Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

هذا العمل أيده بالزراعة والأغذية البحوث مبادرة تنافسية منحة رقم 2011-68003-30395 من وزارة الزراعة في الولايات المتحدة، والمعهد الوطني للأغذية والزراعة من خلال مشروع نوروكوري. تم توفير التمويل للوصول المفتوح المسؤول "وزارة الزراعة في الولايات المتحدة". ونود أن أشكر روبرت اتمار (كلية طب بايلور، هيوستن، تكساس) يرجى تزويدنا كابسيدس المنقي وفاليري أفام لمساعدتها مع الصور ال. ونود أيضا أن أشكر فرانك أ. باري لمساعدتنا على بدء التجارب التي عرضت.

1. المستندة إلى لوحة "الفحص ملزمة" "تقييم الخسائر من أعلى ترتيب نوروفيروس قفيصه هيكل" ملاحظة: بروتوكول العزة مشابهة جداً لتلك المقدمة هنا قد نشرت 29، وفحوصات العزة مماثلة أفيد سابقا كجزء من بحوث المواد في أماكن أخرى 17 ، ، من 18</sup...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

البروتوكول والأساليب الموصوفة هنا يوفر وسيلة لتقييم نوروفيروس البشرية قفيصه السلامة/وظيفة. هذه الأساليب يمكن استخدامها للحصول على آليا إلى التبصر في آثار المعالجات المنظمة ضد الفيروس، ويمكن أن تكمل يحتمل أن تكون أساليب تقييم المنظمة أكثر تقليدية مثل المقايسة RT-قبكر أو اللوحة. على سبيل ا...

نوروفيروس البشرية المسؤولة عن عبئا كبيرا في مجال صحة العامة على الصعيد العالمي، تسبب الأمراض حوالي 685 مليون و 212,000 حالة وفاة سنوياً1، بتكلفة تقدر بمليارات الدولارات2،3في. واليوم، نوروفيروس الكشف والتحديد الكمي ينطوي التضخيم الجينوم و/أو الأنظمة الأساسية المستندة إلى يجند. الأول المفضل عموما كما أكثر حساسية، ويوفر المعلومات الكمية، وقد خطر أقل عموما من النتائج الإيجابية الكاذبة4. الأكثر شيوعاً نوروفيروس الكشف والتحديد الكمي الجينوم التضخيم هو التقنية المنتسخة العكسية الكمية تفاعل البوليميراز المتسلسل (RT-قبكر). لأنه يستهدف ويسهب شريحة صغيرة من الجينوم البشري نوروفيروس، الرايت-qPCR وحدها ليست قادرة على التمييز بين المعدية والجسيمات غير المعدية، كالجيش الملكي النيبالي الجينوم مجاناً، تضررت كابسيدس التي تحتوي على الجينوم، وكابسيدس مع قاتلة يمكن أن لا تزال تضخيم جينومات المتحولة باقتطاع من الرايت qPCR. بينما سجلت مؤخرا اثنين في المختبر زراعة تقنيات جديدة للبشرية نوروفيروس5،6 ، على حد سواء لا تزال تعتمد على الرايت qPCR للفيروس الكمي وليست أساليب مجدية الروتينية السريرية والبيئة اختبار للبشرية نوروفيروسيس. وهكذا، يبقى RT qPCR المعيار الذهبي للتجارب السريرية والبيئة.
وقد وضعت أساليب أخرى في المختبر في محاولة لتقدير أفضل حالة العدوى من جسيمات نوروفيروس. ويمكن تصنيف هذه الأساليب عموما كتلك التي تتناول سلامة قفيصه نوروفيروس، والقائمين بتقييم سلامة الجينوم. النهج السابق أكثر شعبية. هو أسلوب استخداماً رناسي المعالجة المسبقة قبل استخراج الحمض النووي الريبي الجينوم الفيروسي، ولكن هذا لا يفسر الجسيمات الفيروسية، لا تزال سليمة ولكنها تفتقر إلى القدرة على ربط المضيف مستقبلات/co-العوامل، فضلا عن الجسيمات الفيروسية أن تحور قاتلة أو اقتطاع أو تلف هامشيا الجينوم7. سلامة قفيصه يمكن أيضا تقييم يستند إلى قدرة الفيروس على ربط نوروفيروس البشرية المشارك-ريسيبتور/co-العوامل التي هي الكربوهيدرات المعروفة باسم histo-الدم مجموعة مولدات المضادات (هبجاس). هبجاس موجودة في الخلايا الظهارية المعوية المضيف كجزء من جليكوبروتينس أو جليكوليبيدس (بين متعددة الأنسجة الأخرى) وقد يفرز في سوائل الجسم مثل اللعاب. قد أظهرت أيضا البكتيريا المعوية التي تحتوي على مواد مثل هبجا على الأسطح لربط نوروفيروس البشرية8،،من910، وقد تشجع مثل هذه التفاعلات نوروفيروس العدوى5. أن المفهوم الأساسي لاستخدام الربط هبجا أن قادرة على ملزمة المفترضة المستقبلات/المشارك-فكتور الفيروسية الجسيمات فقط ستكون قادرة على إصابة الخلايا. دراسات متعددة تشير إلى أن أساس حبة هبجا الملزمة السابقة لتضخيم الحمض النووي وسيلة واعدة للعدوى التمييز11،،من1213،14، ،من 1516. تحديا كبيرا فيما يتعلق هبجاس أن لا واحد من نوع هبجا يمكنك ربط جميع الأنماط الجينية البشرية نوروفيروس. لمعالجة هذا الوضع، قد استخدمت الميوسين المعدة الخنزير، الذي يحتوي على هبجاس، بدلاً من الكربوهيدرات هبجا المنقي حرصا على سهولة التوليف والاتساق، وخفض التكلفة.
منشور صدر مؤخرا من مور et al. 17 عرض مجموعة من التقنيات الجديدة لتقدير سلامة قفيصه نوروفيروس البشرية. بدلاً من هبجاس، مور et al. 17 التحقيق ملزم رد الفعل على نطاق واسع من الحمض النووي ابتمر (M6-2)18 و رد الفعل على نطاق واسع [مونوكلونل] جسم (NS14)19 إلى ردات كابسيدس نوروفيروس سيدني GII.4 (جسيمات شبيهة بالفيروس أو فلبس) ومقارنة هذا للربط إلى هبجاس الاصطناعية. الابتامرات الحمض النووي هي قصيرة (nt ~ 20-80) واحد الذين تقطعت بهم السبل الأحماض النووية (ssDNA أو الحمض النووي الريبي) إضعاف في هياكل ثلاثية الأبعاد فريدة من نوعها نتيجة تسلسلها وربط هدفا. بسبب وجود الأحماض النووية، فأقل تكلفة؛ كيميائيا بسهولة تصنيعه، النقي، وتم التعديل؛ ومستقرة للحرارة. توجد عدة تقارير عن الابتامرات ولدت ضد نوروفيروسيس، مع بعض منهم عرض تفاعلية واسعة لمجموعة متنوعة من السلالات18،20،،من2122. وعلى سبيل المثال، مور et al. 17 أظهرت أن ابتمر M6-2 منضم إلى نوروفيروس البشرية النقية، وتجميعها كابسيدس (فلبس)، وتصرفت على نحو مماثل إلى هبجا في الاعتماد على قفيصه الفيروسية للحفاظ على النظام (مثلاً، التعليم الثانوي والعالي) أعلى بروتين بنية ملزم تحدث. من ناحية أخرى، ظلت نسبة كبيرة من نوروفيروس عزام ملزمة لجسم NS14 بعد أن كانت كابسيدس التشويه والتحريف تماما. تقييم لربط نوروفيروس في دراسة مور et al. 17 تم استخدام طريقة بسيطة، والمستندة إلى لوحة شبيه أليسا، باستثناء أن الابتامرات تستخدم بدلاً من الأجسام المضادة (وبالتالي تم استدعاء الأسلوب العزة). تم استخدام هذا الأسلوب التجريبي إنتاجية عالية لتقييم آثار المعالجات المختلفة في قفيصه نوروفيروس، العمل الذي قيمة لفهم إليه المنظمة الفيروسية عند التعرض لعوامل الإجهاد الفيزيائية أو الكيميائية. ومع ذلك، هو عيب واحد إلى هذا الأسلوب أقل حساسية وعدم التسامح للملوثات المرتبطة بالمصفوفة في المستويات العليا التي تسبب غير محددة ملزمة الابتامرات.
مور et al. 17 استخدام أسلوب آخر، تناثر الضوء الحيوي (DLS)، لرصد تجميع الجزيئات الفيروسية في الاستجابة للمعالجة بالحرارة. يستخدم عادة لتقييم حجم تعليق نانوحبيبات DLS وامتد للبروتينات23،24 والفيروسات25،،من2627. كثافة الضوء المتناثرة من الجسيمات في حل يتقلب كدالة لحجم الجسيمات، مما يسمح لحساب معامل الانتشار، ومن ثم قطر الجسيمات باستخدام صيغ راسخة. يمكن التمييز بين تقنية DLS هيدرودينامية قطر الجسيمات المشتتة وصولاً إلى النانو، الذي يتيح الكشف عن الفيروسات مشتتة وبروتينات قفيصه الفردية أو dimers والمجاميع الفيروسات استناداً إلى حجم27. تجميع الفيروسات، تمثل زيادة في حجم الجسيمات، ويدل على فقدان سلامة قفيصه. كما قفيصه هو التشويه والتحريف وعطلت هيكلها، بقايا مسعور أصبح عرضه وتسبب الجسيمات عصا معا وتشكيل المجاميع. يمكن استخدام دائرة الأراضي والمساحة لقياس حجم الجسيمات بعد علاج محدد أو الحركية للتجميع في الوقت الحقيقي17،28. هذا الأسلوب له الميزة للسماح بمراقبة سلوك قفيصه في الحل ولكن يتطلب تركيزات عالية من قفيصه النقية، التي قد لا تكون ممثلة تماما للفيروس في حالته الطبيعية.
الأسلوب النهائي يستخدمها مور et al. وكان 17 مجهر إلكتروني (TEM). على الرغم من أن هذا الأسلوب يفتقر إلى الحساسية ولا تنتج بيانات كمية، فإنه يسمح لتصور آثار العلاجات المختلفة في هيكل قفيصه الفيروسية. على الرغم من أن ليست مثالية بعد لإعدادات السريرية والبيئة، استخدام هذه الأساليب في تركيبة قيمة في فهم المنظمة نوروفيروس البشرية. والغرض من هذه المقالة توفير بروتوكولات متعمقة مقايسة الربط القائم على لوحة (العزة)، دائرة الأراضي والمساحة، واستخدام أساليب إعداد تيم للتحقيق في آثار المعالجات الحرارية في قفيصه نوروفيروس في سياق الآثار العلاجات في قفيصه سلامة كما عرضت في مور et al. 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

نوروفيروس البشرية ينتزع قدرا كبيرا من الصحة العامة والخسائر الاقتصادية في جميع أنحاء العالم. الناشئة في المختبر السلف زراعة غير قابلة حتى الآن للكشف الروتيني للفيروس. كشف الحالية وتقنيات القياس الكمي، والتي تعتمد بالدرجة الأولى على تضخيم الحمض النووي، لا تميز المعدية من الجسيمات الفيروسية غير المعدية. والغرض من هذه المقالة أن يقدم تفاصيل محددة بشأن التقدم الذي أحرز مؤخرا في التقنيات المستخدمة معا بغية الحصول على المزيد من المعلومات بشأن حالة العدوى الفيروسية الجسيمات. أسلوب واحد ينطوي على تقييم ملزم ابتمر ssDNA نوروفيروس إلى كابسيدس. الابتامرات ميزة يجري تصنيعه وتعديلها بسهولة، وهي غير مكلفة ومستقرة. تقنية أخرى, ديناميكية تناثر الضوء (DLS)، له ميزة مراقبة السلوك قفيصه في الحل. المجهر الإلكتروني يسمح للتصور السلامة الهيكلية كابسيدس الفيروسية. على الرغم من الوعد، هناك بعض العيوب لكل تقنية، مثل ابتمر غير محددة ملزمة لجزيئات مشحونة بشكل إيجابي من مصفوفات عينة، واشتراط قفيصه المنقي لدائرة الأراضي والمساحة، وضعف الحساسية للمجهر الإلكتروني. ومع ذلك، عندما تستخدم هذه التقنيات مجتمعة، نص البيانات المنتجة يوفر معلومات شاملة أكثر على سلامة قفيصه نوروفيروس التي يمكن استخدامها للاستدلال على العدوى، المعلومات التي من الضروري إجراء تقييم دقيق أساليب المنظمة أو تفسير للكشف عن الفيروسات. توفر هذه المقالة البروتوكولات لاستخدام هذه الأساليب لتميز جزيئات نوروفيروس البشرية المعدية.

تم تقييم السلامة الهيكلية للبشرية نوروفيروس سيدني GII.4 كابسيدس (فلبس) باستخدام عدة أساليب الرواية كما قدمها مور et al. 17-أولاً، تم تجربة في التي كانت سلامة كابسيدس كدالة لقدرتها على ربط المفترضة مستقبلات/المشارك-فكتور (هبجا) أو ssDNA ابتمر (M6-2) مقارنة (<strong class="x...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

أساليب الكشف الروتيني استخدام الجينوم الفيروسي التضخيم مقيدة بعجزهم عن تميز المعدية من جسيمات غير معدية. والغرض من هذه المقالة توفير بروتوكولات مفصلة عن طرق بديلة للمساعدة على تمييز جزيئات نوروفيروس المعدية استخدام ابتمر ملزمة، وتشتت الضوء الديناميكي، ومجهر إلكتروني.

أساليب بديلة في المختبر لتحديد السلامة الهيكلية قفيصه الفيروسية

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

هيكل HIV - 1 بواسطة جمعيات قفيصة البرد المجهر الإلكتروني وتكرارية حلزوني الإعمار الحقيقي الفضاء

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

إرساء ثقافة السائل المغطاة من مجرى الهواء الإنسان المستقطب طلائي Calu-3 خلايا لدراسة استجابة الخلية المضيفة لمسببات الأمراض التنفسية<em&gt; في المختبر</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

مجموع استخراج بروتين و 2-D طرق جل الكهربائي ل<em&gt; بيركولديريا</em&gt; الأنواع

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

متوسط ​​الفيروسية مغلف جلايكوبروتين المسامير من الكترون Cryotomography إعادة بناء باستخدام Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

تحديد تركيز الفيروسي من خلال البلاك فحوصات: نظم تراكب عن طريق التقليدية والرواية

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

كشف الجليكوجين في خلايا الدم المحيطي وحيدات النوى مع الدوري حمض شيف تلطيخ

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

استخدام استراتيجية قفيصة التأسيس Antigen ل تطوير المناهج اتش المصلي 5 تنقلها لقاح

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

تطوير بوساطة حلقة-المجففة بالتبريد متساوي التضخيم الكواشف للكشف عن<em&gt; الكوكسيلا البورنيتية</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

مسحة طريقة أخذ العينات للكشف عن نوروفيروس الإنسان على السطوح

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

في طرق المختبر لمقارنة الهدف وتجليد وCDC التعريفي بين الأجسام المضادة العلاجية: تطبيقات في تحليل Biosimilarity

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...