Name: use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae
Uploaded: 2017-10-06T13:00:00
Description: Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

Yazarlar Ulusal anahtar araştırma ve geliştirme programı Çin mali desteği kabul için Xiao-Guang Chen (2016YFC1200500), Ulusal Doğa Bilimleri Vakfı Çin (81672054 ve 81371846), araştırma ekibi programı doğal Guangdong (2014A030312016) temeli bilim ve bilimsel ve teknolojik programı Guangzhou (201508020263). Minnetle Profesör Jonathan Carlson (Colorado State University) lütfen çekim ve p7NS1-GFP plazmidleri sağlamak için ve eleştirel okuma bu el yazması için anıyoruz.

tüm iletişim kuralları Etik Komitesi, Southern Tıp Üniversitesi tarafından kabul edildi.
 1. yapay bir Intron tasarımı Not: Bu çalışmada kullanılan yapay intron 65 model uzunluğu ve sırası kan basıncı olan 5 &#39; - GTAAGAGTCGATCGACGCGTTACTAACTGGTACCTCTTCTTTTTTTTTTGATATCCTGCAG - 3 &#39;.
<ol><li>Hpa koyun ben kısıtlama site yapay intron her iki ucundaki Yani o Hpa ben sindirim intron plazmid (bkz: şekil...

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current problems in pediatric and adolescent health care. 39, 97-140 (2009).</li><li>Petersen, L. R., Jamieson, D. J., Powers, A. M., Honein, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zika+Virus.">Zika Virus.</a> The New England journal of medicine. 374, 1552-1563 (2016).</li><li>Roberts, D. R., Andre, R. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insecticide+resistance+issues+in+vector-borne+disease+control.">Insecticide resistance issues in vector-borne disease control.</a> The American journal of tropical medicine and hygiene. 50, 21-34 (1994).</li><li>Attaran, A., Roberts, D. R., Curtis, C. F., Kilama, W. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+risks+on+the+backs+of+the+poor.">Balancing risks on the backs of the poor.</a> Nature medicine. 6, 729-731 (2000).</li><li>Volohonsky, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenic+Expression+of+the+Anti-parasitic+Factor+TEP1+in+the+Malaria+Mosquito+Anopheles+gambiae.">Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae.</a> PLoS pathogens. 13, 1006113 (2017).</li><li>Galizi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+sex+ratio+distortion+system+for+the+control+of+the+human+malaria+mosquito.">A synthetic sex ratio distortion system for the control of the human malaria mosquito.</a> Nature communications. 5, 3977 (2014).</li><li>Bourtzis, K., Lees, R. S., Hendrichs, J., Vreysen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+one+rabbit+out+of+the+hat:+Radiation,+transgenic+and+symbiont-based+approaches+for+sustainable+management+of+mosquito+and+tsetse+fly+populations.">More than one rabbit out of the hat: Radiation, transgenic and symbiont-based approaches for sustainable management of mosquito and tsetse fly populations.</a> Acta tropica. 157, 115-130 (2016).</li><li>Kumar, S. S., Puttaraju, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvised+microinjection+technique+for+mosquito+vectors.">Improvised microinjection technique for mosquito vectors.</a> The Indian journal of medical research. 136, 971-978 (2012).</li><li>Attardo, G. M., Higgs, S., Klingler, K. A., Vanlandingham, D. L., Raikhel, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+knockdown+of+a+GATA+factor+reveals+a+link+to+anautogeny+in+the+mosquito+Aedes+aegypti.">RNA interference-mediated knockdown of a GATA factor reveals a link to anautogeny in the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 100, 13374-13379 (2003).</li><li>Singh, A. D., Wong, S., Ryan, C. P., Whyard, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+delivery+of+double-stranded+RNA+in+larvae+of+the+yellow+fever+mosquito,+Aedes+aegypti:+implications+for+pest+mosquito+control.">Oral delivery of double-stranded RNA in larvae of the yellow fever mosquito, Aedes aegypti: implications for pest mosquito control.</a> Journal of insect science. 13, 69 (2013).</li><li>Ward, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aedes+aegypti+transducing+densovirus+pathogenesis+and+expression+in+Aedes+aegypti+and+Anopheles+gambiae+larvae.">Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae.</a> Insect molecular biology. 10, 397-405 (2001).</li><li>Carlson, J., Suchman, E., Buchatsky, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densoviruses+for+control+and+genetic+manipulation+of+mosquitoes.">Densoviruses for control and genetic manipulation of mosquitoes.</a> Advances in virus research. 68, 361-392 (2006).</li><li>Barreau, C., Jousset, F. X., Bergoin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenicity+of+the+Aedes+albopictus+parvovirus+(AaPV),+a+denso-like+virus,+for+Aedes+aegypti+mosquitoes.">Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes.</a> Journal of invertebrate pathology. 68, 299-309 (1996).</li><li>Liu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+non-defective+recombinant+densovirus+vectors+for+microRNA+delivery+in+the+invasive+vector+mosquito,+Aedes+albopictus.">Development of non-defective recombinant densovirus vectors for microRNA delivery in the invasive vector mosquito, Aedes albopictus.</a> Scientific reports. 6, 20979 (2016).</li><li>Ortega, M. M., Bouamar, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guidelines+on+Designing+MicroRNA+Sponges:+From+Construction+to+Stable+Cell+Line.">Guidelines on Designing MicroRNA Sponges: From Construction to Stable Cell Line.</a> Methods in molecular biology. 1509, 221-233 (2017).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli+using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli using the heat shock method.</a> Journal of visualized experiments : JoVE. , e253 (2007).</li><li>Afanasiev, B. N., Kozlov, Y. V., Carlson, J. O., Beaty, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Densovirus+of+Aedes+aegypti+as+an+expression+vector+in+mosquito+cells.">Densovirus of Aedes aegypti as an expression vector in mosquito cells.</a> Experimental parasitology. 79, 322-339 (1994).</li><li>Hu, H. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+the+human-specific+microRNA+miR-941.">Evolution of the human-specific microRNA miR-941.</a> Nature communications. 3, 1145 (2012).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proceedings of the National Academy of Sciences of the United States of America. 74, 5463-5467 (1977).</li><li>Dalby, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advanced+transfection+with+Lipofectamine+2000+reagent:+primary+neurons,+siRNA,+and+high-throughput+applications.">Advanced transfection with Lipofectamine 2000 reagent: primary neurons, siRNA, and high-throughput applications.</a> Methods (San Diego, Calif). 33, 95-103 (2004).</li><li>Gu, J. B., Dong, Y. Q., Peng, H. J., Chen, X. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+recombinant+AeDNA+containing+the+insect-specific+toxin,+BmK+IT1,+displayed+an+increasing+pathogenicity+on+Aedes+albopictus.">A recombinant AeDNA containing the insect-specific toxin, BmK IT1, displayed an increasing pathogenicity on Aedes albopictus.</a> The American journal of tropical medicine and hygiene. 83, 614-623 (2010).</li><li>Hou, Y., Zhang, H., Miranda, L., Lin, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serious+overestimation+in+quantitative+PCR+by+circular+(supercoiled)+plasmid+standard:+microalgal+pcna+as+the+model+gene.">Serious overestimation in quantitative PCR by circular (supercoiled) plasmid standard: microalgal pcna as the model gene.</a> PloS one. 5, 9545 (2010).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+rAAV9+to+Overexpress+or+Knockdown+Genes+in+Mouse+Hearts.">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts.</a> Journal of visualized experiments : JoVE. , (2016).</li></ol>

İki rAaeDV inşaat sınırlamak önemli engelleri aşmak önemlidir. İlk arızalı rekombinant virüs yapımıdır. Bu uygun bir şekilde ifade etmek için bir vektör Akrep böcek özgü neurotoxins20 ve GFP protein gibi yabancı genlerin boyutlu gibi MDV kullanılabilir bildirilmiştir; MDV ORFs eklenen veya değiştirilen eksojen genler ile bir kez yardımcı plazmid eksik vazgeçilmez viral proteinler sağlamak için cotransfected sürece ancak, inşaat strateji ne olursa olsun, virions bağımsız olarak oluşamı...

Sivrisinek yoluyla bulaşan hastalıklar gibi sıtma, Dang Humması, zika ateş ve sarı humma, küresel bulaşıcı hastalık yükü1,2önemli bir kısmı için hesap devam başlıca uluslararası halk sağlığı sorunları vardır. Yanıt vektörel çizimler olarak kullanılmıştır, geleneksel böcek sivrisinek yoluyla bulaşan hastalıkların önlenmesi için sürdürülebilir entegre sivrisinek denetimi stratejisi önemli bir bileşeni vardır. Ancak, bu stratejileri nispeten etkisiz veya ilişkili olumsuz çevresel etkilerin yanı sıra sivrisinek nüfus3,4direnç gelişimi nedeniyle istenmeyen olduğu kanıtlanmıştır. Bu nedenle, denetim ve steril erkek sivrisinekler üretmek için transgenik yöntemleri sivrisinek alternatif yöntemler için acil bir ihtiyaç olduğunu ve patojen dayanıklı sivrisinekler sürümü umut verici yeni kontrol stratejileri ortaya çıktığı. Geliştirmek için etkili yeni kontrol yöntemleri, gibi güvenli ve etkili yaklaşımlar içinde vivo gen teslim, sivrisinek gen işlevi kapsamlı analiz için gerekli.
Plazmid DNA, çift doğrudan mikroenjeksiyon RNA (dsRNA) telli veya küçük müdahale RNA (siRNA) en sık kullanılan vivo içinde gen teslim sivrisinekler yöntemidir. Aslında, sivrisinekler transgenik suşları üretimi hala embriyo mikroenjeksiyon5,6,7göreve güvenmek. Ancak, mikroenjeksiyon bazı sınırlamaları vardır. İlk olarak, bu teknik teknik olarak talep ediyor ve karmaşık prosedürler içerir. İkinci olarak, enjeksiyon embriyo, larva, Pupa ve yetişkin, hedef organizmanın canlılığı doğrudan etkileyen fiziksel bir hakaret neden olur. Üçüncü olarak, çünkü çoğu bir su ortamında yaşıyor ve hareket kıvranma karakteristik sahip sivrisinek larva mikroenjeksiyon için immobilize etmek zordur. Dördüncü olarak, 1st-2nd INSTAR larva boyutunu daha küçük 4th bundan daha hassas biçim ve büyük larva ve cuticles eski 10 - için 20 - kat. Bu özellikler 1st-2nd INSTAR larva bu büyük aşamaları ile karşılaştırıldığında işlemek zorlaştırır. Birlikte, bu faktörlerin bir düşük sonrası enjeksiyon sağkalım oranı yetişkin8' e göre larva (yaklaşık % 5) için katkıda bulunur. Viral tabanlı dağıtım sistemleri ilgili ekstraselüler ve hücre içi önündeki engelleri aşmak için geliştirilmiştir. Bu sistemlerin avantajları kolayca idare, yüksek iletim verimliliği, uzun vadeli ve sağlam düzeyleri ifade ve kalıcı etkileri in vivoüretmek için yeteneği var. Bu nedenle, gen teslim Retrovirüsler, lentiviruses ve adenovirüse bakın sistemleri yaygın olmuştur inmammalian hücre satırları ve modeli tür kullanılır. Sindbis viral ifade sistem daha önce yetişkin sivrisinek gen işlevinde analiz etmek için kullanılmıştı; Biyogüvenlik endişeleri yanı sıra, ancak, enjeksiyon hala viral enfeksiyon9için gerekli bir süreç olduğunu. Her ne kadar larva dsRNA çözümünde iliklerine tarafından sözlü teslim daha önce uygun Teslimat yöntemi olarak bildirilmiştir, küçük RNA işlev analiz10için uygun değildir. Yani, etkili viral teslim yöntemleri hala sivrisinekler için geliştirilmelidir.
Sivrisinek densoviruses (MDVs) Densovirinae alt Parvoviridaeve biri dışında tüm sonbahar Brevidensovirus11cins içinde yer almaktadır. MDV virions sigara saran ve tek iplikçikli DNA (ssDNA) genom ve icosahedral bir kapsid oluşur (20 nm çapında). Viral genom yaklaşık 4 KB içinde büyüklük ve konak hücre çekirdeği içinde çoğaltılır. MDVs ortamında nispeten istikrarlı ve sivrisinekler için yüksek özgüllük ile dar ana bilgisayar aralığını gösterir. Bu virüs yaymak ve doğal olarak sivrisinek nüfus devam potansiyeline sahip ve hemen hemen tüm organ ve dokulara midgut, Malpighi tübüllerin, yağ vücut, kas, sinir hücreleri ve tükürük bezleri12de dahil olmak üzere bu böceklerin istila edebilir.
Sağlam MDV genleri plazmid vektörel çizimler bulaşıcı klonlar plazmid tabanlı üretmek için subcloned; Bu klonlar sivrisinek hücrelere teslim edildiğinde, viral genom plazmid öğesinden elde edilir ve bulaşıcı viral parçacıkların üretilmektedir. MDV küçük ssDNA genom olduğundan, bulaşıcı klonlar kolayca inşa edilir ve viral genom kolay elde edilebilir11,13olabilir. Bu özellikleri MDV sivrisinek Biyoloji incelenmesi için değerli bir ajan olun. Neredeyse tüm viral genom dizisinin viral yayılması için gerekli olduğundan, ancak, rekombinant virüs-den geçerek yedek oluşturma veya ekleme yabancı genlerin viral yeteneklerine, ambalaj ve/veya çoğaltma oluşturur kaybolmasına neden olur bir bariyer MDVs kalkınma olarak gen teslim vektörel çizimler. Burada, biz kolay plazmid inşaat avantajları ve üretebilir işlevsel bir virüs bakım olan bir arızalı olmayan rAaeDV vivo içinde RNA teslim sistemi geliştirmek için bir yapay intronic küçük-RNA ifade strateji kullanarak raporu konak hücreleri vahşi-tipi virüs gerek kalmadan istikrarlı ve uzun vadeli ifade. Ayrıca, bu yöntem larva kolay iletim için sağlar.
Bu çalışmada iletişim kuralları için aşağıdaki adımları açıklanmıştır: 1) rAaeDVs bir intronic küçük-RNA ifade kaset, 2) üretim rekombinant virüs partikülleri C6/36 ambalaj hücre kullanarak kodlama tasarımını satır, boş hücre, kantitatif analiz 3) rAaeDV genom kopya numaraları ve 4) Ae. albopictus larva tarafından virüs doğrudan giriş larva Habitat su vücuda bir enfeksiyon. Genel olarak, bu eser belirli küçük RNA'ların veya hedef genlerin olabilir overexpressed veya gelişmiş MDV dağıtım sistemini kullanarak sivrisinek larva içinde yere serdi olduğunu gösterdi.

<table width="901">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="24">
			<td height="24" style="width:401px;height:24px;">Centrifuge machine</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">75004260</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Centrifuge System</td>
			<td style="width:215px;">Beckman Coulter</td>
			<td style="width:119px;">363118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">GeneJET Gel Extraction Kit</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">K0691</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">E.Z.N.A. Plasmid Midi Kit</td>
			<td style="width:215px;">Omega Biotech</td>
			<td style="width:119px;">D6904</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Purified Agar</td>
			<td style="width:215px;">OXOID</td>
			<td style="width:119px;">LP0028A</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastAP Thermosensitive Alkaline Phosphatase (1 U/&#181;L)</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">EF0651</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastDigest HpaI</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">FD1034</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">FastDigest XbaI</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">FD0684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">T4 DNA Ligase (5 U/&#181;L)</td>
			<td style="width:215px;">Thermo Scientific</td>
			<td style="width:119px;">EL0011</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">TransStbl3 Chemically Competent Cell</td>
			<td style="width:215px;">Beijing Transgen Biotech</td>
			<td style="width:119px;">CD521-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Ampicillin&#160;</td>
			<td style="width:215px;">Beijing Tiangen Biotech</td>
			<td style="width:119px;">RT501</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Roswell Park Memorial Institute (RPMI) 1640 medium</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">&#160;21875109</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Fetal Bovine Serum&#65288; Australia Origin&#65289;</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">10099141</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">penicillin/streptomycin</td>
			<td style="width:215px;">Gibco&#65292; Life Technologies</td>
			<td style="width:119px;">15070063</td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="width:401px;height:23px;">Lipofectamine 2000 Transfection Reagent</td>
			<td style="width:215px;">&#160;Invitrogen&#65292;Life Technologies</td>
			<td style="width:119px;">11668019</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">Proteinase K</td>
			<td style="width:215px;">Promega</td>
			<td>MC5008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">DNase I (RNase-free)</td>
			<td style="width:215px;">&#160;Invitrogen&#65292;Life Technologies</td>
			<td style="width:119px;">AM2222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="width:401px;height:21px;">SuperReal PreMix Plus (SYBR Green)</td>
			<td style="width:215px;">Beijing Tiangen Biotech</td>
			<td style="width:119px;">FP205</td>
			<td></td>
		</tr>
	</tbody>
</table>

use of a recombinant mosquito densovirus as a gene delivery vector for the functional analysis of genes in mosquito larvae

Vivo mikroenjeksiyon bireysel sivrisinekler gen işlevlerinde analiz etmek için en sık kullanılan gen transferi tekniği var. Ancak, bu yöntem teknik olarak işlem talep daha fazla gerektirir ve karmaşık prosedürler, özellikle onların küçük büyüklük, nispeten ince ve kırılgan manikür ve yüksek mortalite, uygulama sınırı nedeniyle larva kullanıldığında içerir. Buna ek olarak, viral vektörler gen teslim için hücre içi ve hücre dışı engelleri aşmak için geliştirilmiştir. Bu sistemlerin avantajları kolayca idare, yüksek gen iletim verimlilik, uzun vadeli bakım gen ekspresyonu ve kalıcı etkileri in vivoüretmek için yeteneği var. Sivrisinek densoviruses (MDVs) yabancı nükleik asitler sivrisinek hücrelere etkin bir şekilde sunabilir, sivrisinek özel, küçük tek iplikçikli DNA virüsler vardır; Ancak, değiştirme veya ekleme rekombinant virüsler genellikle oluşturmak için yabancı genlerin bu virüsler geliştirme olarak teslim vektörel çizimler için bir engel olan ambalaj ve/veya çoğaltma yeteneklerini kaybolmasına neden olur.
Burada, bir kusurlu rekombinant Aedes aegypti densovirus (AaeDV) vivo iletim sistemi geliştirmek için bir yapay intronic küçük-RNA ifade strateji kullanarak rapor. İnşaat, ambalaj ve kantitatif analiz rAaeDV vektörlerin ve larva enfeksiyon için ayrıntılı yordamlar açıklanmıştır.
Bu çalışmada gösterilmiştir, ilk kez, bir kusurlu rekombinant MDV Mikro RNA (miRNA) ifade sistem, geliştirmek ve böylece sivrisinek genlerin fonksiyonel analiz için güçlü bir araç sağlayarak ve için bir temel kurulması fizibilite Sivrisinek kaynaklı hastalıklar kontrol etmek için viral paratransgenesis uygulanması. Biz Aedes albopictus 1st INSTAR larva kolay ve etkili virüs sitesi ıslahı larva su vücuda getirerek enfekte olabilir ki ve gelişmiş rAaeDVs overexpress veya yıkmak için kullanılan olabilir gösterdi larvalar, genler sivrisinek fonksiyonel analiz için bir araç sağlayan bir belirli hedef geni ifadesidir.

RAaeDV inşaat için stratejiler Arızalı rAaeDV vektör sivrisinek larva DsRed gen ifade etmek için oluşturuldu. Elde edilen plazmid NS1-DsRed füzyon protein kaset VP protein (şekil 1A) silinmiş yer. miRNA için ifade yapıları içeren rAaeDV plazmid miRNA sünger, shRNA ve amiRNA ( şekil 1Bgösterildiği) tasarlanmıştır. Örneğin, bir rAaeDV vektör aal-let-7 siv...

Watch this Scientific Journal Video about Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae at JoVE.com

Use of a Recombinant Mosquito Densovirus As a Gene Delivery Vector for the Functional Analysis of Genes in Mosquito Larvae

Sivrisinek larva genlerin fonksiyonel analiz için bir gen teslim vektör olarak rekombinant sivrisinek Densovirus kullanın

Arızalı rekombinant Aedes aegypti densovirus (AaeDV) vivo iletim sistemi geliştirmek için yapay bir intronic küçük RNA ifade strateji kullanarak rapor. İnşaat, ambalaj ve larva enfeksiyon gelince de rAaeDV vektörlerin kantitatif analiz için detaylı bir yordam açıklanır.

In vivo microinjection is the most commonly used gene transfer technique for analyzing the gene functions in individual mosquitoes. However, this method ...

Research

JoVE Journal

Developmental Biology

Differentiation of a Human Neural Stem Cell Line on Three Dimensional Cultures, Analysis of MicroRNA and Putative Target Genes

Üç Boyutlu Kültürleri, mıkroRNA Analizi ve Putatif Hedef Genler üzerinde bir İnsan Sinir Kök Hücre Hattı Farklılaşma

Neural stem cells (NSCs) are capable of self-renewal and differentiation into neurons, astrocytes and oligodendrocytes under specific local ...

Mosaic Zebrafish Transgenesis for Functional Genomic Analysis of Candidate Cooperative Genes in Tumor Pathogenesis

Tümör Patogenezinde Aday Kooperatif Genlerin Fonksiyonel Genomik Analizi Mozaik Zebra balığı Transgenesis

Comprehensive genomic analysis has uncovered surprisingly large numbers of genetic alterations in various types of cancers.  To robustly and efficiently ...

Capturing Tissue Repair in Zebrafish Larvae with Time-lapse Brightfield Stereomicroscopy

Time-lapse aydınlık stereomikroskobi ile Zebra balığı Larva Doku Onarım yakalama

The zebrafish larval tail fin is ideal for studying tissue regeneration due to the simple architecture of the larval fin-fold, which comprises of two ...

Analysis of Zebrafish Larvae Skeletal Muscle Integrity with Evans Blue Dye

Evans Blue Dye ile Zebra balığı Larva İskelet Kası Bütünlüğü Analizi

The zebrafish model is an emerging system for the study of neuromuscular disorders.  In the study of neuromuscular diseases, the integrity of the muscle ...

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Yöntemler Lenf Bezi ve Hemocytes içinde incelemek için<em&gt; Drosophila</em&gt; Larva

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize ...

Rapid Isolation of BMPR-IB+ Adipose-Derived Stromal Cells for Use in a Calvarial Defect Healing Model

BMPR-IB + hızlı İzolasyon Kalvaryum Hata Şifa Modeli Kullanılan Stromal Hücreleri yağ kaynaklı

Invasive cancers, major injuries, and infection can cause bone defects that are too large to be reconstructed with preexisting bone from the patient's own ...

Hypoxic Preconditioning of Marrow-derived Progenitor Cells As a Source for the Generation of Mature Schwann Cells

Olgun Schwann Hücrelerinin Üretimi İçin Bir Kaynak Olarak Kemik İçi Türe Göre Progenitör Hücrelerin Hipoksik Ön Koşullandırma

This manuscript describes a means to enrich for neural progenitors from the marrow stromal cell (MSC) population and thereafter to direct them to the ...

A Method for Characterizing Embryogenesis in Arabidopsis

A Method for Characterizing Embryogenesis in Arabidopsis

Embriyogenez Arabidopsis olarak karakterize bir yöntem

Given the highly predictable nature of their development, Arabidopsis embryos have been used as a model for studies of morphogenesis in plants. However, ...

A Novel Use of Three-dimensional High-frequency Ultrasonography for Early Pregnancy Characterization in the Mouse

Üç boyutlu yüksek frekanslı Ultrasonografi romanı kullanımı için fare erken gebelik karakterizasyonu

High-frequency ultrasonography (HFUS) is a common method to non-invasively monitor the real-time development of the human fetus in utero. The mouse is ...

Generation of Scaffold-free, Three-dimensional Insulin Expressing Pancreatoids from Mouse Pancreatic Progenitors In Vitro

Generation of Scaffold-free, Three-dimensional Insulin Expressing Pancreatoids from Mouse Pancreatic Progenitors In Vitro

İskele-free, üç boyutlu insülin ifade Pancreatoids fare pankreas ataları Vitro gelen nesil

The pancreas is a complex organ composed of many different cell types that work together to regulate blood glucose homeostasis and digestion. These cell ...