Name: generation of escape variants of neutralizing influenza virus monoclonal antibodies
Uploaded: 2017-08-29T13:00:00
Duration: 7 min 55 s
Description: Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Este projecto foi financiado em parte com fundos federais do Instituto Nacional de alergia e doenças infecciosas, National Institutes of Health, departamento de saúde e serviços humanos, sob CEIRS contrato HHSN272201400008C (F.K.); U19AI109946 NIH-01 (F.K.); e P01AI097092-04S1 (P.E.L.).

<ol>
	<li>Shaw, M. L., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Orthomyxoviridae: the viruses and their replication. , (2013).</li><li>Nelson, M. I., Holmes, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolution+of+epidemic+influenza.">The evolution of epidemic influenza.</a> Nat Rev Genet. 8 (3), 196-205 (2007).</li><li>Lauring, A. S., Andino, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quasispecies+Theory+and+the+Behavior+of+RNA+Viruses.">Quasispecies Theory and the Behavior of RNA Viruses.</a> PLoS Pathog. 6 (7), e1001005 (2010).</li><li>Henry Dunand, C. J., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preexisting+human+antibodies+neutralize+recently+emerged+H7N9+influenza+strains.">Preexisting human antibodies neutralize recently emerged H7N9 influenza strains.</a> J Clin Invest. 125 (3), 1255-1268 (2015).</li><li>Dunand, C. J. H., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Both+Neutralizing+and+Non-Neutralizing+Human+H7N9+Influenza+Vaccine-Induced+Monoclonal+Antibodies+Confer+Protection.">Both Neutralizing and Non-Neutralizing Human H7N9 Influenza Vaccine-Induced Monoclonal Antibodies Confer Protection.</a> Cell Host Microbe. 19 (6), 800-813 (2016).</li><li>Tan, G. S., Lee, P. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+Broadly+Neutralizing+Monoclonal+Antibody+That+Targets+the+Fusion+Domain+of+Group+2+Influenza+A+Virus+Hemagglutinin.">Characterization of a Broadly Neutralizing Monoclonal Antibody That Targets the Fusion Domain of Group 2 Influenza A Virus Hemagglutinin.</a> J Virol. 88 (23), 13580-13592 (2014).</li><li>Tan, G. S., Leon, P. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly-Reactive+Neutralizing+and+Non-neutralizing+Antibodies+Directed+against+the+H7+Influenza+Virus+Hemagglutinin+Reveal+Divergent+Mechanisms+of+Protection.">Broadly-Reactive Neutralizing and Non-neutralizing Antibodies Directed against the H7 Influenza Virus Hemagglutinin Reveal Divergent Mechanisms of Protection.</a> PLoS Pathog. 12 (4), e1005578 (2016).</li><li>Smith, K., Garman, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Steel, J., Lowen, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+virus+vaccine+based+on+the+conserved+hemagglutinin+stalk+domain.">Influenza virus vaccine based on the conserved hemagglutinin stalk domain.</a> mBio. 1 (1), (2010).</li><li>Krammer, F., Pica, N., Hai, R., Margine, I., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chimeric+hemagglutinin+influenza+virus+vaccine+constructs+elicit+broadly+protective+stalk-specific+antibodies.">Chimeric hemagglutinin influenza virus vaccine constructs elicit broadly protective stalk-specific antibodies.</a> J Virol. 87 (12), 6542-6550 (2013).</li><li>Wang, T. T., Tan, G. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+a+synthetic+peptide+from+the+influenza+virus+hemagglutinin+provides+protection+against+distinct+viral+subtypes.">Vaccination with a synthetic peptide from the influenza virus hemagglutinin provides protection against distinct viral subtypes.</a> Proc Natl Acad Sci U S A. 107 (44), 18979-18984 (2010).</li><li>Impagliazzo, A., Milder, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stable+trimeric+influenza+hemagglutinin+stem+as+a+broadly+protective+immunogen.">A stable trimeric influenza hemagglutinin stem as a broadly protective immunogen.</a> Science. 349 (6254), 1301-1306 (2015).</li><li>Krammer, F., Palese, P., Steel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Universal+Influenza+Virus+Vaccine+Design+and+Antibody+Mediated+Therapies+Based+on+Conserved+Regions+of+the+Hemagglutinin.">Advances in Universal Influenza Virus Vaccine Design and Antibody Mediated Therapies Based on Conserved Regions of the Hemagglutinin.</a> Current Topics in Microbiology and Immunology. , (2014).</li><li>Wohlbold, T. J., Nachbagauer, R., Margine, I., Tan, G. S., Hirsh, A., Krammer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaccination+with+soluble+headless+hemagglutinin+protects+mice+from+challenge+with+divergent+influenza+viruses.">Vaccination with soluble headless hemagglutinin protects mice from challenge with divergent influenza viruses.</a> Vaccine. 33 (29), 3314-3321 (2015).</li><li>Ekiert, D. C., Bhabha, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibody+recognition+of+a+highly+conserved+influenza+virus+epitope.">Antibody recognition of a highly conserved influenza virus epitope.</a> Science. 324 (5924), 246-251 (2009).</li><li>Ekiert, D. C., Friesen, R. H. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Highly+Conserved+Neutralizing+Epitope+on+Group+2+Influenza+A+Viruses.">A Highly Conserved Neutralizing Epitope on Group 2 Influenza A Viruses.</a> Science. 333 (6044), 843-850 (2011).</li><li>Dreyfus, C., Laursen, N. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+Conserved+Protective+Epitopes+on+Influenza+B+Viruses.">Highly Conserved Protective Epitopes on Influenza B Viruses.</a> Science. 337 (6100), 1343-1348 (2012).</li><li>Tran, E. E. H., Podolsky, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryo-electron+Microscopy+Structures+of+Chimeric+Hemagglutinin+Displayed+on+a+Universal+Influenza+Vaccine+Candidate.">Cryo-electron Microscopy Structures of Chimeric Hemagglutinin Displayed on a Universal Influenza Vaccine Candidate.</a> mBio. 7 (2), e00257 (2016).</li><li>Wiley, D. C., Wilson, I. A., Skehel, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+identification+of+the+antibody-binding+sites+of+Hong+Kong+influenza+haemagglutinin+and+their+involvement+in+antigenic+variation.">Structural identification of the antibody-binding sites of Hong Kong influenza haemagglutinin and their involvement in antigenic variation.</a> Nature. 289 (5796), 373-378 (1981).</li><li>Gerhard, W., Yewdell, J., Frankel, M. E., Webster, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigenic+structure+of+influenza+virus+haemagglutinin+defined+by+hybridoma+antibodies.">Antigenic structure of influenza virus haemagglutinin defined by hybridoma antibodies.</a> Nature. 290 (5808), 713-717 (1981).</li><li>Jackson, D. C., Murray, J. M., White, D. O., Gerhard, W. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enumeration+of+antigenic+sites+of+influenza+virus+hemagglutinin.">Enumeration of antigenic sites of influenza virus hemagglutinin.</a> Infect Immun. 37 (3), 912-918 (1982).</li><li>Matsuzaki, Y., Sugawara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epitope+Mapping+of+the+Hemagglutinin+Molecule+of+A/(H1N1)pdm09+Influenza+Virus+by+Using+Monoclonal+Antibody+Escape+Mutants.">Epitope Mapping of the Hemagglutinin Molecule of A/(H1N1)pdm09 Influenza Virus by Using Monoclonal Antibody Escape Mutants.</a> J Virol. 88 (21), 12364-12373 (2014).</li><li>Tan, G. S., Krammer, F., Eggink, D., Kongchanagul, A., Moran, T. M., Palese, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+pan-H1+anti-hemagglutinin+monoclonal+antibody+with+potent+broad-spectrum+efficacy+in+vivo.">A pan-H1 anti-hemagglutinin monoclonal antibody with potent broad-spectrum efficacy in vivo.</a> J Virol. 86 (11), 6179-6188 (2012).</li><li>Geneva: World Health Organization. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> WHO manual on animal influenza diagnosis and surveillance. , (2002).</li><li>Brauer, R., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influenza+Virus+Propagation+in+Embryonated+Chicken+Eggs.">Influenza Virus Propagation in Embryonated Chicken Eggs.</a> J Vis Exp. (97), e52421 (2015).</li><li>Mart&#237;nez-Sobrido, L., Garc&#237;a-Sastre, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Recombinant+Influenza+Virus+from+Plasmid+DNA.">Generation of Recombinant Influenza Virus from Plasmid DNA.</a> J Vis Exp. (42), e2057 (2010).</li><li>Hoffmann, E., Stech, J., Guan, Y., Webster, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+primer+set+for+the+full-length+amplification+of+all+influenza+A+viruses.">Universal primer set for the full-length amplification of all influenza A viruses.</a> ArchVirol. 146 (12), 2275-2289 (2001).</li><li>Zhou, B., Lin, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+Influenza+B+Virus+Genomic+Amplification+Facilitates+Sequencing,+Diagnostics,+and+Reverse+Genetics.">Universal Influenza B Virus Genomic Amplification Facilitates Sequencing, Diagnostics, and Reverse Genetics.</a> J Clin Microbiol. 52 (5), 1330-1337 (2014).</li><li>Sidhu, S. S., Kossiakoff, A. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+and+designing+protein+function+with+restricted+diversity.">Exploring and designing protein function with restricted diversity.</a> Curr Opin Chem Biol. 11, 347-354 (2007).</li><li>Chen, C. -. W., Chang, C. -. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peptide+Scanning-assisted+Identification+of+a+Monoclonal+Antibody-recognized+Linear+B-cell+Epitope.">Peptide Scanning-assisted Identification of a Monoclonal Antibody-recognized Linear B-cell Epitope.</a> J Vis Exp. (121), e55417 (2017).</li></ol>

Os autores declaram não há conflitos de interesse.

Apesar da maioria dos resíduos identificados através de mutantes de fuga foram precisa, dentre as principais ressalvas desta abordagem é que mutações pontuais de variantes de fuga não pode necessariamente mapear dentro a pegada molecular do anticorpo conforme determinado pelo análises estruturais. Isto é devido a capacidade de uma mutação em um determinado resíduo de conduzir a uma mudança conformacional distal para o local do resíduo mutado, análogo a um efeito alostérico. Outra limitação é que esta metodologia somente pode ser implementada para neutralizar os anticorpos; anticorpos que faltam em vitro pressão seletiva não conduzirá para escapar de mutantes. No entanto, esta limitação pode ser superada com o uso de um painel de variantes de fuga gerada por anticorpos neutralizantes anteriormente caracterizados. Tan et al usou uma variante de fuga de um neutralizante mAb ao vírus da H7N9 para mapear o epítopo de um anticorpo não neutralizante7.
No entanto, elucidar os epítopos de anticorpos através da geração de variantes de fuga fornece uma alternativa viável para microscopia cristalografia e cryo-elétron, os quais exigem um investimento extensivo de equipamento. Outras alternativas são determinar a região de ligação mínima de mAbs usando alanina digitalização ou peptídeo digitalização/truncamento mutantes. Alanina mutagênese de digitalização pode exigir uma quantidade significativa de trabalho na geração de um grande número de variantes durante triagem29, enquanto o peptídeo varredura é limitado a epítopos lineares30. O método descrito neste protocolo não requer nenhum equipamento especial ou técnica, e na verdade, faz uso dos existentes em vitro neutralização ensaios modificados para gerar variantes de fuga dos anticorpos de interesse.
O protocolo para gerar variantes de fuga que exigem várias passagens (por exemplo, os anticorpos específicos do caule) é altamente dependente da concentração inicial de anticorpo na passagem 0. É melhor pecar por precaução e comece um log para metade de um tronco inferior da metade máxima concentração inibitória de um anticorpo e permitir o crescimento robusto de vírus. O pesquisador pode-se especular que uma cultura de vírus de alta concentração na presença de baixa pressão imunológica vai ter uma grande variação genética na população viral. Variantes de fuga podem ser selecionadas para, gradualmente, aumentando a concentração de anticorpos nas passagens seguintes. No caso em que o crescimento do vírus diminui, a quantidade de sobrenadante viral pode ser aumentada na próxima passagem, mantendo a mesma quantidade de concentração de anticorpos na passagem anterior.
O objetivo da maioria das vacinas contra a gripe universal é eliciar uma resposta de anticorpo robusta em relação à região do caule do HA. As análises das variantes de fuga para os anticorpos específicos do caule são importantes para definir a relação entre aptidão de vírus de gripe e pressão imunológica. Curiosamente, vírus mutante de fuga resultante de mAbs específicos do caule foram todos atenuada na vivo em murino LD50 estudos4. Estes estudos fornecem um caso forte para plataformas de vacinação baseada no caule. Além disso, este protocolo pode ser usado para identificar mutantes de fuga para outros compostos antivirais, tais como inibidores de pequenas moléculas. Finalmente, esta metodologia não está limitada a glicoproteínas de superfície do vírus da gripe, mas também pode ser aplicada mais amplamente para determinar os epítopos de outras glicoproteínas virais.

Semelhante a outros vírus de RNA, os vírus da gripe possuam uma polimerase propenso que permite a geração de uma infinidade de variantes antigênicas com cada rodada de replicação1,2,3. A um vírus de gripe tem uma surpreendente capacidade de se adaptar e evadir a resposta imune humana através de deriva antigênica, que é conseguida através de uma acumulação de mutações sobre as glicoproteínas de superfície que leva à perda da ligação de anticorpos. Deriva antigênica das glicoproteínas de superfície virais, HA e neuraminidase (NA), exige a necessidade de reformular e administrar a vacina anualmente.
Os avanços tecnológicos no isolamento e geração de anticorpos antígeno-específicos têm rendido um número elevado de mAbs induzida pela vacina4,5,6,7,8. Por sua vez, a caracterização dos epítopos de mAbs que amplamente neutralizar os vírus da gripe muito tem auxiliado o desenvolvimento de vários universal gripe vacina candidatos9,10,11, 12,13,14. Elucidar a pegada antigênica de um mAb revela os determinantes estruturais da neutralização e permite uma abordagem informada para projeto de vacina. No entanto, não é realista nem rentável para os laboratórios caracterizar estruturalmente extensos painéis de mAbs através de cristalografia de raios x ou crio-microscopia para mapear epítopos do antígeno viral15, 16 , 17 , 18.
Cristalografia de raios x ou microscopia cryo-elétron requer equipamento caro, técnicas especializadas e, potencialmente, uma extensa quantidade de tempo para gerar os dados. Uma abordagem alternativa e mais rápida é utilizando a geração rápida de diversas populações virais através o propenso RNA-dependente do RNA polimerase para gerar mutantes de fuga para determinar os epítopos de mAbs19,20, 21,22,23. A geração de variantes de fuga não requer nenhum equipamento especial ou técnica e pode ser executada com equipamentos e reagentes de laboratório convencional.
Aqui, descrevemos um método que permite o mapeamento dos resíduos críticos necessários para ligação do mAb que reconhecem a gripe HA.

<table border="0" cellpadding="0" cellspacing="0" width="1159">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear flat bottom TC-treated culture microplate with Lid</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353072</td>
			<td style="width:429px;">Assay plate use for the microneutralization assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Falcon 96-well clear V-bottom plate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353263</td>
			<td>Assay plate use for the hemagglutination inhibition assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">1X Minimal Essential Medium (MEM)</td>
			<td style="width:197px;">Gibco</td>
			<td align="right" style="width:119px;">11095080</td>
			<td>Infection medium</td>
		</tr>
		<tr height="26">
			<td height="26" style="height:26px;">Tosyl phenylalanyl chloromethyl (TPCK)-treated trypsin</td>
			<td>Sigma-Aldrich</td>
			<td style="width:119px;">T8802</td>
			<td>Cleaves immature HA0 to HA1 and HA2</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IAV)</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">MAB8258B</td>
			<td>An antibody that recognizes the NP protein of influenza A viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Biotinylated anti-NP primary antibody (IBV)</td>
			<td style="width:197px;">EMD Millipore</td>
			<td style="width:119px;">MAB8260B-5</td>
			<td>An antibody that recognizes the NP protein of influenza B viruses</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Streptavidin-HRP antibody</td>
			<td>EMD Millipore</td>
			<td style="width:119px;">18-152</td>
			<td>This is used as a secondary antibody for the biotinylated anti-NP antibody</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">HRP substrate (SIGMAFAST-OPD)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">P9187-5SET</td>
			<td>o-phenylenediamine dihydrochloride water soluble substrate for HRP</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">96-well V-bottom plate</td>
			<td style="width:197px;">Nunc</td>
			<td align="right" style="width:119px;">249662</td>
			<td>Assay plate used for the hemagglutination assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Chicken red blood cells</td>
			<td>Lampire Biological Laboratories</td>
			<td align="right" style="width:119px;">7201403</td>
			<td>Used to assess the ability of influenza virus to agglutinate</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">TRIzol</td>
			<td style="width:197px;">Ambion</td>
			<td align="right" style="width:119px;">15596026</td>
			<td>Extraction of RNA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Superscript III</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">12574018</td>
			<td>Reverse transcriptase</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Gel Extraction Kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Isolation of amplified PCR product</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Lipofectamine 2000</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">11668027</td>
			<td>Transfection reagent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-human IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11013</td>
			<td>Fluorescent secondary antibody for human antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Anti-mouse IgG (H+L) Alexa Fluor 488</td>
			<td style="width:197px;">Invitrogen</td>
			<td style="width:119px;">A-11001</td>
			<td>Fluorescent secondary antibody for murine antibodies</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">6-well polystyrene microplate</td>
			<td style="width:197px;">Corning, Inc.</td>
			<td align="right" style="width:119px;">353934</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">UltraPure Agarose</td>
			<td style="width:197px;">Invitrogen</td>
			<td align="right" style="width:119px;">16500500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Nalgene long term storage Cryo-tubes</td>
			<td style="width:197px;">ThermoFisher Scientific</td>
			<td style="width:119px;">5012-0020</td>
			<td>Freezing of viral culture supernatant</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/California/04/09 (H1)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/California/04/09 (H1N1) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">reassortant A/Shanghai/1/13 (H7)</td>
			<td style="width:197px;">Palese Laboratory</td>
			<td style="width:119px;"></td>
			<td>reassortant virus expressing the HA and NA of A/Shanghai/1/13 (H7N9) with the internal segments of A/Puerto Rico/8/34 (H1N1)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Bovine serum albumin solution (35%)</td>
			<td style="width:197px;">Sigma-Aldrich</td>
			<td style="width:119px;">A7979</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:415px;">Qiagen gel extration kit</td>
			<td style="width:197px;">Qiagen</td>
			<td align="right" style="width:119px;">28704</td>
			<td>Silica-membrane-based purification of DNA fragments</td>
		</tr>
	</tbody>
</table>

generation of escape variants of neutralizing influenza virus monoclonal antibodies

Vírus da gripe apresentam uma notável capacidade de se adaptar e evitar a resposta imune do hospedeiro. Uma maneira é através de mudanças antigênicas que ocorrem sobre as glicoproteínas de superfície do vírus. A geração de variantes de fuga é um método poderoso em elucidar como vírus escapar à detecção imunológica e na identificação de resíduos críticos necessários para a ligação de anticorpos. Aqui, descrevemos um protocolo sobre como gerar variantes de fuga do vírus da influenza A, utilizando humanos ou murino anticorpos monoclonais (mAbs) dirigido contra a hemaglutinina viral (HA). Com o uso de nossa técnica, nós anteriormente caracterizados resíduos críticos necessários para a ligação de anticorpos como alvo a cabeça ou caule do romance aviária H7N9 HA. O protocolo pode ser facilmente adaptado para outros sistemas de vírus. Análises de variantes de fuga são importantes para a modelagem de deriva antigênica, determinação de polimorfismos de nucleotídeo único (SNPs) conferindo resistência e aptidão de vírus e no projeto de vacinas e/ou terapêutica.

Temos anteriormente usado variações desse método para gerar variantes de fuga de mAbs humana e murino induzida pela vacina de vírus da gripe sazonal, H7N9 vacinação ou sequencial HA de recombinação de DNA/proteína vacinação4,5 ,6,7. Conforme descrito acima, anticorpos foram caracterizados primeiro usando os ensaios HI e microneutralization a fim de informar-nos de qual protocolo específico para continuar com a próxima4,5. Anticorpos 07-5D 03, 5F01-07, 07-5G 01, 4B03-07, 07-4E02 e 07-4D 05 foram encontrados para ter atividades HI e neutralização contra o vírus aviário do H7N9 (A/Shanghai/1/2013) (tabela 1), e, portanto, foi utilizado o protocolo 1 (passo 2.1). Para Celia com neutralizar essa falta de atividade de HI, tais como 41-5E04, 045-051310-2B06, 042-100809-2F04 e S6-B01 (tabela 1), protocolo 2 (passo 2.2) foi usado para gerar variantes de fuga. Fuga mutante mapeamento revelou que muitos dos anticorpos reconhecem críticos resíduos em locais distintos no viral HA4,5 (Figura 4). Enquanto a maioria dos anticorpos HI-positivo tem escape mutantes resíduos perto relatados anteriormente sítios antigênicos do H7 HA, os anticorpos de HI-negativo gerado fuga os mutantes com mutações pontuais no talo região4,5 .
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Anticorpo</td>
			<td>Oi atividade</td>
			<td>Atividade NEUT</td>
		</tr>
		<tr>
			<td>07-5D 03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5F01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-5G 01</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4B03</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4E02</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>07-4D 05</td>
			<td>+</td>
			<td>+</td>
		</tr>
		<tr>
			<td>41-5E04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>045-051310-2B06</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>042-100809-2F04</td>
			<td>-</td>
			<td>+</td>
		</tr>
		<tr>
			<td>S6-B01</td>
			<td>-</td>
			<td>+</td>
		</tr>
	</tbody>
</table>
Tabela 1: Tabela de atividade de anticorpo HI e neutralização. Dez mAbs de H7-específicas isoladas de indivíduos vacinados com a vacina experimental contra H7N9 prova diferentes em vitro atividades antiviral5.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td colspan="4">Primer para a frente (5' para 3')</td>
			<td colspan="4">Reverter o Primer (5' para 3')</td>
			<td colspan="2">Condições de Thermocylcer</td>
		</tr>
		<tr>
			<td>IAV</td>
			<td colspan="4">TATTCGTCTCAGGGAGCAAAAGCAGGGG</td>
			<td colspan="4">ATATCGTCTCGTATTAGTAGAAACAAGGGTGTTTT</td>
			<td colspan="2">42 ° c por 60 min, 94 ° c por 2 min/5 ciclos de 94 ° c por 20 s, 50 ° c por 30 s e 68 ° c por 3 min 30 s, seguida de 40 ciclos de 94 ° c por 20 s, 58 ° c por 30 s e 68 º c por 3 min 30 s, com um tempo de extensão final a 68 ° c por 10 min</td>
		</tr>
		<tr>
			<td>IBV</td>
			<td colspan="4">GGGGGGAGCAGAAGCAGAGC</td>
			<td colspan="4">CCGGGTTATTAGTAGTAACAAGAGC</td>
			<td colspan="2">45 ° c para 55 ° c por 30 min, 60 min, 94 ° c por 2 min/5 ciclos de 94 ° c por 20 s, 40 º c por 30 s e 68 ° c por 3 min 30 s, seguida de 40 ciclos de 94 ° c por 20 s , 58 º c por 30 s e 68 ° c por 3 min 30 s, com um tempo de extensão final a 68 ° c por 10 min</td>
		</tr>
	</tbody>
</table>
Tabela 2: primeiras demão de vírus de gripe Universal. Pares da primeira demão para a amplificação dos segmentos HA de gripe A27 e vírus de28 B e seus respectivos thermocycler condições.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56067/56067fig1.jpg"> 
Figura 1: ensaio de HI. (A), A planta para a criação de um ensaio HI testar a atividade de dois rato específico H1 mAbs 7B2 (cabeça-específico) e 6F12 (talo-específico) usando uma placa de V-fundo de 96 poços e (B) um exemplo dos resultados de um ensaio de HI23. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56067/56067fig2.jpg"> 
Figura 2: ensaio de Microneutralization. Um esquema de configuração de um ensaio de microneutralization testar a atividade de dois humanos mAbs 4 055 e CR911417. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56067/56067fig3.jpg"> 
Figura 3: geração de mutantes fuga. A metodologia sugerida será dependente do HI e a atividade de microneutralization exibido pelo anticorpo. A geração de mutantes de fuga contra (A) anticorpos neutralizantes HI-positivo podem exigir uma única passagem em ovos, enquanto anticorpos neutralizantes de HI-negativo (B) podem envolver várias passagens com o aumento da quantidade de anticorpo em cultura do tecido celular. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56067/56067fig4.jpg"> 
Figura 4: um exemplo de um mapa de epítopo do romance aviária H7N9 HA gerado com variantes mutantes fuga. Induzida pela vacina anticorpos isolaram de indivíduos vacinados com um candidato gripe H7N9 uma vacina foram usados para gerar variantes mutantes de fuga. Cada resíduo indicado em vermelha representa a localização do críticos aminoácidos necessários para uma ligação eficiente de um mAb. Dados foram adaptados de Dunand-Henry et al, 20154. <a href="//ecsource.jove.com/files/ftp_upload/56067/56067fig4large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a>

Watch this Scientific Journal Video about Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies at JoVE.com

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Nós descrevemos um método pelo qual podemos identificar resíduos críticos necessários para a ligação de anticorpos monoclonais humanos ou murino que se destinam a hemaglutinina viral do vírus da influenza A. O protocolo pode ser adaptado para outras glicoproteínas de superfície do vírus e suas correspondentes anticorpos neutralizantes.

Geração de variantes de fuga de neutralizar os anticorpos monoclonais de vírus da gripe

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

Geração de recombinante do vírus Influenza de DNA plasmidial

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Imunologia e Infecção

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

Isolamento de variantes de vírus de RNA Fidelity e Caracterização de frequência de mutação de vírus

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

High-throughput Detection Method for Influenza Virus

Alta capacidade método de detecção de vírus Influenza

Influenza virus is a respiratory pathogen that causes a high degree of morbidity and mortality every year in multiple parts of the world. Therefore, ...

Influenza Virus Propagation in Embryonated Chicken Eggs

Propagação do vírus Influenza em ovos de galinha embrionados

Influenza infection is associated with about 36,000 deaths and more than 200,000 hospitalizations every year in the United States. The continuous ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Geração de IgG Humana Recombinante de Anticorpos Monoclonais As células seleccionadas a partir de B imortalizadas

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Geração de anticorpos monoclonais murinos pelo hibridoma Tecnologia

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Influenza A Virus Studies in a Mouse Model of Infection

Estudos do Vírus Influenza A em um Modelo de Infecção de Camundongos

Influenza viruses cause over 500,000 deaths worldwide1 and are associated with an annual cost of 12 - 14 billion USD in the United States alone ...

Measuring Influenza Neutralizing Antibody Responses to A(H3N2) Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Measuring Influenza Neutralizing Antibody Responses to AH3N2 Viruses in Human Sera by Microneutralization Assays Using MDCK-SIAT1 Cells

Medição da gripe neutralizando Antibody Responses to A(H3N2) vírus em soros humanos por Microneutralization ensaios usando as células MDCK-SIAT1

Neutralizing antibodies against hemagglutinin (HA) of influenza viruses are considered the main immune mechanism that correlates with protection for ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Geração dos anticorpos monoclonais humanos discriminativa de rara B antígeno-específicas células circulantes no sangue

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Generation of Monoclonal Antibodies Against Natural Products

Geração de anticorpos monoclonais contra produtos naturais

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...