Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

פרויקט זה יש כבר מומן בחלקו עם כספים פדרליים מן המכון הלאומי לאלרגיה ומחלות זיהומיות, מכוני הבריאות הלאומיים, מחלקת הבריאות ושירותי האנוש של, תחת CEIRS חוזה HHSN272201400008C (f. K); NIH U19AI109946-01 (F. K); P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

המחברים מצהירים שאין ניגודי אינטרסים.

אמנם הרוב המכריע של שאריות מזוהה באמצעות מוטציות לברוח היה מדויק, אחד ההליכים העיקריים של גישה זו הוא כי מוטציות נקודה של בריחה משתנים עלול שלא בהכרח ממופה בתוך טביעת רגלו מולקולרית של הנוגדן כפי שנקבע על ידי ניתוחים מבנית. זאת בשל היכולת של מוטציה במשקע מסוימים להוביל לשינוי הסתגלותי דיסטלי למיקום של השאריות שעברו מוטציה, מקביל אפקט allosteric. מגבלה נוספת היא כי מתודולוגיה זו בלבד ניתן ליישם על נטרול נוגדנים; נוגדנים חסרי במבחנה הלחץ הסלקטיבי לא תוביל לברוח מוטציות. עם זאת, מגבלה זו ניתן להתגבר עם השימוש של פאנל של גרסאות לברוח שנוצר על ידי נוגדנים נטרול מאופיין בעבר. השיזוף. et al. בשימוש של וריאנט הבריחה של mAb נטרול הוירוס H7N9 למפות את epitope של נוגדן-נטרול7.
למרות זאת, שחקרתי את epitopes של נוגדנים דרך הדור של בריחה משתנים מספק אלטרנטיבה מעשית קריסטלוגרפיה, הקפאה-אלקטרון מיקרוסקופ, אשר שניהם דורשים השקעה נרחבת של ציוד. חלופות אחרות הן לקבוע האזור איגוד מינימלי של mAbs באמצעות מוטציות סריקה/חיתוך סריקה או פפטיד אלנין. אלנין סריקה מוטגנזה מכוונת עשויים לדרוש כמות משמעותית של עבודה על מנת לייצר מספר גדול של משתנים במהלך ההקרנה29, בעוד פפטיד סריקה מוגבלת ליניארי epitopes30. השיטה המתוארת ב פרוטוקול זה דורש ציוד מיוחד או טכניקה, למעשה, עושה שימוש הקיים במבחנה ניטרול מבחני שונה כדי ליצור גרסאות הבריחה של נוגדנים עניין.
הפרוטוקול עבור גרסאות לברוח ביצירת הדורשים מעברים מרובים (למשל, נוגדנים ספציפיים גבעול) תלויה מאוד הריכוז ההתחלתי של נוגדן בקטע 0. עדיף במשנה זהירות, מתחילים ב יומן חצי ליומן רישום נמוך יותר מאשר חצי מקסימלי מעכבות ריכוז נוגדן ולאפשר לצמיחה וירוס חזקים. החוקר יכול לשער כי תרבות וירוס כייל נוגדנים גבוה בנוכחות לחץ חיסונית נמוך יהיה וריאציה גנטית גדולה באוכלוסייה ויראלי. הבריחה גרסאות שניתן לבחור עבור הגדלת בהדרגה את ריכוז נוגדן בקטע הבא. במקרה בו הגידול וירוס יורדת, כמות תגובת שיקוע נגיפי ניתן להגדיל ב המעבר הבא תוך שמירה על כמות זהה של ריכוז נוגדן במעבר הקודם.
המטרה של רוב של חיסונים שפעת אוניברסלי היא מביאות לתגובה נוגדנים חזקים לכיוון האזור גבעול הוואי. הניתוחים של בריחה משתנים כדי נוגדנים ספציפיים גבעול חשובים הגדרת קשרי הגומלין בין כושר וירוס שפעת ובלחץ אימונולוגי. מעניין, וירוסים מוטציה להימלט הנובע mAbs גבעול ספציפי היו כל הקלוש ויוו מאתר LD50 מחקרים4. מחקרים אלה מספקים תיק חזק לפלטפורמות החיסונים מבוסס על גבעול. בנוסף, פרוטוקול זה יכול לשמש כדי לזהות מוטציות לברוח כדי תרכובות אנטי-ויראליות אחרות, כגון מעכבי מולקולה קטנה. לבסוף, מתודולוגיה זו אינה מוגבלת glycoproteins משטח של וירוס שפעת, אך גם ניתן באופן נרחב יותר להחיל כדי לקבוע את epitopes של אחרים glycoproteins ויראלי.

בדומה וירוסים אחרים, ה-RNA, שפעת A וירוסים בעלי של פולימראז לשגיאות המאפשר לדור של מספר רב של גרסאות antigenic עם כל סיבוב של שכפול-1,-2,-3. ה שפעת וירוס יש יכולת מדהימה להסתגל, להתחמק התגובה החיסונית האנושית באמצעות סחיפה antigenic, אשר מושגת באמצעות הצטברות של מוטציות על glycoproteins פני השטח שמוביל האובדן של הנוגדן מחייב. הסחף antigenic של נגיפי glycoproteins פני השטח, הא ו neuraminidase (NA), מחייבת את הצורך ננסח מחדש לנהל את החיסון מדי שנה.
התקדמות טכנולוגית בידוד, דור של אנטיגן ספציפי נוגדנים הניבו מספר גבוה של חיסון-induced mAbs4,5,6,7,8. בתורו, אפיון epitopes של mAbs זה בהרחבה לנטרל וירוסים שפעת A עזר במידה רבה את התפתחות מספר שפעת אוניברסלי חיסון מועמדים9,10,11, 12,13,14. שחקרתי antigenic טביעת רגלו של mAb חושף את גורמים מבניים של ניטרול ומאפשר גישה מושכלת לקראת עיצוב חיסון. עם זאת, זה לא מציאותי ולא חסכונית עבור מעבדות לאפיין מבחינה מבנית לוחות נרחבים של mAbs באמצעות קריסטלוגרפיה באמצעות קרני רנטגן או הקפאה-מיקרוסקופ כדי למפות epitopes אנטיגן ויראלי בכביש15, 16 , 17 , 18.
קריסטלוגרפיה באמצעות קרני רנטגן או הקפאה-מיקרוסקופ דורש ציוד יקר, טכניקות מיוחדות שעשויות להיות כמות נרחבת של זמן להפיק נתוני. גישה חלופית ומהירה הוא ניצול הדור מהירה של אוכלוסיות מגוונות ויראלי באמצעות תלויי-RNA לשגיאות RNA פולימראז ליצירת מוטציות לברוח כדי לקבוע את epitopes של mAbs19,20, 21,22,23. הדור של בריחה משתנים ואינו דורש שום ציוד מיוחד או טכניקה, יכול להתבצע עם ריאגנטים המעבדה קונבנציונליות וציוד.
כאן, אנו מתארים שיטה המאפשרת המיפוי של שאריות קריטי הנדרש עבור איגוד mAb לזהות את שפעת HA...

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

וירוסים שפעת להפגין יכולת מדהימה להסתגל, להתחמק את התגובה החיסונית של המארח. אחת הדרכים היא באמצעות antigenic שינויים המתרחשים glycoproteins משטח של הנגיף. הדור של גרסאות הבריחה היא שיטה חזקה שחקרתי כמה וירוסים לחמוק מגילוי המערכת החיסונית, זיהוי שאריות קריטי הנדרש עבור איגוד נוגדן. כאן, אנו מתארים את פרוטוקול על איך ליצור גרסאות הבריחה של וירוס שפעת A על ידי ניצול אנושי או מאתר נוגדנים חד-שבטיים (mAbs) נגד את hemagglutinin ויראלי (HA). עם השימוש של הטכניקה שלנו, אנחנו בעבר אפיינו את שאריות קריטי הנדרש עבור האיגוד של נוגדנים מיקוד הראש או גבעול של הרומן העופות H7N9 HA. הפרוטוקול ניתן להתאים בקלות למערכות אחרות וירוס. ניתוחים של בריחה משתנים חשובים עבור מידול antigenic להיסחף, קביעת פולימורפיזמים נוקלאוטיד יחיד (SNPs) היוועצות ההתנגדות וכושר וירוס, ולא של עיצוב של חיסונים ו/או הרפוי.

השתמשנו בעבר וריאציות של שיטה זו כדי ליצור גרסאות לברוח כדי mAbs מאתר ואנושי המושרה על ידי חיסון נגד וירוס שפעת עונתית, H7N9 חיסון, או רציפים DNA/רקומביננטי HA חלבון חיסון4,5 ,6,7. כמתואר לעיל, נוגדנים קודם מאופיינים בעזרת את מבחני HI ו- microneutralization כדי להודיע לנו על איזה פרוטוקול ספציפי כדי להמשיך עם4,הבא5. נוגדנים ד 07-5 03, 07-5F01, 07-5 ג' 01, 07-4B03, 07-4E02 ו- 07-4D 05 נמצאו HI ופעילויות ניטרול נגד הנגיף H7N9 העופות (A/שנגחאי/1/2013) (טבלה 1), ובכך היה מנוצל פרוטוקול 1 (שלב 2.1). עבור mAbs עם לנטרל את חוסר פעילות HI, כגון 41-5E04, 045-051310-2B06, 042-100809-2F04 ו- S6-B01 (טבלה 1), פרוטוקול 2 (שלב 2.2) נעשה שימוש כדי ליצור גרסאות לברוח. מיפוי מוטציה להימלט חשף כי רבים של הנוגדנים מזהה שאריות קריטי במיקומים שונים על נגיפי HA4,5 (איור 4). בעוד רוב הנוגדנים HI-חיובית יש לברוח שאריות מוטציה ליד אתרי antigenic שדווח בעבר של H7 HA, הנוגדנים HI-שלילי שנוצר מוטציות לברוח עם מוטציות נקודה גבעול אזור4,5 .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>נוגדן</td>
			<td>היי פעילות</td>
			<td>NEUT פעילות</td>
		</tr>
		<tr>
			<td>07-5D 03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5 ג' 01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D 05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
טבלה 1: שולחן פעילות HI וניטרול נוגדן. MAbs H7 ספציפיים עשר מבודד מאנשים שחוסנו חיסון ניסיוני H7N9 התערוכה שונים במבחנה פעילות אנטי5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">פריימר לפנים (5' ל 3')</td>
			<td colspan="4">הפוך פריימר (5' ל 3')</td>
			<td colspan="2">תנאי Thermocylcer</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">ºC 42 עבור 60 דקות, ºC 94 2 min/5 מחזורים של 94 ºC עבור 20 s, ºC 50 על 30 s ו- 68 ºC במשך 3 דקות 30 s, ואחריו 40 מחזורי 94 ºC 20 s, ºC 58 על 30 s , ו- 68 ºC עבור 3 דקות 30 s עם זמן סיומת הסופי ב- 68 ºC 10 דקות</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">ºC 45, 60 דקות, ºC 55 במשך 30 דקות, ºC 94 2 min/5 מחזורים של 94 ºC עבור 20 s, ºC 40 ל 30 s ו- 68 ºC במשך 3 דקות 30 s, ואחריו 40 מחזורי 94 ºC 20 s , ºC 58 על 30 s, ו- 68 ºC עבור 3 דקות 30 s עם זמן סיומת הסופי ב- 68 ºC 10 דקות</td>
		</tr>
	</tbody>
</table>
בטבלה 2: תחל וירוס שפעת אוניברסלי- פריימר זוגות עבור ההגברה של המקטעים HA של שפעת A27 , וירוסים28 B, מצבם thermocycler בהתאמה.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
איור 1: HI assay- מפרטים טכניים עבור ההגדרה למעלה assay HI לבדוק הפעילות של שני העכבר ספציפיים H1 mAbs 7B2 (ראש-ספציפי), 6F12 (גבעול-ספציפי) באמצעות צלחת V-התחתון 96-ובכן, ו- (B) דוגמה של תוצאות וזמינותו HI23(א) א. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
איור 2: Microneutralization assay. מפרטים טכניים עבור הגדרת assay microneutralization לבחון את הפעילות של שני בני אדם mAbs 4D 055 ו CR911417. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
איור 3: דור של מוטציות לברוח. המתודולוגיה הציע יהיו תלויים בגבוה הפעילות microneutralization הוצגו על ידי הנוגדן. הדור של בריחה מוטציות נגד (A) נוגדנים HI-חיוביות נטרול עשויים לדרוש קטע אחד קטן, ביצים, בעוד נוגדנים HI-שלילי נטרול (B) עשויה להיות כרוכה מעברים מרובים עם הגדלת סכומי נוגדן תרבית רקמת תאים. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
איור 4: דוגמה של מפה של epitope של הרומן העופות H7N9 חה שנוצר עם משתנים מוטציה להימלט. חיסון-induced נוגדנים מבודדים מאנשים שחוסנו מועמד שפעת H7N9 חיסון שימשו כדי ליצור גרסאות מוטציה להימלט. כל שאריות שצוינו האדום מייצג את המיקום של חומצות אמינו קריטי הנדרש עבור איגוד יעיל של mAb. הנתונים היו ממאמרו של Dunand הנרי. et al., 20154. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

אנו מתארים שיטה שבאמצעותה אנו מזהים שאריות קריטי הנדרש עבור האיגוד של נוגדנים חד-שבטיים אנושית או מאתר שמכוונות את hemagglutinin נגיפי שפעת A וירוסים. הפרוטוקול ניתן להתאים glycoproteins משטח אחר וירוס, נוגדנים נטרול המתאימים שלהם.

דור של בריחה וריאציות של נטרול נוגדנים חד-שבטיים של וירוס שפעת

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

הדור של וירוס שפעת רקומביננטי מ-DNA פלסמיד

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

בידוד של פידליטי גרסאות של וירוסים RNA ו אפיון תדירות המוטציה וירוס

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

תפוקה גבוהה איתור שיטת וירוס השפעת

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

רביה וירוס השפעת בembryonated עוף ביצים

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

דור של רקומביננטי אדם IgG נוגדנים חד שבטיים מתאים הממוינים B הונצחו

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

הדור של Murine חד-שבטיים נוגדנים על ידי Hybridoma טכנולוגיה

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

מחקרים וירוס שפעת A במודל של עכברים של זיהום

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

מבחני מדידת שפעת בנטרול תגובות נוגדנים וירוסים A(H3N2) סרה האנושי על-ידי Microneutralization באמצעות תאים MDCK-SIAT1

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

דור שמסווגת נוגדנים חד-שבטיים אנושי מתאי B אנטיגן ספציפי נדיר במחזור הדם

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

דור של נוגדנים חד-שבטיים כנגד מוצרים טבעיים

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...