Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

עבודה זו נתמכה על ידי חקלאות, מזון המחקר יוזמת תחרותי מענק מס 2011-68003-30395 מחלקת החקלאות של ארצות הברית, המכון הלאומי של המזון, החקלאות באמצעות הפרויקט NoroCORE. מימון עבור גישה פתוחה תשלום סופק על ידי מחלקת החקלאות של ארצות הברית. ברצוננו להודות רוברט Atmar (ביילור לרפואה, יוסטון, טקסס) בחביבות לספק לנו את capsids מטוהרים ואת ואלרי לפאם על הסיוע עם תמונות TEM. אנחנו רוצים גם פרנק נ' בארי. תודה שעזרת לנו להתחיל את הניסויים שהוצגו.

1. מבוססת על צלחת איגוד וזמינותו עבור הערכת אובדן של סדר Norovirus Capsid למבנה גבוה הערה: פרוטוקול ELASA דומה מאוד לאחד המוצגים כאן כבר פורסם 29, מבחני ELASA דומה בעבר דווחו חלק ממחקר מאמרים במקום 17 , 18 , 22-
<ol><li>טיפול ?...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

הפרוטוקול ואת הטכניקות המתוארות כאן מספקים אמצעי הערכת norovirus האנושי capsid תקינות/הפונקציונליות של.... שיטות אלה יכול לשמש להשגת תובנה מכניסטית ההשפעות של איון טיפולים נגד הנגיף, באופן פוטנציאלי יכול לשמש כתוספת מסורתיים יותר שיטות ההערכה איון כמו assay RT-qPCR או פלאק. למשל, הערכת איון כימיים או פ?...

Norovirus האנושי הוא אחראי על נטל ניכר בבריאות הציבור ברחבי העולם, גורם על 685 מיליון מחלות ותמותה 212,000 מדי שנה1, בעלות של מיליארדים של דולרים2,3. היום, norovirus זיהוי, כימות כרוך הגנום הגברה ו/או פלטפורמות מבוססות-ליגנד. הראשון הוא בדרך כלל עדיף כפי שהוא רגיש יותר, מספק מידע כמותי, יש סיכון נמוך יותר באופן כללי של תוצאות חיוביות שגויות4. הנפוץ ביותר norovirus זיהוי, כימות הגנום הגברה הטכניקה היא תגובת שרשרת של פולימראז כמותיים רוורס טרנסקריפטאז (RT-qPCR). כי היא מטרות, מגביר את מקטע קטן של הגנום האנושי norovirus, RT-qPCR לבד אינה מסוגלת האפליה בין זיהומיות ופגעו חלקיקים שאינן זיהומיות, כמו ה-RNA הגנומי חינם, capsids המכיל הגנום, capsids עם אנושות מוטציה/קטום הגנום יכול עדיין להיות מוגבר על ידי RT-qPCR. בעוד שני במבחנה הטיפוח-תרגול טכניקות חדשות norovirus אנושי5,6 דווחו לאחרונה, שניהם עדיין לסמוך על RT-qPCR על וירוס כימות, עדיין לא ריאלי שיטות שגרתיות קליני/סביבתיים בדיקת noroviruses האנושית. לפיכך, RT-qPCR נשאר תקן הזהב בדיקה קלינית/סביבתיים.
שיטות אחרות במבחנה פותחו במטרה להעריך טוב יותר את המצב infectivity של חלקיקים norovirus. שיטות אלה יכולים להיות מסווגים בדרך כלל כ אלה המטפלות שלמות capsid norovirus ואלה הערכת תקינות הגנום. הגישה פופולרי יותר. השיטה הנפוצה היא RNase רעלני לפני מיצוי של נגיפי RNA הגנומי, אולם זה אינו חשבון נגיפים נשארים בעינם, אך חוסר היכולת לאגד מארח קולטנים/co-גורמים, כמו גם חלקיקים נגיפיים כי יש מוטציה אנושות או יש נחתך או שולית פגום הגנום7. שלמות capsid גם ניתן להעריך בהתבסס על היכולת של הווירוס כדי לאגד norovirus האנושי co-receptor/co-גורמים, אשר הם פחמימות המכונה אנטיגנים קבוצה היסטו-דם (HBGAs). HBGAs נמצאים בתאי האפיתל במעי מארח כחלק glycoproteins או glycolipids (בין מספר רקמות אחרות), עשוי להיות מופרש בנוזלי גוף שונים כמו רוק. בה חיידק המכילים חומרים דמויי-HBGA על משטחים שלהם יש גם הוכח כדי לאגד norovirus האנושי8,9,10, אינטראקציות כאלה עשויים לקדם norovirus זיהום5. התפיסה הבסיסית של ניצול HBGA מחייב הוא כי רק מסוגל מחייב את בשם הקולטן/co-factor נגיפים יהיה מסוגל להדביק תאים. מחקרים רבים מראים כי מבוסס-חרוז איגוד HBGA שקדמו חומצת גרעין הגברה היא שיטה מבטיחה infectivity אפליה11,12,13,14, 15,16. האתגר העיקרי לגבי HBGAs היא כי אין סוג HBGA יחיד באפשרותך לאגוד כל norovirus אנושיים אחרים. כדי לטפל בבעיה זו, שימש חזירי mucin קיבה, אשר מכיל HBGAs, במקום פחמימות מטוהרים HBGA כדי לשמור על נוחות של סינתזה, עקביות, עלות מופחתת.
פרסום זה התבצעה על ידי מור. et al. 17 הציג סט של טכניקות חדשות עבור הערכת תקינות capsid norovirus אנושי. במקום HBGAs, מור. et al. 17 חקרו את הכריכה של חומצת גרעין בהרחבה תגובתי aptamer (M6-2)18 ו ש GII.4 סידני שילדת norovirus capsids (חלקיקים דמויי וירוס או האח מים)19 בהרחבה תגובתי נוגדנים חד שבטיים (NS14), לעומת זאת על הכריכה כדי HBGAs סינתטי. חומצת גרעין aptamers הם קצר (~ 20-80 nt) יחיד נטושים חומצות גרעין (ssDNA או RNA) לקפל לתוך מבנים תלת מימדיים ייחודיים כתוצאה הרצף שלהם, לאגד מטרה. כי הם חומצות גרעין, הם פחות יקר; בקלות כימית מסונתז מטוהרים, שונה; יציב לחום קיימים מספר דיווחים של aptamers שנוצר נגד noroviruses, עם חלק מהם מציג תגובתיות רחב מגוון של זנים18,20,21,22. דוגמה, מור. et al. 17 הפגינו את aptamer M6-2 קשורה norovirus האנושי מטוהרים, שהורכב capsids (האח מים) ו התנהגה באופן דומה כדי HBGA והתלות capsid ויראלי כדי לשמור על מבנה החלבון סדר (למשל, משניות ושלישוניות) גבוה יותר עבור כריכת להתרחש. מצד שני, חלק ניכר norovirus האח מים מחייב נוגדן NS14 נותרה לאחר היו capsids שפגע בסימני לחלוטין. הערכה של איגוד norovirus במחקר על ידי מור. et al. 17 נעשתה באמצעות שיטה פשוטה, המבוססים על צלחת דומה, אליסה, למעט כי aptamers משמשים במקום נוגדנים (ומכאן השיטה נקראה ELASA). זו השיטה הניסיונית של תפוקה גבוהה שימש כדי להעריך את ההשפעות של טיפולים שונים על capsid norovirus, עבודה זה חשוב להבנת המנגנון של איון ויראלי בתגובה לחשיפה לחצים פיזי או כימי. עם זאת, חסרון אחד לשיטה זו הוא נמוך יותר רגישות חוסר סובלנות כלפי מזהמים מטריקס-הקשורים ברמות גבוהות יותר, הגורמות מחייב שאינם ספציפיים על-ידי aptamers.
מור. et al. 17 להשתמש בשיטה אחרת, אור דינאמי פיזור (DLS), כדי לפקח על צבירה של נגיפים בתגובה טיפול בחום. DLS משמש בדרך כלל כדי להעריך את הגודל של ננו-חלקיק המתלים, הורחבה חלבונים23,24 ווירוסים25,26,27. עוצמת האור מפוזר על ידי חלקיקים בתמיסה תנודות כפונקציה של גודל החלקיקים, המאפשר חישוב מקדם דיפוזיה ולאחר מכן קוטר חלקיקים באמצעות נוסחות ומבוססת. הטכניקה DLS יכולים להבחין הקוטר hydrodynamic של חלקיקים התפזרו עד הננומטרי, המאפשר זיהוי של וירוסים התפזרו, חלבונים capsid בודדים או הדימרים אגרגטים וירוס מבוסס על גודל27. מצבור וירוס, המיוצג על-ידי עלייה גודל החלקיקים, הוא מרמז על אובדן של capsid שלמות. Capsid הוא שפגע בסימני, המבנה שלו משובשות, שאריות הידרופובי הופכים חשופים וגורמים החלקיקים להישאר ביחד ויוצרים אגרגטים. DLS יכול לשמש כדי למדוד את גודל החלקיקים לאחר טיפול שצוין או את קינטיקה של מצבור בזמן אמת17,28. בשיטה זו יש את היתרון של ומאפשר תצפית בהתנהגות capsid בפתרון אך דורש ריכוז גבוה של capsid מטוהרים, אשר ייתכן שאינו לגמרי נציג של הוירוס במצבו הטבעי.
השיטה האחרונה מנוצל על ידי מור. et al. 17 היה במיקרוסקופ אלקטרונים הילוכים (TEM). למרות ששיטה זו חסר רגישות, אינו מייצר נתונים כמותיים, היא מאפשרת הדמיה של ההשפעות של טיפולים שונים על המבנה capsid ויראלי. למרות שלא עדיין אידיאלי עבור הגדרות קליני/סביבתיים, השימוש בשיטות אלה בשילוב הוא חשוב בהבנת האדם norovirus איון. מטרת מאמר זה היא לספק פרוטוקולים מעמיק המבוסס על צלחת איגוד וזמינותו (ELASA), DLS, והשתמשו בשיטות הכנה TEM כדי לחקור את ההשפעות של טיפולים תרמיים על capsid norovirus בהקשר של ההשפעות של הטיפולים על capsid שלמות כפי שהוצג במור. et al. 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

האדם norovirus האסלאם נוקם בריאות הציבור ניכר והפסדים כלכליים ברחבי העולם. מתעוררים במבחנה טיפוח ההתקדמות עדיין אינם ישימים עבור זיהוי שגרתית של הנגיף. כימות טכניקות, אשר מסתמך בעיקר על הגברה חומצת גרעין, וזיהוי הנוכחי לא להפלות זיהומיות של נגיפים שאינן זיהומיות. מטרת מאמר זה היא להציג פרטים ספציפיים על ההתקדמות טכניקות המשמשות ביחד כדי לקבל עוד מידע על מצב infectivity של נגיפים. טכניקה אחת כוללת הערכת קשירה של aptamer ssDNA norovirus כדי capsids. Aptamers יש את היתרון של להיות מסונתז בקלות והוא שונה, ויש זול ויציב. טכניקה נוספת, דינאמי פיזור אור (DLS), יש את היתרון של התנהגות capsid בפתרון. מיקרוסקופ אלקטרונים מאפשר הדמיה של שלמות המבנה של capsids נגיפי. למרות והבטיחה, יש מספר חסרונות כל טכניקה, כגון aptamer שאינם ספציפיים מחייב מפרוטונים שמטענם מולקולות של מטריצות לדוגמה, הדרישה של capsid מטוהרים עבור DLS, ורגישות המסכן עבור מיקרוסקופ אלקטרונים. ובכל זאת, כאשר שיטות אלה משמשים בשילוב, הגוף של נתונים המיוצר מספק מידע מקיף יותר על תקינות capsid norovirus ניתן להסיק infectivity, מידע חיוני עבור הערכה מדויקת של השתקה של כרומוזום שיטות או פרשנות של וירוס האיתור. מאמר זה מספק פרוטוקולים בשיטות אלה להפלות norovirus האנושי זיהומיות חלקיקים.

השלמות. המבנית של האדם norovirus סידני GII.4 capsids (האח מים) הוערכה באמצעות מספר שיטות רומן כפי שהוצגו על ידי מור. et al. 17. קודם כל, נעשה ניסוי שהיו על capsids השלמות כפונקציה של היכולת שלהם לאגד בשם קולטן/co-factor (HBGA) או של ssDNA aptamer (M6-2) בהשוואה (איור 1). התוצאו...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

שיטות איתור שגרתית ניצול גנום ויראלי הגברה מוגבלים על ידי חוסר יכולתם להפלות זיהומיות של חלקיקים שאינן זיהומיות. מטרת מאמר זה נועד לספק נתונים היסטוריים פרוטוקולים עבור שיטות אלטרנטיביות לסייע אפליה של חלקיקים norovirus זיהומיות באמצעות איגוד aptamer, פיזור אור דינאמי במיקרוסקופ אלקטרונים הילוכים.

שיטות אלטרנטיביות במבחנה מצפני Capsid ויראלי המבנית

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

מבנה של HIV-1 הרכבות capsid על ידי מיקרוסקופית אלקטרונים cryo-ו איטרטיבי לשיקום שטח נדל סליל

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

הקמת תרבות הנוזלית מכוסית של Airway האנושי המקוטב-3 Calu תאי אפיתל ללמוד תגובת תא מארחת לפתוגנים נשימה<em&gt; במבחנה</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

הפקת חלבון סה&quot;כ ו2-D שיטות ג&#39;ל אלקטרופורזה עבור<em&gt; Burkholderia</em&gt; מינים

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

ממוצע של ויראלי מעטפת גליקופרוטאין Spikes מאלקטרוני Cryotomography שחזור באמצעות Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

קביעת ריכוז נגיפית באמצעות לוחית מבחני: מערכות כיסוי שימוש מסורתיות וחדשני

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

גילוי גליקוגן בתאי הדם היקפי mononuclear עם תקופתי חומצה שיף מכתים

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

ניצול capsid על-התאגדות האסטרטגיה Antigen לפיתוח גישות Adenovirus סרוטיפ 5-וקטורי חיסון

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

התפתחות Lyophilized Loop בתיווך ריאגנטים הגברה איזו תרמים לצורך זיהוי של<em&gt; Burnetii Coxiella</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

שיטת הדגימה ספוגית לצורך זיהוי של norovirus האדם על משטחים

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

שיטות ויטרו להשוואת יעד מחייב CDC אינדוקציה בין נוגדנים טיפוליים: יישומים ניתוח Biosimilarity

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...