Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

इस परियोजना के राष्ट्रीय एलर्जी और संक्रामक रोग, राष्ट्रीय स्वास्थ्य संस्थान, स्वास्थ्य और मानव सेवा विभाग, CEIRS अनुबंध HHSN272201400008C (F.K.) के तहत के संस्थानों से संघीय धन के साथ भाग में वित्त पोषित किया गया है; NIH U19AI109946-01 (F.K.); और P01AI097092-04S1 (P.E.L.) ।

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

लेखकों के हितों का कोई टकराव की घोषणा ।

हालांकि बच म्यूटेंट के द्वारा की पहचान अवशेषों के बहुमत सटीक गया है, इस दृष्टिकोण के प्रमुख निरंतर में से एक यह है कि भागने के वेरिएंट के बिंदु उत्परिवर्तन जरूरी एंटीबॉडी के आणविक पदचिह्न के भीतर नक्शा के रूप में निर्धारित नहीं कर सकते है संरचनात्मक विश्लेषण । यह एक निश्चित अवशेषों में एक उत्परिवर्तन की क्षमता के कारण है, एक allosteric प्रभाव के अनुरूप रूपांतरित अवशेषों के स्थान के लिए बाहर एक संरचना परिवर्तन का नेतृत्व करने के लिए । एक और सीमा यह है कि इस पद्धति केवल एंटीबॉडी बेअसर करने के लिए लागू किया जा सकता है; एंटीबॉडी कि इन विट्रो में कमी चयनात्मक दबाव म्यूटेंट भागने के लिए नेतृत्व नहीं होगा. हालांकि, इस सीमा से बचने के एक पैनल के उपयोग के साथ काबू किया जा सकता है पहले विशेषता बेअसर एंटीबॉडी द्वारा उत्पंन की गई । टैन एट अल. H7N9 वायरस के लिए एक बेअसर मॉब के एक भागने के संस्करण का इस्तेमाल किया एक गैर के epitope नक्शा एंटीबॉडी7बेअसर ।
बहरहाल, elucidating भागने वेरिएंट की पीढ़ी के माध्यम से एंटीबॉडी के epitopes क्रि और क्रायो-इलेक्ट्रॉन माइक्रोस्कोपी, दोनों जिनमें से उपकरणों की एक व्यापक निवेश की आवश्यकता के लिए एक व्यवहार्य विकल्प प्रदान करता है । अन्य विकल्प alanine स्कैनिंग या पेप्टाइड स्कैनिंग/म्यूटेंट का उपयोग कर mAbs के न्यूनतम बाइंडिंग क्षेत्र का निर्धारण करने के लिए कर रहे हैं । Alanine स्कैनिंग mutagenesis29स्क्रीनिंग के दौरान वेरिएंट की एक बड़ी संख्या पैदा करने में काम की एक महत्वपूर्ण राशि की आवश्यकता हो सकती है, जबकि पेप्टाइड स्कैनिंग रैखिक epitopes के लिए सीमित है30. विधि इस प्रोटोकॉल में वर्णित कोई विशेष उपकरण या तकनीक और वास्तव में की आवश्यकता है, इन विट्रो बेअसर परख के लिए ब्याज की एंटीबॉडी के भागने के वेरिएंट उत्पंन संशोधित में मौजूदा का उपयोग करता है ।
कई मार्ग (उदा, डंठल-विशिष्ट एंटीबॉडी) की आवश्यकता है कि एस्केप वेरिएंट पैदा करने के लिए प्रोटोकॉल एंटीबॉडी के शुरू एकाग्रता पर अत्यधिक निर्भर है 0 मार्ग में । यह सावधानी के पक्ष में गलती और एक लॉग में शुरू करने के लिए एक एंटीबॉडी के आधे से अधिक अधिकतम निरोधात्मक एकाग्रता से कम और मजबूत वायरस के विकास के लिए अनुमति देने के लिए बेहतर है । शोधकर्ता कल्पना कर सकते है कि कम प्रतिरक्षा दबाव की उपस्थिति में एक उच्च titer वायरस संस्कृति वायरल जनसंख्या में एक बड़ी आनुवंशिक भिन्नता होगी । एस्केप वेरिएंट के लिए धीरे से निम्नलिखित मार्ग में एंटीबॉडी एकाग्रता में वृद्धि के द्वारा चुना जा सकता है । इस स्थिति में कि वायरस की वृद्धि कम हो जाती है, वायरल supernatant की मात्रा पिछले बीतने में एंटीबॉडी एकाग्रता की समान मात्रा को बनाए रखते हुए अगले मार्ग में वृद्धि की जा सकती है.
यूनिवर्सल इंफ्लूएंजा टीके के बहुमत के उद्देश्य के लिए हा के डंठल क्षेत्र की ओर एक मजबूत एंटीबॉडी प्रतिक्रिया बटोरना है । डंठल-विशिष्ट एंटीबॉडी के लिए भागने वेरिएंट के विश्लेषण इंफ्लूएंजा वायरस फिटनेस और प्रतिरक्षा दबाव के बीच संबंध को परिभाषित करने में महत्वपूर्ण हैं । दिलचस्प बात यह है, बच उत्परिवर्ती डंठल से उत्पंन वायरस-विशिष्ट mAbs सभी murine LD में vivo में तनु थे५० अध्ययन4। ये अध्ययन डंठल आधारित टीकाकरण प्लेटफार्मों के लिए एक मजबूत मामले प्रदान करते हैं । इसके अतिरिक्त, इस प्रोटोकॉल छोटे अणु अवरोधकों के रूप में अन्य विरोधी वायरल यौगिकों, के लिए भागने म्यूटेंट की पहचान करने के लिए इस्तेमाल किया जा सकता है. अंत में, यह पद्धति इंफ्लूएंजा वायरस सतह नच तक ही सीमित नहीं है, लेकिन यह भी अधिक व्यापक रूप से अंय वायरल नच की epitopes निर्धारित करने के लिए लागू किया जा सकता है ।

अंय आरएनए वायरस के समान, इंफ्लूएंजा एक वायरस एक त्रुटि प्रवण पोलीमरेज़ कि प्रतिकृति के प्रत्येक दौर के साथ एक भीड़ की पीढ़ी के लिए अनुमति देता है1,2,3। इंफ्लूएंजा एक वायरस के लिए एक आश्चर्यजनक अनुकूलन और प्रतिजनी बहाव है, जो सतह नच कि एंटीबॉडी बंधन के नुकसान की ओर जाता है पर उत्परिवर्तनों के एक संचय के माध्यम से हासिल की है के माध्यम से मानव प्रतिरक्षा प्रतिक्रिया से बचने की क्षमता है । वायरल सतह के प्रतिजनी बहाव नच, हा और neuraminidase (NA), आवश्यक वैक्सीन को सालाना तैयार करने और व्यवस्थापित करने की जरूरत है.
अलगाव और प्रतिजन-विशिष्ट एंटीबॉडी की पीढ़ी में तकनीकी प्रगति टीके की एक उच्च संख्या-प्रेरित mAbs4,5,6,7,8में झुकेंगे । बारी में, mAbs के epitopes के लक्षण वर्णन है कि मोटे तौर पर इंफ्लूएंजा एक वायरस बहुत कई सार्वभौमिक इंफ्लूएंजा टीके के विकास के लिए सहायता प्राप्त है बेअसर9,10,11, 12,13,14. Elucidating एक मॉब के प्रतिजनी पदचिह्न बेअसर के संरचनात्मक निर्धारकों को पता चलता है और वैक्सीन डिजाइन की दिशा में एक सूचित दृष्टिकोण के लिए अनुमति देता है । हालांकि, यह न तो यथार्थवादी है और न ही लागत प्रभावी प्रयोगशालाओं के लिए एक्स-रे क्रि या क्रायो-इलेक्ट्रॉन माइक्रोस्कोपी के माध्यम से mAbs के व्यापक पैनलों की विशेषता के लिए वायरल प्रतिजन पर epitopes नक्शा करने के लिए15, 16 , 17 , 18.
एक्स-रे क्रि या क्रायो-इलेक्ट्रॉन माइक्रोस्कोपी महंगे उपकरणों की आवश्यकता है, विशेष तकनीक और संभावित डेटा उत्पन्न करने के लिए समय की एक व्यापक राशि. एक वैकल्पिक और तेजी से दृष्टिकोण त्रुटि प्रवण आरएनए-निर्भर आरएनए पोलीमरेज़ के माध्यम से विविध वायरल आबादी के तेजी से उत्पादन का उपयोग कर रहा है बच म्यूटेंट उत्पन्न करने के लिए mAbs के epitopes का निर्धारण करने के लिए19,20, 21,22,23. भागने वेरिएंट की पीढ़ी किसी विशेष उपकरण या तकनीक की आवश्यकता नहीं है और पारंपरिक प्रयोगशाला एजेंट और उपकरणों के साथ प्रदर्शन किया जा सकता है ।
यहां, हम एक विधि है कि महत्वपूर्ण मॉब बाध्यकारी है कि इंफ्लूएंजा हा पहचान के लिए आवश्यक अवशेषों के मानचित्रण के लिए अनुमति देता है का वर्णन ।

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

इंफ्लूएंजा वायरस एक उल्लेखनीय अनुकूलन और मेजबान प्रतिरक्षा प्रतिक्रिया से बचने की क्षमता का प्रदर्शन । एक तरह से प्रतिजनी बदलाव के माध्यम से होता है कि सतह पर होते हैं नच का वायरस । भागने वेरिएंट की पीढ़ी elucidating कैसे वायरस प्रतिरक्षा का पता लगाने से बचने और एंटीबॉडी बंधन के लिए आवश्यक महत्वपूर्ण अवशेषों की पहचान करने में एक शक्तिशाली तरीका है । यहां, हम कैसे इंफ्लूएंजा उत्पंन करने के लिए पर एक प्रोटोकॉल का वर्णन मानव या murine मोनोक्लोनल एंटीबॉडी (mAbs) वायरल hemagglutinin के खिलाफ निर्देशित (HA) का उपयोग करके वायरस से बच वेरिएंट । हमारी तकनीक के उपयोग के साथ, हम पहले से ही महत्वपूर्ण या तो सिर या उपंयास एवियन H7N9 हा के डंठल को लक्षित एंटीबॉडी के बंधन के लिए आवश्यक अवशेषों की विशेषता । प्रोटोकॉल आसानी से अंय वायरस प्रणालियों के लिए अनुकूलित किया जा सकता है । भागने वेरिएंट का विश्लेषण प्रतिजनी बहाव मॉडलिंग के लिए महत्वपूर्ण हैं, एक न्यूक्लियोटाइड बहुरूपताओं (SNPs) प्रतिरोध और वायरस स्वास्थ्य प्रदान, और टीकों और/या चिकित्सीय चिकित्सा के डिजाइन में निर्धारित ।

हम पहले इस विधि के रूपांतरों का इस्तेमाल किया है मानव और murine mAbs मौसमी इंफ्लूएंजा वायरस वैक्सीन, H7N9 टीकाकरण, या अनुक्रमिक डीएनए द्वारा प्रेरित करने के लिए एस्केप वेरिएंट उत्पंन/संयोजक हा प्रोटीन टीकाकरण4,5 ,6,7. जैसा कि ऊपर वर्णित है, एंटीबॉडी पहले हाय और microneutralization परख का उपयोग करने के क्रम में हमें सूचित करने के लिए जो विशिष्ट प्रोटोकॉल अगले4,5के साथ जारी रखने के लिए विशेषता थी । एंटीबॉडी 07-5D03, 07-5F01, 07-5G01, 07-4B03, 07-4E02 और 07-4D05 एवियन H7N9 वायरस (ए/शंघाई/1/2013) (तालिका 1), और इस प्रकार प्रोटोकॉल 1 (चरण २.१) का उपयोग किया गया था के खिलाफ उच्च और बेअसर गतिविधियों के लिए पाया गया । इस तरह के 41-5E04, 045-051310-2B06, 042-100809-2F04 और S6-B01 (तालिका 1), प्रोटोकॉल 2 (चरण २.२) के रूप में कमी उच्च गतिविधि, के साथ mAbs के लिए एस्केप वेरिएंट उत्पन्न करने के लिए इस्तेमाल किया गया था. एस्केप उत्परिवर्ती मानचित्रण से पता चला है कि एंटीबॉडी के कई वायरल हा4,5 (चित्रा 4) पर अलग स्थानों में महत्वपूर्ण अवशेषों की पहचान । जबकि उच्च सकारात्मक एंटीबॉडी के बहुमत से बच उत्परिवर्ती अवशेषों के पास पहले से ही H7 हा की एंटीजन साइटों की सूचना दी, हाय-नकारात्मक एंटीबॉडी डंठल क्षेत्र में अंक उत्परिवर्तनों के साथ भागने म्यूटेंट उत्पन्न4,5 .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>एंटीबॉडी</td>
			<td>हाय गतिविधि</td>
			<td>NEUT गतिविधि</td>
		</tr>
		<tr>
			<td>07-5D03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
तालिका 1: एंटीबॉडी हाय और बेअसर गतिविधि की मेज । दस H7-विशिष्ट mAbs व्यक्तियों से अलग एक प्रयोगात्मक H7N9 टीका अलग प्रदर्शन इन विट्रो एंटीवायरल गतिविधियों के साथ टीका लगाया5।
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">फॉरवर्ड प्राइमर (5 ' से 3 ')</td>
			<td colspan="4">रिवर्स प्राइमर (5 ' से 3 ')</td>
			<td colspan="2">Thermocylcer अटी</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">४२ º सी के लिए ६० मिनट, ९४ º सी के लिए 2 मिनट/5 चक्र के लिए ९४ º c के लिए 20 s, ५० º c के लिए 30 s और ६८ º c के लिए 3 मिनट 30 एस, के लिए ४० º c के द्वारा पीछा किया 20 s, के लिए ९४ º c 30 s के लिए , और ६८ º सी के लिए 3 मिनट 30 एस के लिए ६८ º c पर एक अंतिम विस्तार समय के साथ 10 मिनट के लिए</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">४५ º सी के लिए ६० मिनट, ५५ º सी के लिए 30 मिनट, ९४ के लिए º सी 2 मिनट के लिए, ९४ º सी के लिए 20 एस, 30 एस के लिए और ४० º सी के लिए 3 मिनट 30 एस, के लिए ६८ º सी के बाद 20 एस के लिए , ५८ º सी के लिए 30 एस, और ६८ º सी के लिए 3 मिनट 30 एस के लिए ६८ º c पर एक अंतिम विस्तार समय के साथ 10 मिनट के लिए</td>
		</tr>
	</tbody>
</table>
तालिका 2: यूनिवर्सल इंफ्लूएंजा वायरस प्राइमर । इंफ्लूएंजा के हा क्षेत्रों के प्रवर्धन के लिए प्राइमरी जोड़े एक27 और बी28 वायरस और उनके संबंधित thermocycler शर्तों ।
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
चित्रा 1: हाय परख । (a) एक उच्च परख की स्थापना के लिए एक योजनाबद्ध को दो माउस H1 की गतिविधि परीक्षण विशिष्ट mAbs 7B2 (सिर विशेष) और 6F12 (डंठल-विशेष) का उपयोग कर एक ९६-अच्छी तरह से वी नीचे प्लेट, और (ख) एक हाय परख23के परिणामों का एक उदाहरण । <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
चित्रा 2: Microneutralization परख । एक microneutralization परख की स्थापना के लिए दो मानव mAbs 4D05 की गतिविधि परीक्षण के लिए एक योजनाबद्ध5 और CR911417। <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
चित्रा 3: एस्केप म्यूटेंट की जनरेशन । सुझाव दिया पद्धति हाय और एंटीबॉडी द्वारा प्रदर्शित microneutralization गतिविधि पर निर्भर हो जाएगा । के खिलाफ बच म्यूटेंट की पीढ़ी (ए) उच्च सकारात्मक एंटीबॉडी बेअसर अंडे में एक ही मार्ग की आवश्यकता हो सकती है, जबकि (बी) बेअसर उच्च नकारात्मक एंटीबॉडी में एंटीबॉडी मात्रा में वृद्धि के साथ कई मार्ग शामिल हो सकते हैं कोशिका ऊतक संस्कृति । <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
चित्रा 4: एक epitope के नक्शे का एक उदाहरण के उपंयास एवियन H7N9 हा एस्केप उत्परिवर्ती वेरिएंट के साथ उत्पंन । टीका-प्रेरित एंटीबॉडी एक उंमीदवार H7N9 इंफ्लूएंजा एक टीके के साथ टीका लगाया व्यक्तियों से अलग से बच उत्परिवर्ती वेरिएंट उत्पंन करने के लिए इस्तेमाल किया गया । प्रत्येक लाल रंग में संकेत अवशेष एक मॉब के कुशल बंधन के लिए आवश्यक महत्वपूर्ण अमीनो एसिड के स्थान का प्रतिनिधित्व करता है । डेटा Dunand-हेनरी एट अल, २०१५4से अनुकूलित किया गया । <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

हम एक विधि है जिसके द्वारा हम महत्वपूर्ण मानव या murine मोनोक्लोनल एंटीबॉडी कि इंफ्लूएंजा के वायरल hemagglutinin एक वायरस के लक्ष्य के बंधन के लिए आवश्यक अवशेषों की पहचान का वर्णन । प्रोटोकॉल अंय वायरस सतह नच और उनके इसी बेअसर एंटीबॉडी के लिए अनुकूलित किया जा सकता है ।

बचने इंफ्लूएंजा वायरस मोनोक्लोनल एंटीबॉडी के भागने के वेरिएंट की पीढ़ी

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

पुनः संयोजक इन्फ्लुएंजा वायरस के डीएनए प्लाज्मिड से पीढ़ी

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

फिडेलिटी और वायरस वायरस उत्परिवर्तन आवृत्ति के शाही सेना के विशेषता के वेरिएंट के अलगाव

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

इन्फ्लुएंजा वायरस के लिए उच्च throughput जांच विधि

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Embryonated चिकन अंडे में इन्फ्लुएंजा वायरस प्रचार

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

अमर छाँटे बी कोशिकाओं से पुनः संयोजक मानव आईजीजी मोनोक्लोनल एंटीबॉडी का सृजन

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

हाइब्रिडोमा प्रौद्योगिकी द्वारा Murine मोनोक्लोनल एंटीबॉडी की पीढ़ी

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

इंफ्लूएंजा संक्रमण के एक माउस मॉडल में एक वायरस अध्ययन

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

मापने इंफ्लूएंजा को निष्क्रिय एंटीबॉडी प्रतिक्रियाओं को एक (H3N2) मानव सीरा में Microneutralization परख द्वारा MDCK-SIAT1 कोशिकाओं का उपयोग कर वायरस

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

दुर्लभ प्रतिजन-विशिष्ट बी कोशिकाओं से रक्त में परिचालित में भेदभावपूर्ण मानव मोनोक्लोनल एंटीबॉडी की पीढ़ी

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

प्राकृतिक उत्पादों के खिलाफ मोनोक्लोनल एंटीबॉडी का उत्पादन

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...