Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

이 프로젝트는 자금을 일부 알레르기 국립 연구소와 전염병에서 연방 자금, 건강의 국가 학회, 학과의 보건 및 인적 서비스, CEIRS 아래 계약 HHSN272201400008C (F.K.); NIH U19AI109946-01 (F.K.); 그리고 P01AI097092-04S1 (P.E.L.)입니다.

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

저자는 관심 없음 충돌 선언합니다.

대부분 탈출 돌연변이 통해 식별 된 잔류물의 정확 하 게 되어,이 방법의 주요 주의 사항 중 하나 이지만 탈출 이체의 점 돌연변이 의해 결정 되는 항 체의 분자 풋프린트 내에서 반드시 매핑되지 않을 수 있습니다. 구조 분석입니다. 이것은 원심 allosteric 효과 유사한 돌연변이 잔류물의 위치를 구조적 변화에 지도 하는 특정 잔류물에 돌연변이의 능력 때문 이다. 또 다른 한계는이 방법만 중화 항 체;에 대 한 구현 될 수 있습니다. 항 체를 체 외에서 선택적 압력 부족 돌연변이 탈출 이어질 것입니다. 그러나,이 제한 탈출 변종 이전 특징이 중화 항 체에 의해 생성 된 패널의 사용으로 극복할 수 있습니다. 황갈색 외. H7N9 바이러스를 중화 mAb의 탈출 변형 사용 비 중화 항 체7의 epitope를 지도.
그럼에도 불구 하 고, 탈출 이체의 세대를 통해 항 체의 epitopes를 elucidating 결정학 및 cryo 전자 현미경 검사 법, 둘 다 장비의 광범위 한 투자 요구에 대안을 제공 합니다. 다른 대안 mAbs 알라닌 스캔 또는 펩 티 드 스캔/자르기 돌연변이 사용 하 여 최소한의 바인딩 영역을 결정 하는. 알라닌 mutagenesis 스캔 이체의 많은 수를 생성 하는 펩 티 드 검색 하는 것은 선형 epitopes30으로 제한 하는 동안29, 심사 하는 동안에 작업의 상당한 금액을 요구할 수 있습니다. 이 프로토콜에서 설명 하는 방법을 아무 특별 한 장비 또는 기술을 요구 하 고 사실, 사용 기존 생체 외에서 중화 분석 관심의 항 체의 탈출 이체를 생성 하도록 수정.
여러 구절 (예를 들어, 스토킹 특정 항 체)를 요구 하는 생성 탈출 변종에 대 한 프로토콜 높은 통로 0 항 체의 시작 농도에 따라 달라 집니다. 그것은 주의 측면에 잘못을 항 체의 절반 최대한 억제 농도 보다 낮은 반 로그에 로그 시작 강력한 바이러스 성장에 대 한 허용을 좋습니다. 연구원 면역 저압의 높은 titer 바이러스 문화 바이러스 인구에서 큰 유전 변이 가질 것 이라고 추측 수 있습니다. 도 이체 다음 구절에서 항 체 농도 점차적으로 증가 하 여 대 한 선택할 수 있습니다. 바이러스 성장 감소, 그 바이러스 상쾌한 양의 이전 구절에서 항 체 농도의 동일한 금액을 유지 하면서 다음 구절에서 늘릴 수 있습니다.
보편적인 인플루엔자 백신의 대부분의 목표는 HA의 스토킹 지역으로 강력한 항 체 응답을 이끌어내는 것 이다. 줄기-특정 항 체를 탈출 이체의 분석은 인플루엔자 바이러스 체력과 면역 압력 사이의 관계를 정의에서 중요 한. 흥미롭게도, 탈출 돌연변이 바이러스 스토킹 관련 mAbs에서 유래한 murine LD50 연구4에서 모든 감쇠 vivo에서 했다. 이러한 연구는 예방 접종 스토킹 기반 플랫폼에 대 한 강한 케이스를 제공합니다. 또한,이 프로토콜 작은 분자 억제제 같은 다른 안티 바이러스 화합물에 탈출 돌연변이 식별 하기 위해 사용 될 수 있습니다. 마지막으로,이 방법론 인플루엔자 바이러스 표면 glycoproteins에 국한 되지 않습니다 하지만 다른 바이러스 성 glycoproteins의 epitopes를 결정 하도 더 넓게 적용 될 수 있습니다.

다른 RNA 바이러스와 마찬가지로, 인플루엔자 A 바이러스는 다양 한 항 원 이체 복제1,2,3의 각 라운드의 생성을 허용 하는 오류 중 합 효소를 소유한 다. 인플루엔자 바이러스는 항 체 바인딩의 손실에 지도 하는 표면 glycoproteins에 돌연변이의 축적을 통해 달성 된다 항 원 편 류를 통해 인간의 면역 반응을 회피 하 고 적응 하는 놀라운 능력. 바이러스 성 표면 glycoproteins, 하 및 응집 (NA)의 항 원 편 류를 다르게 매년 백신을 관리 하 고 필요를 필요로 합니다.
격리 및 항 원 특정 항 체의 생성 기술 발전 백신 유도 mAbs4,5,6,,78의 높은 수를 얻지 못했다. 차례로, 인플루엔자 A 바이러스를 광범위 하 게 중화 mAbs의 epitopes의 특성은 크게 주 었 여러 범용 인플루엔자 백신 후보자9,,1011의 개발 12,,1314. mAb의 항 원 발자국 elucidating 중립화의 구조적 결정 요인 밝혀 고 백신 디자인으로 정보 접근에 대 한 수 있습니다. 그러나, 그것은 현실도 구조적으로 바이러스 성 항 원15, 에 epitopes를 지도 하기 위하여 엑스레이 결정학 또는 cryo 전자 현미경 검사 법을 통해 mAbs의 광범위 한 패널 특성 실험실에 대 한 비용 효율적인 16 , 17 , 18.
엑스레이 결정학 또는 cryo 전자 현미경 검사 법 고가의 장비, 전문된 기술 및 잠재적으로 광범위 한 양의 데이터를 생성 하는 시간이 필요 합니다. 대체 하 고 빠른 접근 활용 오류가 RNA 의존을 통해 다양 한 바이러스 인구의 급속 한 세대 mAbs19,20의 epitopes를 결정 하기 위해 탈출 돌연변이 생성에 RNA 중 합 효소 21,,2223. 이스케이프 변종의 생성 어떤 특별 한 장비 또는 기술을 요구 하지 않는다 고 기존의 실험실 시 약 및 장비와 함께 수행할 수 있습니다.
여기, 인플루엔자 HA를 인식 하는 mAb 바인딩에 필요한 중요 한 잔류물의 매핑 허용 하는 방법을 설명 합니다.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

인플루엔자 바이러스는 호스트 면역 반응을 회피 하 고 적응 하는 놀라운 능력을 전시 한다. 한 가지 방법은 바이러스의 표면 glycoproteins에서 발생 하는 항 원 변화를 통해 이다. 탈출 이체의 세대에 elucidating 바이러스 면역 검출을 탈출 하는 방법을 식별 하는 항 체 바인딩에 필요한 중요 한 잔류물에 강력한 방법입니다. 여기, 우리 인플루엔자 A 바이러스도 변종 바이러스 성 조류 (HA)에 대 한 감독 또는 murine 단일 클론 항 체 (mAbs)를 이용 하 여 생성 하는 방법에 대 한 프로토콜을 설명 합니다. 우리의 기술 사용 하 여 우리는 이전 중요 한 잔류물 머리 나는 새로운 조류 H7N9 하의 줄기를 대상으로 항 체 바인딩을 위한 필요한 특징. 프로토콜은 다른 바이러스 시스템에 쉽게 적용할 수 있습니다. 탈출 이체의 분석은 단 하나 뉴클레오티드 동 질 다 상 (Snp) 저항 및 바이러스, 부여 결정 항 원 편 류를 모델링 및 백신 치료제의 설계에 중요 합니다.

우리가 이전 계절 인플루엔자 바이러스 백신, H7N9 예방 접종, 또는 순차적 DNA/재조합 HA 단백질 예방 접종4,5 에 의해 유도 된 인간과 murine mAbs에 탈출 변종 생성 하이 방법의 사용 6,7. 위에서 설명한 항 체가 고 microneutralization 분석 실험 사용 하 여 다음4,5을 계속 하는 특정 프로토콜의 우리에 게 먼저 특징 이었다. 항 체 07-5 D 03, 07-5F01, 07-5 G 01, 07-4B03, 07-4E02, 07-4 D 05 조류 H7N9 바이러스 (A/상하이/1/2013) (표 1)에 대 한 안녕 고 중화 활동을 발견 하 고 따라서 프로토콜 1 (2.1 단계) 이용 되었다. S6-B01 (표 1), 042-100809-2F04, 045-051310-2B06, 41-5E04 등이 활동 부족 중화와 mAbs에 대 한 프로토콜 2 (2.2 단계) 탈출 변종을 생성 하 사용 되었다. 탈출 돌연변이 매핑 밝혀 항 체의 많은 바이러스 성 하4,5 (그림 4)에 다른 위치에서 중요 한 잔류물을 인식. 이 부정적인 항 체 줄기 지역4,5 탈출 점 돌연변이와 돌연변이 생성이 긍정적인 항 체의 대부분 있다 H7 하의 이전에 보고 된 항 원 사이트 근처 돌연변이 잔류물, 탈출 하는 동안 .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>항 체</td>
			<td>안녕하세요 활동</td>
			<td>NEUT 활동</td>
		</tr>
		<tr>
			<td>07-5 D 03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5 G 01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4 D 05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
표 1: 항 체가 고 중화 활동의 테이블. 개인 실험 H7N9 백신 접종에서 고립 된 10 H7 전용 mAbs 전시 다른 시험관에 항 바이러스 활동5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">앞으로 뇌관 (5' 3')</td>
			<td colspan="4">반전 뇌관 (5' 3')</td>
			<td colspan="2">Thermocylcer 조건</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">60 분 42 º C, 20 94 º C의 2 분/5 사이클 94 º C s, 30 50 º C s 3 분 30 s 68 º C 20 94 º C의 40 주기 다음 s, 58 ° C 30에 대 한 s 그리고 10 분 동안 68 º C에서 최종 확장 시간 3 분 30 s 68 º C</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">60 분, 30 분 동안 55 ° C, 20 94 º C의 2 분/5 사이클 94 º C 45 º C s, 30 40 º C s 3 분 30 s 68 º C 20 94 º C의 40 주기 다음 s 58 º C 30에 대 한 s, 그리고 10 분 동안 68 º C에서 최종 확장 시간 3 분 30 s 68 º C</td>
		</tr>
	</tbody>
</table>
표 2: 범용 인플루엔자 바이러스 뇌관. 인플루엔자 A27 B28 바이러스 및 그들의 각각 thermocycler 조건 하 세그먼트의 확대를 위한 뇌관 쌍.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
그림 1: 안녕 분석 결과. 두 개의 마우스 H1 특정 mAbs 7B2 (머리 전용) 및 6F12 (스토킹 관련) 96-잘 V-하단 플레이트, 그리고 (B)는이 분석 결과23의 결과의 예를 사용 하 여 작업을 테스트 하는 분석 결과 설정에 대 한 도식 (A) A <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
그림 2: Microneutralization 분석 결과. Microneutralization 분석 결과 두 인간의 mAbs 4D 055 와 CR911417의 활동을 테스트 설정에 대 한 도식 <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
그림 3: 탈출 돌연변이의 발생. 제안 하는 방법론은이 항 체에 의해 전시 microneutralization 활동에 종속 됩니다. (A)에 대 한 탈출 돌연변이 생성 중화이 긍정적인 항 체 필요할 수 있습니다. 계란, 단일 통로 (B) 항 체가 부정 중화 항 체 량 증가 함께 여러 구절을 포함 수 있습니다. 세포 조직 문화입니다. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
그림 4:는 epitope 지도 새로운 조류 H7N9 하의 탈출 돌연변이 변형 생성의 예. 백신 유발 항 체 격리 후보와 개인에서 H7N9 인플루엔자 백신 탈출 돌연변이 변종을 생성 하는 데 사용 했다. 각 찌 꺼 기는 mAb의 효율적인 바인딩에 필요한 중요 한 아미노산의 위치 빨간 나타냅니다에 표시. 데이터는 Dunand 헨리 외., 20154에서 적응 했다. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

우리는 우리가 대상으로 인플루엔자 A 바이러스의 바이러스 성 조류 인간 또는 murine 단일 클론 항 체의 바인딩을에 필요한 중요 한 잔류물을 식별 하는 방법을 설명 합니다. 프로토콜은 다른 바이러스 표면 glycoproteins 그리고 그들의 해당 중화 항 체에 적용할 수 있습니다.

인플루엔자 바이러스 단일 클론 항 체를 중화의 탈출 변종의 생성

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

플라스미드 DNA의 재조합 독감 바이러스의 생성

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

연구

면역학 및 감염병학

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

바이러스 변이 주파수의 RNA 바이러스 및 특성화의 피델리티 변종의 분리

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

인플루엔자 바이러스에 대한 높은 처리량 검출 방법

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

인간 백신 닭 계란에 인플루엔자 바이러스 전파

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

정렬 된 불멸화 된 B 세포로부터 재조합 인간 IgG 단일 클론 항체의 생성

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

하이 브리 도마 기술에 의해 쥐 단일 클론 항체의 생성

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

감염 마우스 모델에서 인플루엔자 A 바이러스 연구

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

사용 하 여 MDCK SIAT1 세포 분석 실험 측정 인플루엔자 항 체 응답 Microneutralization에 의해 인간의 세라에 A(H3N2) 바이러스를 중화

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

희귀 한 항 원 특정 B 세포 혈액 순환에서 구별 인간 단일 클론 항 체의 생성

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

천연 제품에 대 한 단일 클론 항 체의 생성

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...