Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Dette arbejde blev støttet af landbrug og fødevare forskning initiativ konkurrencedygtige tilskud nr. 2011-68003-30395 fra United States Department of Agriculture, nationale Institut for fødevarer og landbrug gennem NoroCORE-projektet. Finansiering for åben adgang gebyr blev leveret af United States Department of Agriculture. Vi vil gerne takke Robert Atmar (Baylor College of Medicine, Houston, TX) venligst give os renset capsids og Valerie Lapham for hendes hjælp med TEM billeder. Vi vil også gerne takke Frank N. Barry for at hjælpe os start eksperimenterne præsenteret.

1. plade-baserede bindende Assay for evaluering af tab af højere orden Norovirus kapsid struktur NOTE: en meget lignende ELASA protokol til den ene præsenteres her har været offentliggjort 29, og lignende ELASA assays er tidligere blevet rapporteret som en del af forskning artikler andre steder 17 , 18 , 22.
<ol><li>Varmebehandling af menneskelige norovirus G...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

Protokol og teknikker beskrevet her giver et middel til vurdering af menneskers norovirus kapsid integritet/funktionalitet. Disse metoder kan anvendes til at indhente mekanistiske indblik i virkningerne af inaktivering behandlinger mod virus og kan potentielt supplement til mere traditionelle inaktivering evalueringsmetoder som RT-qPCR eller plaque assay. For eksempel, giver evaluering af kemiske eller fysiske inaktivering af plaque assay alene et mål for graden af virus inaktivering, men ikke den underliggende mekanism...

Menneskelige norovirus er ansvarlig for en betydelig offentlig sundhedsbyrde globalt, forårsager omkring 685 millioner sygdomme og 212,000 dødsfald årligt1, til en pris i milliarder af dollars2,3. I dag, indebærer norovirus påvisning og kvantificering genom forstærkning og/eller ligand-baserede platforme. Førstnævnte er generelt foretrækkes, da det er mere følsom, giver kvantitative oplysninger og har generelt lavere risiko for falske positive resultater4. Den mest almindelige norovirus påvisning og kvantificering genom forstærkning teknik er reverse transkriptase kvantitative polymerase kædereaktion (RT-qPCR). Fordi det mål og forstærker et lille segment af menneskelige norovirus genom, RT-qPCR alene er ikke i stand til at diskriminere mellem smitsomme og ikke-smitsomme partikler, som gratis genomisk RNA, beskadiget capsids indeholdende genomer og capsids med fatalt muteret/afkortes genomer kan stadig blive forstærket af RT-qPCR. Mens to nye in vitro- dyrkningsmetoder for menneskelige norovirus5,6 er blevet rapporteret for nylig, begge stadig stole på RT-qPCR for virus kvantificering og er endnu ikke muligt metoder til rutinemæssig klinisk/miljømæssige testning for menneskelige norovira. Således, RT-qPCR fortsat guldstandarden for klinisk/miljømæssige test.
Andre in vitro- metoder er blevet udviklet i et forsøg på bedre anslå smitteevne status for norovirus partikler. Disse metoder kan generelt inddeles som dem, der vedrører integriteten af norovirus kapsid og evaluere genom integritet. Den tidligere tilgang er mere populære. En almindeligt anvendt metode er RNase forbehandling før udvinding af viral genomisk RNA, men det ikke tager højde for virale partikler, der forbliver intakt, men mangler evnen til at binde vært receptorer/co-faktorer, samt viruspartikler, som fatalt har muteret eller har afkortet eller marginalt beskadiget genomer7. Kapsid integritet kan også blive evalueret baseret på virus evne til at binde til menneskelige norovirus co-receptor/co-faktorer, som er kulhydrater kendt som Histò-blod gruppe antigener (HBGAs). HBGAs er til stede i vært intestinale epitel celler som en del af glykoproteiner eller glycolipider (blandt flere andre væv) og kan udskilles i kropsvæsker som spyt. Enteriske bakterier indeholdende HBGA-lignende stoffer på deres overflader har også vist sig at binde menneskelige norovirus8,9,10, og sådanne interaktioner kan fremme norovirus infektion5. Det grundlæggende koncept af at udnytte HBGA bindende er, at kun virale partikler kan bindende den formodede receptor/co-factor ville være i stand til at inficere celler. Flere undersøgelser tyder på, at perle-baserede HBGA bindende forud nukleinsyre amplifikation er en lovende metode for infektivitet forskelsbehandling11,12,13,14, 15,16. En stor udfordring med hensyn til HBGAs er, at ingen enkelt HBGA type kan binde alle menneskelige norovirus genotyper. For at løse dette, har svin gastrisk mucin, som indeholder HBGAs, været anvendt i stedet for renset HBGA kulhydrater i lethed syntese, konsistens og reducerede omkostninger.
En nylig publikation af Moore et al. 17 indført en række nye teknikker til estimering af menneskelige norovirus kapsid integritet. I stedet for HBGAs, Moore et al. 17 undersøgt binding af et bredt reaktive nukleinsyre aptamer (M6-2)18 og bredt reaktive monoklonalt antistof (NS14)19 til varmebehandlede GII.4 Sydney norovirus capsids (virus-lignende partikler eller VLPs) og sammenlignede dette til binding til syntetisk HBGAs. Nukleinsyre aptamers er korte (~ 20-80 nt) enkelt strandede nukleinsyrer (ssDNA eller RNA), fold i unikke tredimensionale strukturer som følge af deres sekvens og binde et mål. Fordi de er nukleinsyrer, er de billigere; let kemisk syntetiseret, renset og modificeret; og stabilt for varme. Flere rapporter om aptamers genereres mod norovira findes, med nogle af dem viser bred reaktivitet til en lang række stammer18,20,21,22. For eksempel, Moore et al. 17 demonstreret at aptamer M6-2 bundet til renset, samlet menneskelige norovirus capsids (VLPs) og opførte sig på samme måde til HBGA i afhængigheden af viral kapsid at opretholde højere orden (fx, sekundær og tertiær) protein struktur for bindende for at forekomme. På den anden side en betydelig del af norovirus VLP binding til antistof NS14 forblevet efter capsids var fuldstændig denatureret. Evaluering af norovirus bindende i undersøgelse af Moore et al. 17 blev gjort ved hjælp af en simpel, plade-baseret metode svarende til ELISA, med den undtagelse, at aptamers anvendes i stedet for antistoffer (derfor metoden blev kaldt ELASA). Denne høje overførselshastighed eksperimentelle metode blev brugt til at vurdere virkningerne af forskellige behandlinger på norovirus kapsid, arbejde, som er værdifulde for forståelsen af mekanismen for viral inaktivering ved udsættelse for fysiske eller kemiske stressfaktorer. Dog er en ulempe at denne metode den lavere følsomhed og manglende tolerance for matrix-associerede forureninger på højere niveauer, der forårsager non-specifik binding ved aptamers.
Moore et al. 17 bruges en anden metode, dynamiske lys spredning (DLS), til at overvåge sammenlægning af virale partikler i svar til varmebehandling. DLS er almindeligt anvendt til at vurdere størrelsen af nanopartikel suspensioner og er blevet udvidet til proteiner23,24 og vira25,26,27. Intensiteten af det lys spredt af partikler i løsning svinger som en funktion af partikelstørrelsen, den giver mulighed for beregning af diffusion koefficient og derefter partikel diameter ved hjælp af veletablerede formler. DLS teknik kan skelne de hydrodynamiske diameter af spredte partikler ned til nanoskala, der tillader detektering af spredte vira, individuelle kapsid proteiner eller dimere og virus aggregater baseret på størrelse27. Virus sammenlægning, repræsenteret ved en stigning i partikelstørrelse, er betegnende for tab af kapsid integritet. Som kapsid er denatureret og dens struktur forstyrres, hydrofobe restkoncentrationer blive udsat og forårsage partikler til at holde sammen og danne aggregater. DLS kan bruges til at måle partikelstørrelse efter en bestemt behandling eller kinetik af sammenlægning i realtid17,28. Denne metode har fordelen, at observation af kapsid adfærd i løsning men kræver høje koncentrationer af renset kapsid, som måske ikke er helt repræsentativt af virussen i sin naturlige tilstand.
Den endelige metode anvendes af Moore et al. 17 var transmissions elektronmikroskopi (TEM). Selv om denne metode mangler følsomhed og producerer ikke kvantitative data, det giver mulighed for visualisering af virkningerne af forskellige behandlinger på viral kapsid struktur. Selv om ikke endnu ideel til klinisk/miljømæssige indstillinger, er brugen af disse metoder i kombination værdifulde i at forstå menneskets norovirus inaktivering. Formålet med denne artikel er at give dybdegående protokoller for plade-baserede bindende assay (ELASA), DLS, og TEM præparationsmetoder bruges til at undersøge virkningerne af varme behandlinger på norovirus kapsid i forbindelse med behandlinger effekter på kapsid integritet som præsenteres i Moore et al. 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

Menneskelige norovirus exacts betydelige offentlige sundhedsmæssige og økonomiske tab på verdensplan. Dukker op i vitro endnu dyrkning fremskridt ikke er gældende for rutinemæssig påvisning af virus. Nuværende påvisning og kvantificering teknikker, der bygger primært på nukleinsyre amplifikation, diskriminerer ikke smitsomme fra ikke-infektiøse viruspartikler. Formålet med denne artikel er at fremlægge specifikke detaljer om de seneste fremskridt i teknikker, der anvendes sammen med henblik på at erhverve yderligere oplysninger om infektivitetsniveauet status af virale partikler. En teknik indebærer vurdering af bindingen af en norovirus ssDNA aptamer til capsids. Aptamers har fordelen at være let syntetiseret og ændret, og er billig og stabil. En anden teknik, dynamisk lys spredning (DLS), har fordelen, at observere kapsid adfærd i løsning. Elektronmikroskopi giver mulighed for visualisering af den strukturelle integritet af de virale capsids. Selv om lovende, er der nogle ulemper til hver teknik, som ikke-specifikke aptamer binding til positivt ladede molekyler fra prøven matricer, kravet om renset kapsid for DLS og ringe følsomhed for Elektron Mikroskopi. Ikke desto mindre, når disse teknikker anvendes i kombination, kroppen af data produceret giver mere omfattende information om norovirus kapsid integritet, der kan bruges til at udlede smitteevne, oplysninger, som er afgørende for korrekt evaluering af inaktivering metoder eller fortolkning af virus opdagelse. Denne artikel giver protokoller for at bruge disse metoder til at diskriminere smitsomme menneskelige norovirus partikler.

Den strukturelle integritet af menneskelige norovirus GII.4 Sydney capsids (VLPs) blev vurderet ved hjælp af flere nye metoder, som præsenteres af Moore et al. 17. for det første et eksperiment blev udført som integriteten af capsids som funktion af deres evne til at binde en formodede receptor/co-factor (HBGA) eller ssDNA aptamer (M6-2) blev sammenlignet (figur 1). De resultater, der vises er tidligere indgivet af Moore <...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Rutinemæssig påvisningsmetoder udnytte viral genomet forstærkning er begrænset af deres manglende evne til at diskriminere smitsomme fra ikke-smitsomme partikler. Formålet med denne artikel er at give detaljerede protokoller for alternative metoder til at støtte i forskelsbehandling af smitsomme norovirus partikler ved hjælp af aptamer bindende, dynamisk lysspredning og transmissions elektronmikroskopi.

Alternative In Vitro metoder til bestemmelse af Viral kapsid strukturelle integritet

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Etablering af en Liquid-dækket kultur Polarized humane luftveje Epitelial Calu-3-celler til at studere Host celle respons på luftvejspatogener<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total protein Udvinding og 2-D gelelektroforese Metoder til<em&gt; Burkholderia</em&gt; Arter

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Midling af viruskappeglycoproteinet Spikes fra Electron Cryotomography Rekonstruktioner hjælp Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

Viral Koncentration beslutsomhed gennem plakanalyser: ved hjælp af traditionel og Novel Overlay Systems

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Afsløring glykogen i perifere mononukleære blodceller med Periodic Acid Schiff Farvning

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Udnytte den Antigen capsidet-Indbygning strategi for udvikling af adenovirusserotype 5-vektoriserede Vaccine Approaches

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Udviklingen af ​​Frysetørret Loop-medierede Isotermiske Amplification reagenser til påvisning af<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Swab Sampling metode til påvisning af menneskelige Norovirus på overflader

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In vitro- metoder til sammenligning af målbinding og CDC-induktion mellem terapeutiske antistoffer: applikationer i biosimilaritetsanalyse

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...