Name: use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae
Uploaded: 2017-10-06T13:00:00
Description: Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

המחברים לאשר תמיכה כספית מן המחקר הלאומי מפתח תוכנית הפיתוח של סין (2016YFC1200500 אל שיאו-גואנג חן), את נבחרת מדעי הטבע קרן של סין (81672054 ו- 81371846), התכנית צוות המחקר של הטבעי קרן המדע של גואנג-דונג (2014A030312016), התכנית המדעית והטכנולוגית של גואנגג'ואו (201508020263). אנו להכיר בהכרת תודה פרופסור ג'ונתן קרלסון (קולורדו סטייט) עבור מתבקשים לספק את פלסמידים ןלמה ו- p7NS1-GFP, אנושות קריאת כתב היד הזה.

כל הפרוטוקולים אושרו על-ידי אתי הוועדה של דרום רפואי האוניברסיטה.
 1. עיצוב אינטרון מלאכותי של הערה: אינטרון מלאכותי המשמש בעבודה זו הוא 65 bp ב אורך, ואודות הרצף הוא 5 &#39; - GTAAGAGTCGATCGACGCGTTACTAACTGGTACCTCTTCTTTTTTTTTTGATATCCTGCAG - 3 &#39;.
<ol><li>מקום Hpa אני הגבלה באתר בשני קצוות אינטרו...

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current problems in pediatric and adolescent health care. 39, 97-140 (2009).</li><li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> The New England journal of medicine. 374, 1552-1563 (2016).</li><li>Roberts, D. R., Andre, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insecticide+resistance+issues+in+vector-borne+disease+control.">Insecticide resistance issues in vector-borne disease control.</a> The American journal of tropical medicine and hygiene. 50, 21-34 (1994).</li><li>Attaran, A., Roberts, D. R., Curtis, C. F., Kilama, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+risks+on+the+backs+of+the+poor.">Balancing risks on the backs of the poor.</a> Nature medicine. 6, 729-731 (2000).</li><li>Volohonsky, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+Expression+of+the+Anti-parasitic+Factor+TEP1+in+the+Malaria+Mosquito+Anopheles+gambiae.">Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.</a> PLoS pathogens. 13, 1006113 (2017).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature communications. 5, 3977 (2014).</li><li>Bourtzis, K., Lees, R. S., Hendrichs, J., Vreysen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+one+rabbit+out+of+the+hat:+Radiation,+transgenic+and+symbiont-based+approaches+for+sustainable+management+of+mosquito+and+tsetse+fly+populations.">More than one rabbit out of the hat: Radiation, transgenic and symbiont-based approaches for sustainable management of mosquito and tsetse fly populations.</a> Acta tropica. 157, 115-130 (2016).</li><li>Kumar, S. S., Puttaraju, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvised+microinjection+technique+for+mosquito+vectors.">Improvised microinjection technique for mosquito vectors.</a> The Indian journal of medical research. 136, 971-978 (2012).</li><li>Attardo, G. M., Higgs, S., Klingler, K. A., Vanlandingham, D. L., Raikhel, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+knockdown+of+a+GATA+factor+reveals+a+link+to+anautogeny+in+the+mosquito+Aedes+aegypti.">RNA interference-mediated knockdown of a GATA factor reveals a link to anautogeny in the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 100, 13374-13379 (2003).</li><li>Singh, A. D., Wong, S., Ryan, C. P., Whyard, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+delivery+of+double-stranded+RNA+in+larvae+of+the+yellow+fever+mosquito,+Aedes+aegypti:+implications+for+pest+mosquito+control.">Oral delivery of double-stranded RNA in larvae of the yellow fever mosquito, Aedes aegypti: implications for pest mosquito control.</a> Journal of insect science. 13, 69 (2013).</li><li>Ward, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aedes+aegypti+transducing+densovirus+pathogenesis+and+expression+in+Aedes+aegypti+and+Anopheles+gambiae+larvae.">Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae.</a> Insect molecular biology. 10, 397-405 (2001).</li><li>Carlson, J., Suchman, E., Buchatsky, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densoviruses+for+control+and+genetic+manipulation+of+mosquitoes.">Densoviruses for control and genetic manipulation of mosquitoes.</a> Advances in virus research. 68, 361-392 (2006).</li><li>Barreau, C., Jousset, F. X., Bergoin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+of+the+Aedes+albopictus+parvovirus+(AaPV),+a+denso-like+virus,+for+Aedes+aegypti+mosquitoes.">Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes.</a> Journal of invertebrate pathology. 68, 299-309 (1996).</li><li>Liu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+non-defective+recombinant+densovirus+vectors+for+microRNA+delivery+in+the+invasive+vector+mosquito,+Aedes+albopictus.">Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus.</a> Scientific reports. 6, 20979 (2016).</li><li>Ortega, M. M., Bouamar, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+on+Designing+MicroRNA+Sponges:+From+Construction+to+Stable+Cell+Line.">Guidelines on Designing MicroRNA Sponges: From Construction to Stable Cell Line.</a> Methods in molecular biology. 1509, 221-233 (2017).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> Journal of visualized experiments : JoVE. , e253 (2007).</li><li>Afanasiev, B. N., Kozlov, Y. V., Carlson, J. O., Beaty, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+of+Aedes+aegypti+as+an+expression+vector+in+mosquito+cells.">Densovirus of Aedes aegypti as an expression vector in mosquito cells.</a> Experimental parasitology. 79, 322-339 (1994).</li><li>Hu, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+the+human-specific+microRNA+miR-941.">Evolution of the human-specific microRNA miR-941.</a> Nature communications. 3, 1145 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74, 5463-5467 (1977).</li><li>Dalby, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advanced+transfection+with+Lipofectamine+2000+reagent:+primary+neurons,+siRNA,+and+high-throughput+applications.">Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications.</a> Methods (San Diego, Calif). 33, 95-103 (2004).</li><li>Gu, J. B., Dong, Y. Q., Peng, H. J., Chen, X. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+AeDNA+containing+the+insect-specific+toxin,+BmK+IT1,+displayed+an+increasing+pathogenicity+on+Aedes+albopictus.">A recombinant AeDNA containing the insect-specific toxin, BmK IT1, displayed an increasing pathogenicity on Aedes albopictus.</a> The American journal of tropical medicine and hygiene. 83, 614-623 (2010).</li><li>Hou, Y., Zhang, H., Miranda, L., Lin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serious+overestimation+in+quantitative+PCR+by+circular+(supercoiled)+plasmid+standard:+microalgal+pcna+as+the+model+gene.">Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene.</a> PloS one. 5, 9545 (2010).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+rAAV9+to+Overexpress+or+Knockdown+Genes+in+Mouse+Hearts.">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.</a> Journal of visualized experiments : JoVE. , (2016).</li></ol>

חשוב להתגבר על שני המחסומים מפתח המגבילות בנייה rAaeDV. הראשון הוא הייצור של וירוס רקומביננטי פגומה. בעבר דווח כי MDV יכול לשמש וקטור לבטא כראוי בגודל גנים זרים, כגון עקרב חרקים ייחודיות neurotoxins20 החלבון GFP; עם זאת, משנה האסטרטגיה הבנייה, ברגע ORFs של MDV נוספו או מוחלף גנים אקסוגני, virions לא יכול ליצור ?...

בעקיצות יתוש מחלות כמו מלריה, קדחת דנגי, קדחת zika, קדחת צהובה, הן בעיות בריאות הציבור הבינלאומיים הגדולים ימשיך להביא בחשבון חלק משמעותי של מחלה זיהומית העולמי נטל1,2. חומרי הדברה קונבנציונאליים, אשר שימשו בתגובה וקטורים, הם מרכיב מרכזי של קיימא יתושים משולבת אסטרטגיה הבקרה למניעת מחלות בעקיצות יתוש. עם זאת, אסטרטגיות מעין אלו הוכיחו להיות יחסית לא יעילה או לא רצוי בשל את המשויך השפעות סביבתיות שליליות, כמו גם את האבולוציה של עמידות נגד יתושים אוכלוסיות3,4. מסיבות אלו, יש צורך דחוף שיטות אלטרנטיביות של יתוש שליטה, וכן השימוש בשיטות הטרנסגניים לייצר יתושים זכרים מעוקרים, שחרורו של יתושים פתוגן עמיד שהתעוררו כמו אסטרטגיות שליטה חדש מבטיח. לפתח אפקטיבי חדש לשלוט בשיטות, כגון גישות בטוח ויעיל עבור ויוו המסירה הגן, ניתוח מקיף של יתוש ג'ין פונקציה זו נדרשת.
Microinjection ישירה של פלסמיד ה-DNA, כפול תקועים RNA (dsRNA) או RNA קטנים מפריעות (siRNA) היא הנפוצה ביותר ויוו ג'ין משלוח השיטה יתושים. למעשה, ייצור הטרנסגניים זנים של יתושים עדיין מסתמכים על תהליך של העובר microinjection5,6,7. עם זאת, microinjection יש מספר מגבלות. ראשית, טכניקה זו הוא תובעני מבחינה טכנית, כרוך פרוצדורות מסובכות. שנית, הזרקת גורם של עלבון פיזית אל העובר, הזחלים, גלמים, מבוגר, אשר משפיע ישירות על הכדאיות של האורגניזם היעד. שלישית, קשה לשתק רימות היתוש עבור microinjection כי רוב לגור גידול מימיים והינם בעלי מאפיין נזחל התנועה. רביעית, בגודל של 1סנט-2nd לחלל הזחלים היא 10 - עד 20 פי קטן יותר מזה של 4th לחלל הזחלים בוגרים, ואת את ציפורנייך של לשעבר הם עדינים יותר. תכונות אלה מקשות לתמרן 1סנט-2nd לחלל הזחלים בהשוואה לאלו בשלבים בוגרים. משולב, גורמים אלה תורמים סיכויי הישרדות שלאחר הזרקת מופחת עבור הזחלים (כ- 5%) לעומת מבוגרים8. מערכות מבוססות ויראלי משלוח פותחו כדי להתגבר על המחסומים חוץ-תאית, תאיים הקשורים. המערכות הללו יש את היתרונות של טיפול קל, יעילות גבוהה התמרה חושית, לטווח ארוך וחזק רמות ביטוי ביכולתה לייצר תופעות מתמשכות ויוו. לכן, ג'ין מערכות אספקה ניצול רטרווירוסים, lentiviruses ו- adenoviruses היה נרחב בשימוש שורות תאים inmammalian ומינים מודל. מערכת ביטוי ויראלי Sindbis היה בשימוש בעבר כדי לנתח את פונקציית ג'ין היתוש למבוגרים; מלבד החשש אבטחה, הזרקת זאת, עדיין תהליך הכרחי עבור זיהום ויראלי9. אמנם, משלוח אוראלי למסמס את הזחלים בפתרון dsRNA דווחה בעבר שיטת משלוח ריאלי, זה מתאים ניתוח פונקציה RNA קטנים10. אז, יש עדיין לפתח שיטות משלוח ויראלי יעיל ליתושים.
יתוש densoviruses (MDVs) הם חלק תת משפחה Densovirinae Parvoviridae, ונפילתה, כולם בתוך הסוג של Brevidensovirus11. MDV virions שאינו אפוף הינם מורכבים של גנום חד גדילי הדנ א (ssDNA), של capsid icosahedral (20 ננומטר בקוטר). הגנום הנגיפי משוכפל בתוך הגרעינים של התאים המארחים והיא בגודל של-4 kb. MDVs יציבים יחסית בסביבת ולהציג מגוון מארח צר עם ירידה לפרטים גבוה ליתושים. וירוסים אלה יש פוטנציאל התפשטה, מתעקש באופן טבעי אוכלוסיות יתוש, יכול לפלוש כמעט כל איברים ורקמות של חרקים אלה, לרבות פיתול, Malpighian בקוריאנית, שומן הגוף, מערכת השרירים, נוירונים, בלוטות הרוק12.
הגנום MDV שלם יכול להיות subcloned לתוך פלסמיד וקטורים לייצר שיבוטים זיהומיות המבוסס על פלסמיד; כאשר שיבוטים אלה מועברים לתאים יתושים, הגנום הנגיפי מופק מן הווקטור פלסמיד, נגיפים זיהומיות מיוצרים. מכיוון MDV יש גנום קטן ssDNA, שיבוטים זיהומיות נבנות בקלות וניתן הגנום הנגיפי בקלות בעורמה11,13. מאפיינים אלה להפוך MDV סוכן יקר לבחינת ביולוגיה נגד יתושים. עם זאת, כי כמעט את כל רצף הגנום הנגיפי חיונית עבור הפצה ויראלית, היצירה של וירוס רקומביננטי באמצעות החלפת או החדרת גנים זרים גורמת הפסד יכולות אריזה ו/או שכפול ויראלי, אשר יוצר מכשול להתפתחות של MDVs כמו ג'ין משלוח וקטורים. במסמך זה, אנחנו מדווחים באמצעות אסטרטגיית מלאכותי ביטוי קטן-RNA intronic לפתח מפורמטת rAaeDV ויוו RNA משלוח מערכת בעלת היתרונות של בנייה קלה פלסמיד ותחזוקה של וירוס פונקציונלי יכול לייצר ביטוי ארוכות טווח ויציבה בתאי המארח ללא צורך פראי-סוג וירוס. בנוסף, שיטה זו מאפשרת התמרה חושית קל של הזחלים.
הפרוטוקולים עבור השלבים הבאים מתוארים במחקר זה: שורה 1) העיצוב של rAaeDVs קידוד של קלטת ביטוי קטן-RNA intronic, 2) לייצור חלקיקי וירוס רקומביננטי שימוש בתא C6/36 אריזה, 3) ניתוח כמותי של התא-חופשית הגנום rAaeDV להעתיק מספרים ו- 4) זיהום של Ae. albopictus הזחלים על ידי ישיר החדרת וירוס לתוך הגוף מים של הגידול הזחל. בסך הכל, עבודה זו הוכיחה כי RNAs קטן מסוים או גנים היעד שניתן overexpressed או הפיל ב הזחלים יתושים באמצעות מערכת מפותחת של משלוח MDV.

<table width="901">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="24">
			<td height="24" style="width:401px;height:24px;">Centrifuge machine</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">75004260</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Centrifuge System</td>
			<td style="width:215px;">Beckman Coulter</td>
			<td style="width:119px;">363118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">GeneJET Gel Extraction Kit</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">K0691</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">E.Z.N.A. Plasmid Midi Kit</td>
			<td style="width:215px;">Omega Biotech</td>
			<td style="width:119px;">D6904</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Purified Agar</td>
			<td style="width:215px;">OXOID</td>
			<td style="width:119px;">LP0028A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastAP Thermosensitive Alkaline Phosphatase (1 U/&#181;L)</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">EF0651</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastDigest HpaI</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">FD1034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastDigest XbaI</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">FD0684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">T4 DNA Ligase (5 U/&#181;L)</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">EL0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">TransStbl3 Chemically Competent Cell</td>
			<td style="width:215px;">Beijing Transgen Biotech</td>
			<td style="width:119px;">CD521-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Ampicillin&#160;</td>
			<td style="width:215px;">Beijing Tiangen Biotech</td>
			<td style="width:119px;">RT501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Roswell Park Memorial Institute (RPMI) 1640 medium</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">&#160;21875109</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Fetal Bovine Serum&#65288; Australia Origin&#65289;</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">10099141</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">penicillin/streptomycin</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">15070063</td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="width:401px;height:23px;">Lipofectamine 2000 Transfection Reagent</td>
			<td style="width:215px;">&#160;Invitrogen&#65292;Life Technologies</td>
			<td style="width:119px;">11668019</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Proteinase K</td>
			<td style="width:215px;">Promega</td>
			<td>MC5008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">DNase I (RNase-free)</td>
			<td style="width:215px;">&#160;Invitrogen&#65292;Life Technologies</td>
			<td style="width:119px;">AM2222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">SuperReal PreMix Plus (SYBR Green)</td>
			<td style="width:215px;">Beijing Tiangen Biotech</td>
			<td style="width:119px;">FP205</td>
			<td></td>
		</tr>
	</tbody>
</table>

use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae

Microinjection in vivo הוא הטכניקה העברת גנים הנפוצות ביותר לניתוח הפונקציות ג'ין יתושים בודדים. אולם, שיטה זו דורשת יותר טכנית בדרישה מבצע, כרוך פרוצדורות מסובכות, במיוחד כשמשתמשים בהם הזחלים שלהם גודל קטן, יחסית דק ושברירי לציפורן וכתוצאה תמותה גבוהה, אשר להגביל היישום שלה. לעומת זאת, וקטורים ויראלי למסירה גן פותחו כדי להתגבר על המחסומים חוץ-תאית, תאיים. המערכות הללו יש את היתרונות של טיפול קל, ג'ין גבוה התמרה חושית יעילות, תחזוקה לטווח הארוך של ביטוי גנים, את היכולת לייצר תופעות מתמשכות ויוו. יתוש densoviruses (MDVs) הם וירוסים דנ א חד גדילי ספציפי נגד יתושים, קטנים שיכולים לספק ביעילות חומצות גרעין זר לתוך תאים יתושים; עם זאת, החלפת או החדרת גנים זרים כדי ליצור וירוסים רקומביננטי בדרך כלל גורמת לאובדן יכולות אריזה ו/או שכפול, המהווה מחסום לפיתוח של וירוסים אלה כמו משלוח וקטורים.
במסמך זה, מדווחים באמצעות אסטרטגיית מלאכותי ביטוי קטן-RNA intronic לפתח חלבון תקינה densovirus (AaeDV) Aedes aegypti ויוו מערכת המשלוח. מתוארים הליכים מפורטים עבור בנייה, אריזה אנליזה כמותית של הווקטורים rAaeDV, זיהום זחל.
מחקר זה מדגים, בפעם הראשונה, את הכדאיות של פיתוח מפורמטת רקומביננטי MDV מיקרו RNA (miRNA) ביטוי מערכת, ובכך לספק כלי רב עוצמה לניתוח פונקציונלי של גנים יתושים ואת הקמת בסיס יישום של נגיפי paratransgenesis לפיקוח על מחלות בעקיצות יתוש. הפגנו כי אדס 1סנט לחלל הזחלים יכול להיות בקלות וביעילות נגוע על ידי החדרת הנגיף לגוף מים הזחלים רבייה אתר, כי rAaeDVs מפותחת יכול לשמש overexpress או להפיל ביטוי של גנים יעד ספציפיות של הזחלים, מתן כלי לניתוח פונקציונלי של יתוש גנים.

אסטרטגיות לבנייה rAaeDV וקטור rAaeDV פגומים נוצר כדי לבטא את הגן DsRed ב רימות היתוש. פלסמיד וכתוצאה מכך הכיל קלטת חלבון NS1-DsRed פיוז'ן עם החלבון סמנכ ל שנמחקו (איור 1א'). פלסמידים rAaeDV המכיל ביטוי בונה עבור miRNA, miRNA ספוג, shRNA, amiRNA עוצבו (ראה ...

Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

שימוש Densovirus יתוש רקומביננטי כמו וקטור משלוח ג'ין לניתוח פונקציונלי של גנים רימות היתוש

. מדווחים באמצעות מלאכותיים intronic קטן RNA ביטוי אסטרטגיית לפתח חלבון תקינה densovirus (AaeDV) Aedes aegypti ויוו מערכת המשלוח. הליך מפורט עבור בנייה, אריזה, ניתוח כמותי של וקטורים rAaeDV כמו גם כ נגוע זחל מתואר.

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method ...

Research

JoVE Journal

Developmental Biology

Differentiation of a Human Neural Stem Cell Line on Three Dimensional Cultures, Analysis of MicroRNA and Putative Target Genes

בידול של קו תאי גזע עצבי אדם בשלוש תרבויות ממדים, גני ניתוח של MicroRNA והמשוער יעד

Neural stem cells (NSCs) are capable of self-renewal and differentiation into neurons, astrocytes and oligodendrocytes under specific local ...

Mosaic Zebrafish Transgenesis for Functional Genomic Analysis of Candidate Cooperative Genes in Tumor Pathogenesis

פסיפס דג הזברה Transgenesis לניתוח הגנום פונקציונלי של גנים שיתופיים מועמד בפתוגנזה גידול

Comprehensive genomic analysis has uncovered surprisingly large numbers of genetic alterations in various types of cancers.  To robustly and efficiently ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

לכידת תיקון רקמות דג הזברה זחלים עם הזמן לשגות Brightfield stereomicroscopy

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

ניתוח של יושרה שריר שלד דג הזברה זחלים עם אוונס הכחול צבע

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

שיטות לבדיקת בלוטת לימפה hemocytes ב<em&gt; תסיסנית</em&gt; זחלים

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize ...

Rapid Isolation of BMPR-IB+ Adipose-Derived Stromal Cells for Use in a Calvarial Defect Healing Model

בידוד מהיר של BMPR-IB + השומן שמקורם בתאי סטרומה לשימוש במודל ריפוי פגם calvarial

Invasive cancers, major injuries, and infection can cause bone defects that are too large to be reconstructed with preexisting bone from the patient's own ...

Hypoxic Preconditioning of Marrow-derived Progenitor Cells As a Source for the Generation of Mature Schwann Cells

Hypoxic Preonditioning של תאים יליד מארו נגזר כמקור לדור של תאים שוואן בוגרת

This manuscript describes a means to enrich for neural progenitors from the marrow stromal cell (MSC) population and thereafter to direct them to the ...

A Method for Characterizing Embryogenesis in Arabidopsis

A Method for Characterizing Embryogenesis in Arabidopsis

שיטת אפיון מופרה ב תודרנית

Given the highly predictable nature of their development, Arabidopsis embryos have been used as a model for studies of morphogenesis in plants. However, ...

A Novel Use of Three-dimensional High-frequency Ultrasonography for Early Pregnancy Characterization in the Mouse

שימוש הרומן של בדיקת אולטרה סאונד בתדירות גבוהה תלת מימדי אפיון בתחילת ההריון העכבר

High-frequency ultrasonography (HFUS) is a common method to non-invasively monitor the real-time development of the human fetus in utero. The mouse is ...

Generation of Scaffold-free, Three-dimensional Insulin Expressing Pancreatoids from Mouse Pancreatic Progenitors In Vitro

Generation of Scaffold-free, Three-dimensional Insulin Expressing Pancreatoids from Mouse Pancreatic Progenitors In Vitro

דור של אינסולין נטולת לגרדום, תלת מימדי לבטא Pancreatoids העכבר אבות הלבלב במבחנה

The pancreas is a complex organ composed of many different cell types that work together to regulate blood glucose homeostasis and digestion. These cell ...