Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Dit werk werd gesteund door de landbouw en voedsel onderzoek initiatief concurrerende Grant nr. 2011-68003-30395 van de United States Department of Agriculture, de nationale Instituut van de voedselvoorziening en de landbouw door middel van het NoroCORE-project. Voor open toegang gratis financiering werd verstrekt door het Amerikaanse ministerie van landbouw. We zouden graag bedanken Robert Atmar (Baylor College of Medicine, Houston, TX) voor vriendelijk ons het gezuiverde capsids en Valerie Lapham voor haar hulp bij de TEM-beelden. Ook bedank we Frank N. Barry voor het helpen ons start de experimenten gepresenteerd.

1. bindende Assay voor het evalueren van verlies van hogere Norovirus Eiwitmantel orderstructuur plaat gebaseerde Opmerking: een zeer vergelijkbaar ELASA protocol bij degene die hier gepresenteerd is gepubliceerd 29, en soortgelijke ELASA testen zijn eerder gemeld als onderdeel van onderzoek elders 17 , 18 , 22 artikelen.
<ol><li>Warmtebehandeling van menselijke...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

Het protocol en de hier beschreven technieken bieden een middel om de beoordeling menselijke norovirus Eiwitmantel integriteit/functionaliteit. Deze methoden kunnen worden gebruikt voor het verkrijgen van mechanistische inzicht in de effecten van inactivatie behandelingen tegen het virus, en potentieel meer traditionele inactivatie evaluatiemethoden zoals RT-qPCR of plaque bepaling kunnen aanvullen. Bijvoorbeeld, biedt de evaluatie van chemische of fysische inactivatie door plaque assay alleen een zekere mate van virus i...

Menselijke norovirus is verantwoordelijk voor een aanzienlijke volksgezondheid last wereldwijd, waardoor ongeveer 685 miljoen ziekten en 212,000 doden jaarlijks1, aan een kostprijs in de miljarden dollars2,3. Vandaag, omvat norovirus detectie en kwantificering genoom versterking en/of ligand-gebaseerde platforms. Eerstgenoemde is over het algemeen de voorkeur, want het is gevoeliger, kwantitatieve informatie, en over het algemeen lagere risico van valse positieve resultaten4 heeft. De meest voorkomende norovirus detectie en kwantificering genoom amplificatie techniek is reverse-transcriptase kwantitatieve polymerasekettingreactie (RT-qPCR). Omdat het richt zich op en een klein segment van het menselijke norovirus genoom versterkt, RT-qPCR alleen is niet in staat zijn van discriminatie tussen besmettelijke en niet-infectieuze deeltjes, als vrije genomic RNA, beschadigde capsids met genoom, en capsids met dodelijk gemuteerd/afgekapt genoom kunnen nog worden versterkt door RT-qPCR. Terwijl twee nieuwe in vitro teelttechnieken voor menselijke norovirus5,6 hebben onlangs gemeld, beide nog steeds vertrouwen op RT-qPCR voor virus kwantificering en zijn nog niet haalbaar methoden voor routinematige klinische/milieu testen voor menselijke norovirussen. RT-qPCR blijft dus, de gouden standaard voor het testen van de klinische/milieu.
Andere methoden in vitro zijn ontwikkeld in een poging om de status van de infectiviteit van norovirus deeltjes beter te schatten. Deze methoden kunnen in het algemeen worden gecategoriseerd als die waarmee de integriteit van het norovirus Eiwitmantel en die evaluatie genoom integriteit. De voormalige aanpak is meer populair. Een veelgebruikte methode is RNase Voorbehandeling voorafgaand aan de winning van virale genomic RNA, maar dit houdt geen rekening met virale deeltjes, die intact blijven, maar niet over de mogelijkheid om te binden host receptoren/co-factoren, evenals virale deeltjes die hebben dodelijk gemuteerd of zijn afgekapt of beschadigd marginaal genoom7. Eiwitmantel integriteit kan ook worden geëvalueerd op basis van het vermogen van het virus te binden aan menselijke norovirus co-receptor/co-factoren, die koolhydraten histo-bloed groep antigenen (HBGAs) genoemd. HBGAs in de intestinale epitheliale cellen van de gastheer aanwezig zijn als onderdeel van glycoproteïnen of glycolipiden (onder meerdere andere weefsels) en in lichaamsvloeistoffen zoals speeksel uitgescheiden kan worden. Darmen bacteriën die HBGA-achtige stoffen bevatten op hun oppervlakken hebben ook aangetoond dat het menselijke norovirus8,9,10te binden, en dergelijke interactie kunnen bevorderen norovirus infectie5. Het basisconcept van het gebruik van HBGA-bindende is dat alleen virale deeltjes kunnen binden met de vermeende receptor/co-factor zou kunnen cellen te infecteren. Meerdere studies suggereren dat kraal gebaseerde HBGA bindende voorafgaand aan versterking van de nucleïnezuur een veelbelovende methode voor infectiviteit discriminatie11,12,13,14is, 15,16. Een grote uitdaging met betrekking tot de HBGAs is dat geen enkel HBGA type alle menselijke norovirus genotypen kunt binden. Om aan te pakken dit, is varkens maag mucin, waarin HBGAs, gebruikt in plaats van gezuiverde HBGA koolhydraten in het belang van gemak van synthese, consistentie, en lagere kosten.
Een recente publicatie door Moore et al. 17 introduceerde een reeks nieuwe technieken voor het schatten van menselijke norovirus Eiwitmantel integriteit. In plaats van HBGAs, Moore et al. 17 binding van een grotendeels reactief nucleïnezuur aptamer (M6-2)18 en in het algemeen reactief monoklonaal antilichaam (NS14)19 tot en met warmtebehandelde GII.4 Sydney norovirus capsids (virusachtige deeltjes of experimentele) onderzocht en vergeleken dit om de binding aan synthetische HBGAs. Nucleic zuur-aptamers zijn korte (~ 20-80 nt) één gestrande nucleïnezuren (ssDNA of RNA) die Vouw in unieke driedimensionale structuren als gevolg van hun volgorde en binden van een doel. Omdat ze nucleïnezuren, zijn ze minder duur; gemakkelijk chemisch gesynthetiseerde, gezuiverd en gemodificeerde; en stabiele te verwarmen. Verscheidene verslagen van aptamers gegenereerd tegen norovirussen bestaat, met een aantal van hen tonen brede reactiviteit aan een verscheidenheid van stammen18,20,21,22. Bij wijze van voorbeeld, Moore et al. 17 aangetoond dat aptamer M6-2 gebonden aan gezuiverde, geassembleerd menselijke norovirus capsids (experimentele) en gedragen op dezelfde manier aan HBGA in de afhankelijkheid van de virale Eiwitmantel om hogere orde (bijv, secundaire en tertiaire) structuur voor eiwit binding aan het optreden. Aan de andere kant, een aanzienlijk deel van norovirus VLP binding aan antilichaam NS14 bleef na capsids werden volledig gedenatureerd. Evaluatie van norovirus bindend in de studie van Moore et al. 17 werd gedaan met behulp van een eenvoudige, plaat gebaseerde methode ELISA, vergelijkbaar met de uitzondering dat aptamers worden gebruikt in plaats van antilichamen (vandaar de methode werd genoemd ELASA). Deze hoge doorvoer experimentele methode werd gebruikt om de effecten van verschillende behandelingen op de norovirus Eiwitmantel, werk dat is waardevol voor het begrijpen van het mechanisme van virale inactivatie bij blootstelling aan fysische of chemische stressoren evalueren. Een nadeel van deze methode is echter de lagere gevoeligheid en gebrek aan tolerantie voor matrix-geassocieerde verontreinigingen op hogere niveaus waardoor niet-specifieke binding door de aptamers.
Moore et al. 17 gebruikt een andere methode, dynamisch licht verstrooiing (DLS), voor controle van aggregatie van virale deeltjes naar aanleiding van warmtebehandeling. DLS wordt gebruikt bij het evalueren van de grootte van nanoparticle schorsingen en heeft uitgebreid naar eiwitten23,24 en virussen25,26,27. De intensiteit van de lichtverstrooiing door deeltjes in oplossing fluctueert als een functie van deeltjesgrootte, zodat voor de berekening van diffusie coëfficiënt en vervolgens deeltje diameter gevestigde formules gebruiken. De DLS-techniek kunt onderscheiden van de hydrodynamische diameter van verspreide deeltjes naar de nanoschaal, die maakt de ontdekking van verspreide virussen, individuele Eiwitmantel eiwitten of Dimeren en virus aggregaten op basis van grootte27. Virus aggregatie, vertegenwoordigd door een toename van de grootte van de deeltjes, is kenmerkend voor verlies van Eiwitmantel integriteit. Aangezien de Eiwitmantel is gedenatureerd en haar structuur verstoord, hydrofobe residuen worden blootgesteld en veroorzaken de deeltjes te plakken aan elkaar en vormen van aggregaten. Distributielijsten kunnen worden gebruikt voor het meten van deeltjesgrootte na een opgegeven behandeling of de kinetiek van aggregatie in real-time17,28. Deze methode heeft het voordeel van het toestaan van waarneming van Eiwitmantel gedrag in oplossing maar vereist hoge concentraties van gezuiverde Eiwitmantel, die wellicht niet geheel representatief is voor het virus in zijn natuurlijke staat.
De laatste methode gebruikt door Moore et al. 17 was transmissie-elektronenmicroscopie (TEM). Hoewel deze methode gevoeligheid mist en geen kwantitatieve gegevens produceert, staat het voor de visualisatie van de effecten van verschillende behandelingen op de virale Eiwitmantel structuur. Hoewel nog niet ideaal voor klinische/omgevingsinstellingen, is het gebruik van deze methoden in combinatie waardevol inzicht in menselijke norovirus inactivatie. Het doel van dit artikel is bedoeld als diepgaande protocollen voor de plaat gebaseerde bindende assay (ELASA), Distributielijsten, en TEM voorbereiding methoden gebruikt voor het onderzoeken van de effecten van warmtebehandelingen die men op het norovirus Eiwitmantel in het kader van de behandelingen effecten op Eiwitmantel integriteit zoals gepresenteerd in Moore et al. 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

Menselijke norovirus lijders aanzienlijke volksgezondheid en economische verliezen wereldwijd. Opkomende in vitro teelt voorschotten gelden niet nog voor routinematige opsporing van het virus. De huidige detectie en kwantificering technieken, die voornamelijk afhankelijk zijn van nucleïnezuur amplificatie, discrimineren niet besmettelijke uit niet-besmettelijke virale deeltjes. Het doel van dit artikel is om specifieke details over recente vorderingen in de technieken samen worden gebruikt om te verwerven verdere informatie over de status van de infectiviteit van virale deeltjes. Een techniek omvat de beoordeling van de binding van een norovirus ssDNA aptamer te capsids. Aptamers hebben het voordeel dat het gemakkelijk wordt gesynthetiseerd en gewijzigd, en zijn goedkoop en stabiel. Een andere techniek, dynamisch licht verstrooiing (DLS), heeft het voordeel van Eiwitmantel gedrag optreedt in oplossing. Elektronenmicroscopie zorgt voor visualisatie van de structurele integriteit van de virale capsids. Hoewel veelbelovend, zijn er enkele nadelen aan elke techniek, zoals niet-specifieke aptamer binding aan positief geladen moleculen van monster matrices, eis van gezuiverde Eiwitmantel distributielijsten en arme gevoeligheid voor elektronenmicroscopie. Niettemin, als deze technieken worden gebruikt in combinatie, het lichaam van de geproduceerde gegevens vindt u uitgebreidere informatie over norovirus Eiwitmantel integriteit die kan worden gebruikt voor het afleiden van de infectiviteit, informatie die essentieel is voor een nauwkeurige evaluatie van inactivatie methoden of interpretatie van virusdetectie. Dit artikel bevat de protocollen voor het gebruik van deze methoden te discrimineren besmettelijke menselijke norovirus deeltjes.

De structurele integriteit van menselijke norovirus GII.4 Sydney capsids (experimentele) werd beoordeeld met behulp van verschillende nieuwe methoden, zoals gepresenteerd door Moore et al. 17. ten eerste, een experiment werd gedaan die de integriteit van de capsids als een functie van hun vermogen om te binden een vermeende receptor/co-factor (HBGA) of ssDNA aptamer (M6-2) werden vergeleken (Figuur 1). De getoonde resultaten z...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routine detectiemethoden gebruik te maken van de versterking van het virale genoom worden beperkt door hun onvermogen om te discrimineren besmettelijke uit niet-infectieuze deeltjes. Het doel van dit artikel is om gedetailleerde protocollen voor alternatieve methoden om hulp in discriminatie van besmettelijke norovirus deeltjes met behulp van aptamer-bindende, Dynamische lichtverstrooiing en transmissie-elektronenmicroscopie.

Alternatieve In Vitro methoden voor de bepaling van de structurele integriteit van virale Eiwitmantel

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Structuur van HIV-1 capside Assemblies van cryo-elektronenmicroscopie en iteratief Helical Real-ruimte Wederopbouw

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Tot oprichting van een Liquid bedekte cultuur van gepolariseerde menselijke luchtwegen Epiteel Calu-3 cellen aan Host Cell Reactie op respiratoire pathogenen Studie<em&gt; In vitro</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Totaal Eiwitextractie en 2-D gelelektroforese Werkwijzen voor<em&gt; Burkholderia</em&gt; Soorten

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Een gemiddelde van virale envelop glycoproteïne Spikes uit Electron Cryotomography Reconstructies met Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

Virale Concentratie Bepaling Door Plaque Testen: met behulp van traditionele en Novel Overlay System

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Detecteren Glycogeen in perifeer bloed mononucleaire cellen met Periodic Acid Schiff kleuring

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Gebruik makend van de Antigen Capsid-Incorporation strategie voor de ontwikkeling van adenovirus serotype 5-Vectored Vaccin Approaches

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

De ontwikkeling van gevriesdroogde Loop-gemedieerde Isotherme Amplification reagentia voor de detectie van<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Swab Sampling Methode voor de detectie van humane Norovirus op oppervlakken

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methoden voor het vergelijken van Target Binding en CDC Inductie Tussen Therapeutische Antilichamen: Toepassingen in Biosimilarity Analysis

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...