Flucht Varianten innerhalb der molekularen Ausleuchtzone des Antikörpers bestimmt nicht unbedingt zuordnen kann Strukturanalysen. Dies ist aufgrund der Fähigkeit einer Mutation an einen gewissen Rückstand zu einer Konformationsänderung distal an die Stelle des mutierten Rückstands, analog zu einer allosterischen Effekt führen. Eine weitere Einschränkung ist, dass diese Methode nur für neutralisierenden Antikörpern umgesetzt werden kann; Antikörper, die in-vitro- selektiven Druck fehlt führt nicht um durch Mutation entstehende Variationen zu entkommen. Diese Einschränkung kann jedoch mit dem Einsatz von einem Gremium von Flucht-Varianten von bisher charakterisierten neutralisierende Antikörper erzeugt überwunden werden. Tan Et Al. verwendet eine Flucht-Variante eine neutralisierende MAB mit dem H7N9-Virus, das Epitop eines nicht neutralisierende Antikörper7zuzuordnen.
Dennoch bietet die Aufklärung die Epitope von Antikörpern durch die Generierung von Flucht Varianten eine echte Alternative zur Kristallographie und Cryo-Elektron Mikroskopie, beide mit eine umfangreichen Investition von Ausrüstung erfordern. Andere Alternativen sind die minimale Bindung Region mAbs mit Alanin scannen oder Peptid Scannen/Trunkierung Mutanten zu bestimmen. Alanin Scannen Mutagenese erfordern eine erhebliche Menge an Arbeit bei der Erzeugung einer Vielzahl von Varianten bei29, screening, während Peptid Scannen auf lineare Epitope30begrenzt ist. In diesem Protokoll beschriebene Methode erfordert keine spezielle Ausrüstung oder Technik und in der Tat nutzt bestehende in-vitro- Neutralisation Assays geändert, um Flucht Varianten der Antikörper von Interesse zu erzeugen.
Das Protokoll zur Generierung von Flucht-Varianten, die mehrere Passagen (z.B., Stiel-spezifische Antikörper) erfordern ist stark abhängig von der Ausgangspunkt Konzentration des Antikörpers in Abschnitt 0. Es ist besser, irren auf der Seite der Vorsicht und beginnen bei einem Protokoll um die Hälfte niedriger als die halbe maximale hemmende Konzentration eines Antikörpers ein Protokoll und robuste Virus Wachstum ermöglichen. Der Forscher spekulieren, dass eine hoher Titer Virus Kultur im Beisein von immunologischen Niederdruck eine große genetische Variation in der viralen Population haben wird. Flucht-Varianten können durch die schrittweise Erhöhung der Antikörperkonzentration in den folgenden Passagen für ausgewählt werden. Den Fall, dass das Virus Wachstum sinkt, kann die virale Überstand in den nächsten Durchgang erhöht werden und gleichzeitig die gleiche Menge an Antikörperkonzentration im vorherigen Durchgang.
Ein Großteil der universal Influenza-Impfstoffe soll eine robuste Antikörperantwort gegenüber der Stiel-Region des HA zu entlocken. Die Analysen der Flucht Varianten an Stiel-spezifische Antikörper sind wichtig bei der Definition der Beziehung zwischen Influenza Virus Fitness und immunologische Druck. Interessanterweise waren Flucht mutierte Viren aus Stiel-spezifische mAbs alle abgeschwächte in Vivo in murinen LD50 Studien4. Diese Studien liefern ein starkes Argument für die Impfung Stiel-basierte Plattformen. Darüber hinaus könnte dieses Protokoll verwendet werden, um Escape-Mutanten auf andere antiviralen Verbindungen, wie z. B. niedermolekularer Hemmer zu identifizieren. Zu guter Letzt diese Methode beschränkt sich nicht auf Influenza Virus Oberfläche Glykoproteine, aber auch häufiger angewandt werden um die Epitope von anderen viralen Glykoproteinen zu bestimmen.

Ähnlich wie bei anderen RNA-Viren, Influenza A Viren besitzen eine fehleranfällige Polymerase, die für die Erzeugung einer Vielzahl von Antigenen Varianten mit jeder Runde von Replikation1,2,3ermöglicht. Die Influenza Virus hat eine erstaunliche Fähigkeit, sich anzupassen und der menschlichen Immunantwort über Antigendrift, die durch eine Anhäufung von Mutationen auf die Oberfläche Glykoproteine erreicht wird, die zum Verlust der Antikörperbindung führt zu entziehen. Antigendrift der viralen Oberfläche Glykoproteine HA und Neuraminidase (NA), erfordert die Notwendigkeit, neu zu formulieren und den Impfstoff jährlich zu verwalten.
Technologische Fortschritte in die Isolation und die Generation der Antigen-spezifische Antikörper haben eine hohe Anzahl von Impfstoff-induzierte mAbs4,5,6,7,8geführt. Im Gegenzug hat die Charakterisierung von Epitopen von mAbs, die im großen und ganzen Influenza A Viren neutralisieren die Entwicklung von mehreren universal Influenza-Impfstoff Kandidaten9,10,11unterstützt, 12,13,14. Aufklärung des Antigenen Fußabdrucks einer MAB zeigt die strukturellen Determinanten der Neutralisation und ermöglicht eine fundierte Ansatz in Richtung Impfstoff-Design. Es ist jedoch weder realistisch noch kostengünstiger für Labors umfangreiche Panels von mAbs durch Röntgen-Kristallographie oder Kryo-Elektronenmikroskopie strukturell zu charakterisieren, um Epitope auf virale Antigen15, Karte 16 , 17 , 18.
Röntgen-Kristallographie oder Kryo-Elektronenmikroskopie erfordert teure Ausrüstung, spezielle Techniken und möglicherweise eine beträchtliche Menge an Zeit, um Daten zu generieren. Ein alternativer und schneller Ansatz nutzt die schnelle Generierung von verschiedenen viralen Bevölkerungsgruppen über die fehleranfällige RNA-abhängige RNA-Polymerase, Escape-Mutanten um festzustellen, die Epitope von mAbs19,20, generieren 21,22,23. Die Generation der Flucht Varianten erfordert spezielle Ausrüstung oder Technik und kann mit herkömmlichen Laborreagenzien und Ausrüstung durchgeführt werden.
Hier beschreiben wir eine Methode, die für die Zuordnung von kritischen Rückstände erforderlich für mAb Bindung ermöglicht, die die Influenza HA erkennen.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Influenza-Viren zeigen eine bemerkenswerte Fähigkeit, sich anzupassen und die Host-Immunantwort zu entgehen. Eine Möglichkeit ist durch Antigene auf der Oberfläche Glykoproteine des Virus auftretende Änderungen. Die Generation der Flucht Varianten ist eine leistungsfähige Methode in Aufklärung wie Viren immun entdeckt zu werden und bei der Ermittlung kritischer Rückstände für die Antikörperbindung erforderlich. Hier beschreiben wir ein Protokoll wie Influenza A Virus Flucht Varianten erzeugen durch die Verwendung von menschlichen oder murinen monoklonalen Antikörper (mAbs) gegen virale Hämagglutinin (HA). Mit dem Einsatz unserer Technik gekennzeichnet wir zuvor kritische Rückstände für die Bindung von Antikörpern, die Ausrichtung der Kopf oder der Stiel des neuartigen Vogelgrippe H7N9 HA erforderlich. Das Protokoll kann leicht für andere Virus-Systeme angepasst werden. Analysen der Flucht Varianten sind wichtig für die Modellierung von Antigendrift, Bestimmung von single-Nukleotid-Polymorphismen (SNPs) verleiht Resistenz und Virus-Fitness, und bei der Gestaltung von Impfstoffen und Therapeutika.

Wir haben zuvor Variationen dieser Methode benutzt, um Flucht Varianten zu menschlichen und murinen mAbs induziert durch die saisonale Influenza-Virus-Impfstoff, H7N9 Impfung oder sequenzielle DNA/rekombinante HA Protein Impfung4,5 generieren ,6,7. Wie oben beschrieben, wurden Antikörper zuerst mit der HI und Microneutralization Assays um mitteilen, welche spezifischen Protokolls weiterhin mit nächsten4,5charakterisiert. Antikörpern 07-5D 03, 07-5F01, 07-5G 01, 07-4B03, 07-4E02 und 07-4D 05, HI und Neutralisierung Aktivitäten gegen die Vogelgrippe H7N9-Virus (A/Shanghai/1/2013) (Tabelle 1) gefunden wurden, und so Protokoll 1 (Schritt 2.1) genutzt wurde. Für mAbs mit neutralisieren, dass HI-Aktivität, z. B. 41-5E04, 045-051310-2B06, 042 100809 2F04 und S6-B01 (Tabelle 1) der Mangel, wurde Protokoll Nr. 2 (Schritt 2.2) zur Flucht Varianten erzeugen. Flucht mutierten Zuordnung ergab, dass viele der Antikörper kritischer Rückstände an unterschiedlichen Standorten auf die virale HA4,5 (Abbildung 4 erkennen). Während die Mehrheit der HI-Positive Antikörper haben mutierten Rückstände in der Nähe von bereits gemeldeten Antigenen Stätten der H7 HA flüchten, generiert die HI-Negative Antikörper Escape-Mutanten mit Punktmutationen im Stiel Region4,5 .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antikörper</td>
			<td>Hallo Aktivität</td>
			<td>NEUT Aktivität</td>
		</tr>
		<tr>
			<td>07-5D 03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G 01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D 05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Tabelle 1: Tabelle HI und Neutralisierung Antikörperaktivität. 10 H7-spezifische mAbs isoliert von Individuen mit einer experimentellen H7N9-Impfstoff Geimpften weisen verschiedene in-Vitro antivirale Aktivitäten5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">Forward Primer (5' 3')</td>
			<td colspan="4">Reverse Primer (5' 3')</td>
			<td colspan="2">Thermocylcer Bedingungen</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">42 ° c für 60 min, 94 ° c für 2 min/5 Zyklen von 94 ° c für 20 s, 50 º c für 30 s und 68 ° c für 3 min 30 s, gefolgt von 40 Zyklen von 94 ° c für 20 s, 58 ° c für 30 s , und 68 ° c für 3 min 30 s mit einer letzten Erweiterung Zeit bei 68 ° c für 10 min.</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">45 º c für 60 min, 55 º c für 30 min, 94 ° c für 2 min/5 Zyklen von 94 ° c für 20 s, 40 º c für 30 s und 68 ° c für 3 min 30 s, gefolgt von 40 Zyklen von 94 ° c für 20 s , 58 º c für 30 s und 68 ° c für 3 min 30 s mit einer letzten Erweiterung Zeit bei 68 ° c für 10 min.</td>
		</tr>
	</tbody>
</table>
Tabelle 2: Universal Influenza Virus Zündkapseln. Grundierung-Paare für die Verstärkung der HA-Segmente von Influenza-A-27 und B28 Viren und ihre jeweiligen Thermocycler-Bedingungen.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
Abbildung 1: HI-Assay. (A) A Schaltplan für die Einrichtung eines HI-Assays, die Aktivität der beiden Maus H1-spezifische mAbs 7B2 (Kopf-spezifisch) und 6F12 (Stiel-spezifisch) mit einer 96-Well-V-Boden-Platte, und (B) ein Beispiel für die Ergebnisse von einer HI-Assay-23zu testen. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
Abbildung 2: Microneutralization Assay. Ein Schaltplan für die Einrichtung eines Microneutralization-Assays, die Aktivität von zwei menschlichen mAbs 4 055 und CR911417zu testen. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
Abbildung 3: Generation von Escape-Mutanten. Die Methodik vorgeschlagen werden abhängig von der HI und die Microneutralization-Aktivität durch die Antikörper ausgestellt. Die Generation der Escape-Mutanten gegen(a-)erfordern neutralisierende HI-Positive Antikörper einen Durchgang in den Eiern, während neutralisierende HI-Negative Antikörper (B) mehrere Passagen mit steigenden Mengen Antikörper in beinhalten kann Zelle-Gewebe-Kultur. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
Abbildung 4: Beispiel für ein Epitop-Map des neuartigen Vogelgrippe H7N9 HA mit Flucht mutierten Varianten generiert. Impfstoff-induzierte Antikörper isoliert von Individuen mit einem Kandidaten geimpft H7N9 Grippe ein Impfstoff wurden zur Flucht mutierten Varianten erzeugen. Jede Rückstände in Rot repräsentiert die Position des kritischen Aminosäuren benötigt für effiziente Bindung einer MAB angegeben. Daten wurden von Dunand-Henry Et Al., 20154angepasst. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Bitte klicken Sie hier für eine größere Version dieser Figur.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Wir beschreiben eine Methode mit der identifizieren wir kritische Rückstände für die Bindung von menschlichen oder murinen monoklonalen Antikörpern, die die virale Hämagglutinin der Influenza A-Viren Zielen erforderlich. Das Protokoll kann zu anderen Virus Oberfläche Glykoproteine und ihre entsprechenden neutralisierende Antikörper angepasst werden.

Generation von Escape Varianten des Influenza-Virus Monoclonal Antikörper neutralisieren

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

Erzeugung von rekombinanten Influenza Virus von Plasmid-DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Forschung

Immunologie und Infektion

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

Isolierung von Fidelity Varianten von RNA-Viren und Charakterisierung von Virus-Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

High-Throughput Nachweisverfahren für Influenza-Virus

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Influenza Virus Vermehrung in embryonierten Hühnereiern

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Erzeugung von rekombinanten humanen IgG monoklonalen Antikörpern aus Immortalisierte Sortiert B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Generation of Murine Monoclonal Antibodies by Hybridomtechnologie

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

Influenza-A-Virus-Studien in einem Mausmodell der Infektion

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Messung der Influenza neutralisierenden Antikörperantworten gegen a/H3N2-Viren im menschlichen Serum von Microneutralization Assays mit MDCK-SIAT1 Zellen

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Generation von diskriminierendem menschlichen monoklonalen Antikörpern aus seltenen Antigen-spezifische B-Zellen im Blut zirkulierenden

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

Generierung von monoklonalen Antikörpern gegen Naturprodukte

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...