Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

इस कार्य को कृषि एवं खाद्य अनुसंधान पहल प्रतियोगी अनुदान सं 2011-68003-30395 द्वारा संयुक्त राज्य कृषि विभाग, राष्ट्रीय खाद्य एवं कृषि संस्थान, NoroCORE परियोजना के माध्यम से समर्थित किया गया । संयुक्त राज्य कृषि विभाग द्वारा ओपन एक्सेस चार्ज के लिए फंडिंग प्रदान की गई । हम रॉबर्ट अतमार (चिकित्सा, ह्यूस्टन, TX के Baylor कॉलेज) शुक्रिया अदा करना चाहूंगा के लिए कृपया हमें शुद्ध capsids और वैलेरी Lapham के साथ उसकी सहायता के लिए उपलब्ध कराने के उनि छवियां । हम भी हमें प्रस्तुत प्रयोगों शुरू करने में मदद करने के लिए फ्रैंक एन बैरी शुक्रिया अदा करना चाहूंगा ।

1. उच्च क्रम के नुकसान के मूल्यांकन के लिए प्लेट आधारित बाध्यकारी परख नोरोवायरस कैप्सिड संरचना नोट: यहाँ प्रस्तुत किए गए एक बहुत ही ELASA प्रोटोकॉल को प्रकाशित किया गया है < सुप class = "xref" > 29 , और इ?...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

प्रोटोकॉल और तकनीक यहां वर्णित मानव नोरोवायरस कैप्सिड अखंडता का आकलन करने का एक साधन प्रदान/ इन तरीकों वायरस के खिलाफ निष्क्रियता उपचार के प्रभाव में यंत्रवत अंतर्दृष्टि प्राप्त करने के लिए इस्तेमा?...

मानव नोरोवायरस एक काफी सार्वजनिक स्वास्थ्य के बोझ के लिए दुनिया भर में जिंमेदार है, के बारे में ६८५,०००,००० बीमारियों और २१२,००० की मृत्यु प्रतिवर्ष1, डॉलर के अरबों में एक लागत पर2,3। आज, नोरोवायरस का पता लगाने और ठहराव जीनोम प्रवर्धन और/या ligand आधारित प्लेटफार्मों शामिल है । पूर्व आम तौर पर पसंद किया जाता है के रूप में यह अधिक संवेदनशील है, मात्रात्मक जानकारी प्रदान करता है, और आम तौर पर झूठी सकारात्मक परिणाम के कम जोखिम है4। सबसे आम नोरोवायरस डिटेक्शन और ठहराव जीनोम प्रवर्धन तकनीक रिवर्स transcriptase मात्रात्मक पोलीमरेज़ श्रृंखला प्रतिक्रिया (RT-qPCR) है । क्योंकि यह लक्ष्य और मानव नोरोवायरस जीनोम के एक छोटे से खंड प्रवर्धित, RT-अकेले qPCR संक्रामक और गैर संक्रामक कणों के बीच भेदभाव करने में सक्षम नहीं है, मुक्त जीनोमिक आरएनए के रूप में, क्षतिग्रस्त capsids युक्त जीनोम, और capsids के साथ घातक रूपांतरित/छोटे जीनोम अभी भी RT-qPCR द्वारा परिलक्षित किया जा सकता है । जबकि दो नए इन विट्रो खेती तकनीक मानव नोरोवायरस के लिए5,6 हाल ही में सूचित किया गया है, दोनों अभी भी qPCR पर निर्भर वायरस ठहराव के लिए और अभी तक व्यवहार्य तरीके नियमित नैदानिक के लिए नहीं कर रहे है/ मानव noroviruses के लिए परीक्षण । इस प्रकार, RT-qPCR नैदानिक/पर्यावरणीय परीक्षण के लिए स्वर्ण मानक रहता है ।
अन्य इन विट्रो विधियों में एक बेहतर नोरोवायरस कणों की infectivity स्थिति का अनुमान लगाने के प्रयास में विकसित किया गया है. इन तरीकों आम तौर पर उन है कि नोरोवायरस कैप्सिड की अखंडता का पता और जीनोम अखंडता का मूल्यांकन उन के रूप में वर्गीकृत किया जा सकता है । पूर्व दृष्टिकोण अधिक लोकप्रिय है । एक सामांय रूप से इस्तेमाल किया विधि वायरल जीनोमिक आरएनए के निष्कर्षण से पहले RNase है, लेकिन यह वायरल कणों कि बरकरार रहने के लिए खाता नहीं है, लेकिन मेजबान रिसेप्टर्स/सह कारकों, साथ ही वायरल कणों कि घातक रूप से रूपांतरित किया है बांध करने की क्षमता का अभाव है या काट दिया है या मामूली क्षतिग्रस्त जीनोम7। कैप्सिड अखंडता भी मानव नोरोवायरस सह रिसेप्टर/सह कारकों, जो histo-रक्त समूह एंटीजन (HBGAs) के रूप में जाना जाता है कार्बोहाइड्रेट के लिए बाइंड करने के लिए वायरस की क्षमता के आधार पर मूल्यांकन किया जा सकता है । HBGAs (कई अन्य ऊतकों के बीच) नच या glycolipids के भाग के रूप में मेजबान आंत्र उपकला कोशिकाओं में मौजूद हैं और लार की तरह शारीरिक तरल पदार्थ में स्रावित किया जा सकता है । अपनी सतहों पर HBGA पदार्थों से युक्त प्रवेश बैक्टीरिया भी मानव नोरोवायरस8,9,10बांध दिखाया गया है, और इस तरह की बातचीत नोरोवायरस संक्रमण5को बढ़ावा कर सकते हैं । HBGA बाध्यकारी के उपयोग की मूल अवधारणा यह है कि केवल वायरल कणों ख्यात रिसेप्टर बाध्यकारी/सह कारक कोशिकाओं को संक्रमित करने में सक्षम होगा । एकाधिक अध्ययनों से पता चलता है कि मनका आधारित HBGA बंधन पूर्ववर्ती न्यूक्लिक एसिड प्रवर्धन infectivity भेदभाव के लिए एक होनहार विधि है11,12,13,14, 15,16. HBGAs के संबंध में एक प्रमुख चुनौती यह है कि कोई भी HBGA प्रकार सभी मानव नोरोवायरस पादी बाँध सकता है. यह पता करने के लिए, सुअर गैस्ट्रिक mucin, जो HBGAs शामिल हैं, संश्लेषण, स्थिरता, और कम लागत की आसानी के हित में शुद्ध HBGA कार्बोहाइड्रेट के स्थान पर इस्तेमाल किया गया है.
मूर एट अल द्वारा हाल ही में एक प्रकाशन । 17 मानव नोरोवायरस कैप्सिड अखंडता का आकलन करने के लिए नई तकनीकों का एक सेट पेश किया । HBGAs, मूर एट अल के स्थान पर । 17 एक मोटे तौर पर प्रतिक्रियाशील न्यूक्लिक अम्ल aptamer (M6-2)18 और मोटे तौर पर प्रतिक्रियाशील मोनोक्लोनल एंटीबॉडी (NS14)19 को हीट-इलाज GII. 4 सिडनी नोरोवायरस capsids (वायरस की तरह कणों या VLPs) की जांच की बाध्यकारी और इस तुलना में सिंथेटिक HBGAs करने के लिए बाध्यकारी करने के लिए । न्यूक्लिक एसिड aptamers कम कर रहे है (~ 20-80 nt) एकल असहाय न्यूक्लिक एसिड (ssDNA या आरएनए) है कि उनके अनुक्रम का एक परिणाम के रूप में अद्वितीय तीन आयामी संरचनाओं में गुना और एक लक्ष्य बांध । क्योंकि वे न्यूक्लिक एसिड होते हैं, वे कम महंगा है; आसानी से रासायनिक संश्लेषित, शुद्ध, और संशोधित; और स्थिर करने के लिए गर्मी । noroviruses के खिलाफ उत्पंन aptamers की कई रिपोर्टों मौजूद हैं, उनमें से कुछ उपभेदों18,20,21,22की एक किस्म के लिए व्यापक जेट दिखा । उदाहरण के माध्यम से, मूर एट अल । 17 का प्रदर्शन किया है कि aptamer M6-2 को शुद्ध, इकट्ठे मानव नोरोवायरस capsids (VLPs) और वायरल HBGA पर निर्भरता में कैप्सिड करने के लिए उच्च क्रम (उदा, माध्यमिक और तृतीयक) प्रोटीन संरचना बनाए रखने के लिए इसी तरह व्यवहार किया होने के लिए बाध्य । दूसरी ओर, नोरोवायरस VLP के एक महत्वपूर्ण अनुपात एंटीबॉडी NS14 के लिए बाध्यकारी capsids के बाद बने रहे थे पूरी तरह से विकृत । नोरोवायरस का मूल्यांकन मूर एट अल द्वारा अध्ययन में बाध्यकारी । 17 एक सरल, प्लेट-आधारित एलिसा के समान विधि का उपयोग किया गया था, अपवाद है कि aptamers एंटीबॉडी के स्थान पर उपयोग किया जाता है के साथ (इसलिए विधि ELASA कहा जाता था) । इस उच्च प्रवाह प्रयोगात्मक विधि नोरोवायरस कैप्सिड, काम है कि शारीरिक या रासायनिक तनाव के संपर्क पर वायरल निष्क्रियता के तंत्र को समझने के लिए मूल्यवान है पर विभिंन उपचार के प्रभाव का मूल्यांकन करने के लिए इस्तेमाल किया गया था । हालांकि, इस विधि के लिए एक दोष कम संवेदनशीलता और मैट्रिक्स के लिए सहिष्णुता की कमी है, उच्च स्तर पर जुड़े संदूषणों कि कारण गैर aptamers द्वारा विशेष बाध्यकारी ।
मूर एट अल । 17 एक और विधि, गतिशील प्रकाश कैटरिंग (DLS), गर्मी उपचार के जवाब में वायरल कणों के एकत्रीकरण की निगरानी करने के लिए इस्तेमाल किया । DLS आमतौर पर nanoparticle सस्पेंशन के आकार का मूल्यांकन करने के लिए प्रयोग किया जाता है और प्रोटीन के लिए विस्तारित किया गया है23,24 और वायरस25,26,27. कण आकार के एक समारोह के रूप में हल में कणों से बिखरे हुए प्रकाश की तीव्रता, प्रसार गुणांक की गणना के लिए अनुमति देता है और फिर कण व्यास अच्छी तरह से स्थापित सूत्र का उपयोग कर । DLS तकनीक फैलाया कणों के hydrodynamic व्यास नीचे नेनो, जो फैलाया वायरस, व्यक्तिगत कैप्सिड प्रोटीन या dimers का पता लगाने की अनुमति देता है, और वायरस समुच्चय आकार27के आधार पर भेद कर सकते हैं । वायरस एकत्रीकरण, कण आकार में वृद्धि के द्वारा प्रतिनिधित्व किया, कैप्सिड अखंडता की हानि का संकेत है । के रूप में कैप्सिड विकृत और उसकी संरचना बाधित है, hydrophobic अवशेषों को उजागर हो और कणों के साथ रहना और समुच्चय के रूप में पैदा होता है । DLS एक निर्दिष्ट उपचार या वास्तविक समय17,28में एकत्रीकरण के कैनेटीक्स के बाद कण आकार को मापने के लिए इस्तेमाल किया जा सकता है । इस विधि समाधान में कैप्सिड व्यवहार के अवलोकन की अनुमति देने का लाभ है, लेकिन शुद्ध कैप्सिड की उच्च सांद्रता की आवश्यकता है, जो पूरी तरह से अपने प्राकृतिक राज्य में वायरस के प्रतिनिधि नहीं हो सकता है ।
अंतिम मूर एट अल द्वारा उपयोग विधि । 17 ट्रांसमिशन इलेक्ट्रॉन माइक्रोस्कोपी (उनि) था । हालांकि इस विधि संवेदनशीलता का अभाव है और मात्रात्मक डेटा का उत्पादन नहीं करता है, यह वायरल कैप्सिड संरचना पर विभिन्न उपचार के प्रभाव के दृश्य के लिए अनुमति देता है । हालांकि नैदानिक/पर्यावरण सेटिंग्स के लिए अभी तक आदर्श नहीं, संयोजन में इन तरीकों का उपयोग मानव नोरोवायरस निष्क्रियता को समझने में मूल्यवान है । इस अनुच्छेद के प्रयोजन के लिए थाली के लिए गहराई प्रोटोकॉल में प्रदान करना है बाध्यकारी परख (ELASA), DLS, और उनि तैयारी के लिए उपचार के संदर्भ में नोरोवायरस कैप्सिड पर गर्मी उपचार के प्रभाव की जांच तरीकों का इस्तेमाल किया कैप्सिड पर प्रभाव अखंडता के रूप में मूर एट अल में प्रस्तुत किया । 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

मानव नोरोवायरस काफी सार्वजनिक स्वास्थ्य और आर्थिक नुकसान दुनिया भर में सटीक । इन विट्रो में उभरते खेती अग्रिम अभी तक वायरस की दिनचर्या का पता लगाने के लिए लागू नहीं कर रहे हैं । वर्तमान पता लगाने और ठहराव तकनीक है, जो न्यूक्लिक एसिड प्रवर्धन पर मुख्य रूप से निर्भर करते हैं, गैर संक्रामक वायरल कणों से संक्रामक भेदभाव नहीं है । इस अनुच्छेद के प्रयोजन के लिए एक साथ इस्तेमाल किया तकनीक में हाल के अग्रिमों पर विशिष्ट विवरण मौजूद है ताकि वायरल कणों के infectivity स्थिति पर और अधिक जानकारी प्राप्त करने के लिए । एक तकनीक capsids के लिए एक नोरोवायरस ssDNA aptamer के बंधन का आकलन शामिल है । Aptamers आसानी से संश्लेषित और संशोधित किया जा रहा है का लाभ है, और सस्ती और स्थिर हैं । एक अंय तकनीक, गतिशील प्रकाश कैटरिंग (DLS), समाधान में कैप्सिड व्यवहार देख के लाभ है । इलेक्ट्रॉन माइक्रोस्कोपी वायरल capsids के संरचनात्मक अखंडता के दृश्य के लिए अनुमति देता है । हालांकि वादा किया है, वहां एक तकनीक के लिए कुछ कमियां हैं, जैसे गैर विशिष्ट aptamer नमूना मैट्रिक्स से अणुओं के आरोप को बाध्यकारी, DLS के लिए शुद्ध कैप्सिड की आवश्यकता है, और इलेक्ट्रॉन माइक्रोस्कोपी के लिए गरीब संवेदनशीलता । फिर भी, जब इन तकनीकों के संयोजन में उपयोग किया जाता है, डेटा का उत्पादन शरीर नोरोवायरस कैप्सिड अखंडता पर अधिक व्यापक जानकारी प्रदान करता है कि infectivity अनुमान, जानकारी है जो सटीक मूल्यांकन के लिए आवश्यक है के लिए इस्तेमाल किया जा सकता है निष्क्रियता तरीकों या वायरस का पता लगाने की व्याख्या । यह आलेख इन विधियों में भेदभाव संक्रामक मानव नोरोवायरस कणों का उपयोग करने के लिए प्रोटोकॉल प्रदान करता है ।

मानव नोरोवायरस GII .4 सिडनी capsids (VLPs) के संरचनात्मक अखंडता के रूप में मूर एट अल द्वारा प्रस्तुत कई उपंयास तरीकों का उपयोग कर मूल्यांकन किया गया था । 17. सबसे पहले, एक प्रयोग किया गया था ज?...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

नियमित पहचान वायरल जीनोम प्रवर्धन का उपयोग तरीके उनके गैर संक्रामक कणों से संक्रामक भेदभाव करने में असमर्थता से सीमित हैं । इस लेख का उद्देश्य aptamer बाध्यकारी, गतिशील प्रकाश बिखरने, और संचरण इलेक्ट्रॉन माइक्रोस्कोपी का उपयोग कर संक्रामक नोरोवायरस कणों के भेदभाव में सहायता करने के लिए वैकल्पिक तरीकों के लिए विस्तृत प्रोटोकॉल प्रदान करने के लिए है ।

वैकल्पिक इन विट्रो तरीके वायरल कैप्सिड संरचनात्मक अखंडता के निर्धारण के लिए

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

क्रायो - इलेक्ट्रॉन माइक्रोस्कोपी द्वारा एचआईवी -1 capsid विधानसभाओं की संरचना और चलने का पेचदार रियल अंतरिक्ष पुनर्निर्माण

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Polarized मानव airway के एक तरल से ढके संस्कृति की स्थापना उपकला Calu 3 मेजबान सेल श्वसन रोगज़नक़ों रिस्पांस कोशिकाओं के अध्ययन<em&gt; इन विट्रो में</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

कुल प्रोटीन निष्कर्षण और 2 डी जेल वैद्युतकणसंचलन तरीके के लिए<em&gt; Burkholderia</em&gt; प्रजाति

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Jsubtomo का उपयोग इलेक्ट्रॉन Cryotomography पुनर्निर्माण से वायरल लिफाफा ग्लाइकोप्रोटीन spikes के औसत

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

का प्रयोग पारंपरिक और उपन्यास ओवरले सिस्टम: पट्टिका assays के माध्यम से वायरल एकाग्रता दृढ़ संकल्प

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

समय-समय पर एसिड शिफ़ धुंधला के साथ परिधीय रक्त कोशिकाओं mononuclear में ग्लाइकोजन का पता लगाने के

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

Adenovirus सीरोटाइप 5-vectored वैक्सीन दृष्टिकोण के विकास के लिए एंटीजन Capsid-निगमन रणनीति का उपयोग

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

की जांच के लिए Lyophilized लूप की मध्यस्थता इज़ोटेर्माल प्रवर्धन अभिकर्मकों का विकास<em&gt; Coxiella burnetii</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

पर सतहों मानव Norovirus की जांच के लिए स्वाब नमूने विधि

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

चिकित्सीय एंटीबॉडी के बीच लक्ष्य बाध्यकारी और सीडीसी प्रेरण की तुलना करने के लिए विट्रो विधि में: बायोसमिलाइटी विश्लेषण में अनुप्रयोग

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...