Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Diese Arbeit wurde vom Agriculture and Food Research Initiative wettbewerbsfähige Grant Nr. 2011-68003-30395 vom United States Department of Agriculture, nationalen Institut für Ernährung und Landwirtschaft im Rahmen des NoroCORE Projekts unterstützt. Open-Access-Gebühr wurde von der United States Department of Agriculture finanziert. Wir möchten danken Robert Atmar (Baylor College of Medicine, Houston, TX) freundlicherweise uns zur Verfügung gestellt die gereinigten Capsids und Valerie Lapham für ihre Unterstützung bei der TEM-Bilder. Wir möchten auch Frank N. Barry Danke für Ihre Hilfe die Experimente vorgestellt.

1. Platte-basierte verbindlich Test zur Bewertung der Verlust der höheren Norovirus Kapsid Auftragsstruktur Hinweis: ein sehr ähnliches ELASA Protokoll zu dem hier vorgestellten wurde veröffentlicht 29, und ähnliche ELASA Assays zuvor gemeldet wurden als Teil der Forschung anderswo 17 , 18 , 22 Artikel.
<ol><li>Wärmebehandlung von menschlichen Norovirus GII...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

Das Protokoll und die hier beschriebenen Techniken bieten ein Mittel zur Bewertung der menschlichen Norovirus Kapsid Integrität/Funktionalität. Diese Methoden können verwendet werden, für den Erhalt der mechanistische Einblicke in die Auswirkungen der Inaktivierung Behandlungen gegen das Virus und können potenziell traditionellere Inaktivierung Bewertungsmethoden wie RT-qPCR oder Plaque-Assay ergänzen. Beispielsweise sieht die Bewertung der chemischen oder physikalischen Inaktivierung durch Plaque-Assay allein ein ...

Menschlichen Norovirus ist verantwortlich für eine beträchtliche öffentliche Gesundheit Belastung weltweit verursacht ca. 685 Millionen Erkrankungen und 212.000 Todesfälle jährlich1, zu einem Preis in den Milliarden von Dollar2,3. Heute, beinhaltet Norovirus-Erkennung und Quantifizierung Genom Verstärkung bzw. Liganden-basierten Plattformen. Ersteres wird in der Regel bevorzugt, da es empfindlicher ist, quantitative Informationen liefert und in der Regel geringere Gefahr von falsch-positive Ergebnisse4 hat. Die am häufigsten verwendete Norovirus Erkennung und Quantifizierung Genom Verstärkung Technik ist Reverse Transkriptase quantitative Polymerase-Kettenreaktion (RT-qPCR). Denn es richtet sich an und ein kleines Segment des menschlichen Norovirus-Genoms verstärkt, RT-qPCR allein ist nicht in der Lage, die Unterscheidung zwischen dem infektiösen und nicht-infektiöse Partikel als kostenlose genomischen RNA, beschädigt tödlich Capsids mit Genomen und Capsids mit mutiert/abgeschnitten Genome können durch RT-qPCR noch verstärkt werden. Während vor kurzem zwei neue in-vitro- Kultivierung Techniken für menschliche Norovirus5,6 gemeldet wurden, beide noch verlassen sich auf RT-qPCR Virus Quantifizierung und noch nicht machbar Methoden für die routinemäßige klinische/Umwelt Tests für menschliche Noroviren. RT-qPCR bleibt daher den Goldstandard für klinische/Umwelttests.
Andere in-vitro- Methoden entstanden in dem Bemühen, die Infektiosität Status des Norovirus Partikel besser abschätzen zu können. Diese Methoden können in der Regel als diejenigen, die die Integrität der Norovirus Kapsid ansprechen und die Bewertung von Genom Integrität kategorisiert werden. Das erste Verfahren wird immer beliebter. Eine häufig verwendete Methode ist RNase Vorbehandlung vor der Extraktion der viralen genomischen RNA, aber dies nicht berücksichtigt werden, Viruspartikel, die intakt bleiben, aber nicht über die Fähigkeit, Host-Rezeptoren/co-Faktoren zu binden sowie Viruspartikel, die tödlich mutiert haben oder abgeschnitten oder Genome7geringfügig beschädigt haben. Kapsid Integrität kann auch ausgewertet werden, basierend auf die Fähigkeit des Virus binden an menschlichen Norovirus co-receptor/co-Faktoren, die Kohlenhydrate sind bekannt als Histo-Blut Gruppe Antigene (HBGAs). HBGAs sind in intestinalen Epithelzellen Host als Bestandteil von Glykoproteinen oder Glycolipide (unter mehreren anderen Geweben) und in Körperflüssigkeiten wie Speichel abgesondert werden kann. Magensaftresistente Bakterien mit HBGA-ähnlichen Substanzen auf ihrer Oberfläche haben auch gezeigt, dass menschliche Norovirus8,9,10binden und solche Interaktionen können Norovirus Infektion5fördern. Das grundlegende Konzept der Verwendung HBGA Bindung ist, dass nur virale Partikel binden die vermeintliche Rezeptor/co-factor in der Lage wäre, Zellen zu infizieren. Mehrere Studien deuten darauf hin, dass Wulst-basierte HBGA Bindung vor Nucleinsäureamplifikation eine viel versprechende Methode für Infektiosität Diskriminierung11,12,13,14ist, 15,16. Eine große Herausforderung für HBGAs ist, dass kein einziges HBGA Typ alle menschlichen Norovirus Genotypen binden kann. Um dieses Problem anzugehen, hat Schwein Magen Mucin, die HBGAs enthält, anstelle von gereinigten HBGA Kohlenhydrate im Interesse der einfachen Synthese, Konsistenz und reduzierten Kosten eingesetzt.
Einer kürzlich erschienenen Publikation von Moore Et al. 17 führte eine Reihe von neuen Techniken für die Schätzung der menschlichen Norovirus Kapsid Integrität. Anstelle von HBGAs, Moore Et al. 17 Bindung eines weitgehend reaktiven Nukleinsäure-Aptamer (M6-2)18 und im großen und ganzen reaktive monoklonaler Antikörper (NS14)19 , wärmebehandelte GII.4 Sydney Norovirus Capsids (virusähnliche Partikel oder untersuchten) untersucht und verglichen um die Bindung an synthetischen HBGAs. Nukleinsäure-Aptamere sind kurz (~ 20-80 nt) einzelne gestrandeten Nukleinsäuren (SsDNA oder RNA), die Falten zu einzigartigen dreidimensionalen Strukturen als Folge ihrer Sequenz und ein Ziel zu binden. Weil sie Nukleinsäuren sind, sind sie weniger kostspielig; leicht chemisch synthetisiert, gereinigte und modifiziert; und stabil gegen Hitze. Mehrere Berichte von Aptameren generiert gegen Noroviren gibt, mit einigen von ihnen zeigen breite Reaktivität verschiedener Stämme18,20,21,22. Zum Beispiel, Moore Et al. 17 unter Beweis gestellt, dass Aptamer M6-2 verpflichtet, gereinigt, zusammengebauten menschlichen Norovirus Capsids (untersuchten) und verhielt sich ähnlich, HBGA in die Abhängigkeit von der viralen Kapsid zu höherer Ordnung (z. B. sekundäre und tertiäre) Protein-Struktur für verbindliches auftreten. Auf der anderen Seite blieb ein erheblicher Anteil der Norovirus VLP Bindung an Antikörper NS14 nach Capsids völlig denaturiert wurden. Bewertung der Norovirus-Bindung in der Studie von Moore Et al. 17 erfolgte über eine einfache Platte-basierte Methode ähnlich wie ELISA, mit der Ausnahme, dass Aptamere anstelle von Antikörpern verwendet werden (daher ist die Methode ELASA hieß). Diese experimentellen Hochdurchsatz-Methode wurde zur Bewertung der Auswirkungen verschiedener Therapien auf das Norovirus Kapsid, Arbeit, die für das Verständnis des Mechanismus der viralen Inaktivierung bei Belastung durch physikalische oder chemische Stressoren wertvoll ist. Ein Nachteil dieser Methode ist jedoch die geringere Empfindlichkeit und Mangel an Toleranz für Matrix-assoziierte Kontaminanten auf höheren Ebenen, die unspezifische Bindung von Aptameren verursachen.
Moore Et al. 17 verwendet eine andere Methode, dynamische Lichtstreuung (DLS), Aggregation der Viruspartikel als Reaktion auf Wärmebehandlung zu überwachen. DLS ist häufig verwendet, um die Größe der Nanopartikel-Suspensionen zu bewerten und auf Proteine23,24 und Viren25,26,27erweitert. Die Intensität des Lichts verstreut durch Partikel in Lösung schwankt in Abhängigkeit von der Partikelgröße, so dass für die Berechnung des Diffusionskoeffizienten und dann Partikeldurchmesser mit bewährten Formeln. Die DLS-Technik kann den hydrodynamischen Durchmesser der dispergierten Partikel bis in den Nanobereich unterscheiden, die ermöglicht die Erkennung von verteilten Viren, individuelle Kapsid-Proteine oder Dimere und Virus-Aggregate, die anhand der Größe27. Virus-Aggregation, vertreten durch eine Erhöhung der Partikelgröße, zeugt vom Verlust der Integrität Kapsid. Das Kapsid ist denaturiert und seine Struktur gestört, hydrophoben Überreste ausgesetzt werden und dazu führen, dass die Teilchen zusammenhalten und Aggregate zu bilden. DLS kann verwendet werden, zur Messung der Partikelgröße nach einer bestimmten Behandlung oder die Kinetik der Aggregation in Echtzeit17,28. Diese Methode erfordert hohe Konzentrationen von gereinigten Kapsid, die möglicherweise nicht ganz repräsentativ für das Virus in seinem natürlichen Zustand aber hat den Vorteil, dass Beobachtung des Verhaltens Kapsid in Lösung.
Die letzte Methode von Moore Et Al. genutzt 17 Jahre alt war Transmissions-Elektronenmikroskopie (TEM). Obwohl diese Methode Empfindlichkeit fehlt und keine quantitative Daten erzeugt, ermöglicht es für die Visualisierung der Auswirkungen der verschiedenen Behandlungen auf die virale Kapsid-Struktur. Obwohl nicht noch ideal für klinische/Umgebungseinstellungen, ist der Einsatz dieser Methoden in Kombination wertvolle menschliche Norovirus Inaktivierung zu verstehen. Der Zweck dieses Artikels ist es, detaillierte Protokolle für die Platte basierende Bindung-Assay (ELASA), DLS, bieten und TEM Vorbereitung Methoden untersuchen die Auswirkungen der Wärmebehandlungen auf das Norovirus Kapsid im Zusammenhang mit den Behandlungen Auswirkungen auf Kapsid Integrität im Moore Et Al. vorgestellt 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

Menschlichen Norovirus fordert erhebliche öffentliche Gesundheit und wirtschaftliche Verluste weltweit. Schwellenländer in Vitro sind Anbau Fortschritte noch nicht anwendbar für routinemäßige Nachweis des Virus. Die aktuelle Erkennung und Quantifizierung Techniken, die in erster Linie auf Nucleinsäureamplifikation angewiesen sind, diskriminieren nicht infektiöse von nicht-infektiöse Viruspartikel. Der Zweck dieses Artikels ist es, spezifische Details über die jüngsten Fortschritte in Techniken zusammen, um weitere Informationen über den Status der Infektiosität der Viruspartikel erwerben zu präsentieren. Eine Technik beinhaltet die Beurteilung der Bindung von einer Norovirus SsDNA Aptamer, Capsids. Aptamere haben den Vorteil des Seins leicht synthetisiert und geändert und sind preiswert und stabil. Eine andere Technik, dynamisches Licht Streuung (DLS), hat den Vorteil der Beobachtung Kapsid Verhalten in Lösung. Elektronen-Mikroskopie ermöglicht eine Visualisierung der strukturellen Integrität der viralen Capsids. Obwohl mit dem Versprechen, gibt es einige Nachteile, jede Technik, wie z. B. Aptamer unspezifische Bindung an positiv geladene Moleküle aus Probe Matrizen, Erfordernis der gereinigten Kapsid für DLS und schlechte Empfindlichkeit für Elektronenmikroskopie. Dennoch, wenn diese Techniken in Kombination verwendet werden, versorgt den Körper der produzierten Daten umfassenderen Informationen auf Norovirus Kapsid Integrität, die verwendet werden, um die Infektiosität, Informationen ableiten, die wesentlich für die genaue Bewertung der Inaktivierungsverfahren oder Auslegung der Virenerkennung. Dieser Artikel enthält Protokolle für den Einsatz dieser Methoden, um menschlichen ansteckenden Norovirus Teilchen zu unterscheiden.

Die strukturelle Integrität des menschlichen Norovirus GII.4 Sydney Capsids (untersuchten) wurde anhand mehrere neuartige Methoden wie von Moore Et Al. vorgestellt 17. zunächst ein Experiment wurde durchgeführt, die die Integrität des Capsids in Abhängigkeit von ihrer Fähigkeit, eine vermeintliche Rezeptor/co-factor (HBGA) oder SsDNA Aptamer (M6-2) binden waren im Vergleich (Abbildung 1). Die angezeigten Ergebnisse wurde...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Routinemäßige Nachweismethoden nutzen virale Genom Verstärkung sind durch ihre Unfähigkeit, infektiöse von nicht-infektiöse Partikel unterscheiden begrenzt. Der Zweck dieses Artikels ist es, detaillierte Protokolle nach alternativen Methoden zur Diskriminierung von ansteckenden Norovirus Teilchen mit Aptamer Bindung, dynamische Lichtstreuung und Transmissions-Elektronenmikroskopie Unterstützung bieten.

Alternative In-vitro- Methoden zur Bestimmung der viralen Kapsid strukturelle Integrität

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Aufbau des HIV-1 Capsid Assemblies durch Kryo-Elektronenmikroskopie und Iterative Helical Real-Raum Wiederaufbau

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Forschung

Immunologie und Infektion

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Aufbau einer Liquid-bedeckten Kultur Polarized Menschliche Airway Epithelial Calu-3-Zellen, um Host-Zell-Antwort, um Atemwegspathogene Studie<em&gt; In-vitro-</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Gesamtproteinextraktion und 2-D Gelelektrophorese-Methoden für<em&gt; Burkholderia</em&gt; Arten

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Mittelung der Virushülle Glykoprotein-Spikes von Electron Cryotomography Rekonstruktionen mit Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

Viral Entschlossenheit Konzentration Durch Plaque-Assays: Mit Tradition und neuen Überzugssysteme

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

Erkennen von Glykogen in peripheren mononukleären Blutzellen mit Perjodsäure-Schiff-Färbung

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Unter Verwendung der Antigen Capsid-Incorporation Strategie für die Förderung der Adenovirus-Serotyp 5-Vectored Vaccine Approaches

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

Die Entwicklung der Lyophilisierte Loop-mediated Isothermal Amplification Reagenzien zum Nachweis von<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Swab Sampling Verfahren zum Nachweis von humanem Norovirus auf Oberflächen

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In - vitro - Methoden zum Vergleich der Zielbindungs und CDC Induktion zwischen Therapeutische Antikörper: Anwendungen in Biosimilarity Analyse

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...