Name: alternative in vitro methods for the determination of viral capsid structural integrity
Uploaded: 2017-11-16T15:00:00
Description: Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

이 작품은 NoroCORE 프로젝트를 통해 농업 및 식품 연구 주도권 경쟁 부여 번호 2011-68003-30395 미국 농 무부, 식품 및 농업에 의해 지원 되었다. 오픈 액세스 비용 자금 미국 농 무부에 의해 제공 했다. 우리는 로버트 Atmar (베일 러 대학의과 대학, 휴스턴, TX) 친절 하 게 우리가 제공 하 고 순화 capsids 발레리 라 팜 가장 이미지와 함께 그녀의 지원에 대 한 감사 하 고 싶습니다. 우리는 또한 제시 하는 실험을 시작 하는 데 도움에 대 한 프랭크 N. 배리 감사 하 고 싶습니다.

1. 구조에 대 한 평가 손실의 더 높은 순서 노로바이러스 Capsid 바인딩 분석 결과 플레이트 기반 참고: 여기에 매우 비슷한 ELASA 프로토콜 게시 29 되었습니다 그리고 유사한 ELASA 분석 이전 연구의 일부 기사 17 , , 18 22 다른 곳으로 보고 되었습니다.
<ol><li>인간의 노로바이러스 GII...

<ol>
	<li>Kirk, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=World+Health+Organization+estimates+of+the+global+and+regional+disease+burden+of+11+foodborne+bacterial,+protozoal,+and+viral+diseases,+2010:+A+data+synthesis.">World Health Organization estimates of the global and regional disease burden of 11 foodborne bacterial, protozoal, and viral diseases, 2010: A data synthesis.</a> PLOS Med. 12 (12), e1001920 (2015).</li><li>Scharff, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+burden+from+health+losses+due+to+foodborne+illness+in+the+United+States.">Economic burden from health losses due to foodborne illness in the United States.</a> J. Food Prot. 75 (1), 123-131 (2012).</li><li>Lee, B. Y., Mcglone, S. M., Bailey, R. R., Zachary, S., Umscheid, C. A., Muder, R. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Economic+impact+of+outbreaks+of+norovirus+infection+in+hospitals.">Economic impact of outbreaks of norovirus infection in hospitals.</a> Infect. Control Hosp. Epidemiol. 32 (2), 191-193 (2011).</li><li>Law, J. W. -. F., Ab Mutalib, N. -. S., Chan, K. -. G., Lee, L. -. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+methods+for+the+detection+of+foodborne+bacterial+pathogens:+principles,+applications,+advantages+and+limitations.">Rapid methods for the detection of foodborne bacterial pathogens: principles, applications, advantages and limitations.</a> Front. Microbiol. 5, 770 (2015).</li><li>Jones, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteric+bacteria+promote+human+and+mouse+norovirus+infection+of+B+cells.">Enteric bacteria promote human and mouse norovirus infection of B cells.</a> Science. 346 (6210), 755-759 (2014).</li><li>Ettayebi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Replication+of+human+noroviruses+in+stem+cell+-+derived+human+enteroids.">Replication of human noroviruses in stem cell - derived human enteroids.</a> Science. 5211, (2016).</li><li>Moore, M. D., Goulter, R. M., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+as+a+foodborne+pathogen:+challenges+and+developments.">Human norovirus as a foodborne pathogen: challenges and developments.</a> Annu. Rev. Food Sci. Technol. 6 (1), 411-433 (2015).</li><li>Miura, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Histo-blood+group+antigen-like+substances+of+human+enteric+bacteria+as+specific+adsorbents+for+human+noroviruses.">Histo-blood group antigen-like substances of human enteric bacteria as specific adsorbents for human noroviruses.</a> J. Virol. 87 (17), 9441-9451 (2013).</li><li>Almand, E. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+binding+to+select+bacteria+representative+of+the+human+gut+microbiota.">Human norovirus binding to select bacteria representative of the human gut microbiota.</a> Plos One. 12 (3), e0173124 (2017).</li><li>Rubio-del-Campo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noroviral+P-Particles+as+an+in+vitro+model+to+assess+the+interactions+of+noroviruses+with+probiotics.">Noroviral P-Particles as an in vitro model to assess the interactions of noroviruses with probiotics.</a> PLoS ONE. 9 (2), e89586 (2014).</li><li>Hirneisen, K. A., Kniel, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+ELISA+attachment+and+infectivity+assays+for+murine+norovirus.">Comparison of ELISA attachment and infectivity assays for murine norovirus.</a> J. Virol. Methods. 186 (1-2), 14-20 (2012).</li><li>Dancho, B. A., Chen, H., Kingsley, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discrimination+between+infectious+and+non-infectious+human+norovirus+using+porcine+gastric+mucin.">Discrimination between infectious and non-infectious human norovirus using porcine gastric mucin.</a> Int. J. Food Microbiol. 155 (3), 222-226 (2012).</li><li>Li, X., Chen, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+the+porcine+gastric+mucin+binding+assay+for+high-pressure-inactivation+studies+using+murine+norovirus+and+Tulane+virus.">Evaluation of the porcine gastric mucin binding assay for high-pressure-inactivation studies using murine norovirus and Tulane virus.</a> Appl. Environ. Microbiol. 81 (2), 515-521 (2015).</li><li>Lou, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+inactivation+of+human+norovirus+virus-like+particles+provides+evidence+that+the+capsid+of+human+norovirus+is+highly+pressure+resistant.">High-pressure inactivation of human norovirus virus-like particles provides evidence that the capsid of human norovirus is highly pressure resistant.</a> Appl. Environ. Microbiol. 78 (15), 5320-5327 (2012).</li><li>Wang, D., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+conditions+for+human+norovirus+measured+by+an+in+situ+capture-qRT-PCR+method.">Inactivation conditions for human norovirus measured by an in situ capture-qRT-PCR method.</a> Int. J. Food Microbiol. 172, 76-82 (2014).</li><li>Wang, D., Xu, S., Yang, D., Young, G. M., Tian, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+in+situ+capture+quantitative+(real-time)+reverse+transcription-PCR+method+as+an+alternative+approach+for+determining+inactivation+of+Tulane+virus.">New in situ capture quantitative (real-time) reverse transcription-PCR method as an alternative approach for determining inactivation of Tulane virus.</a> Appl. Environ. Microbiol. 80 (7), 2120-2124 (2014).</li><li>Moore, M. D., Bobay, B. G., Mertens, B., Jaykus, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+norovirus+aptamer+exhibits+high+degree+of+target+conformation-dependent+binding+similar+to+that+of+receptors+and+discriminates+particle+functionality.">Human norovirus aptamer exhibits high degree of target conformation-dependent binding similar to that of receptors and discriminates particle functionality.</a> mSphere. 1 (6), e00298-e00216 (2016).</li><li>Moore, M. D., Escudero-Abarca, B. I., Suh, S. H., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+and+characterization+of+nucleic+acid+aptamers+targeting+the+capsid+P+domain+of+a+human+norovirus+GII.4+strain.">Generation and characterization of nucleic acid aptamers targeting the capsid P domain of a human norovirus GII.4 strain.</a> J. Biotechnol. 209, 41-49 (2015).</li><li>Kitamoto, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-Reactivity+among+Several+Recombinant+Calicivirus+Virus-Like+Particles+(VLPs)+with+Monoclonal+Antibodies+Obtained+from+Mice+Immunized+Orally+with+One+Type+of+VLP.">Cross-Reactivity among Several Recombinant Calicivirus Virus-Like Particles (VLPs) with Monoclonal Antibodies Obtained from Mice Immunized Orally with One Type of VLP.</a> J. Clin. Microbiol. 40 (7), 2459-2465 (2002).</li><li>Giamberardino, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrasensitive+norovirus+detection+using+DNA+aptasensor+technology.">Ultrasensitive norovirus detection using DNA aptasensor technology.</a> PloS one. 8 (11), e79087 (2013).</li><li>Beier, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+a+DNA+aptamer+against+norovirus+capsid+protein+VP1.">Selection of a DNA aptamer against norovirus capsid protein VP1.</a> FEMS Microbiol. Lett. 351 (2), 162-169 (2014).</li><li>Escudero-Abarca, B. I., Suh, S. H., Moore, M. D., Dwivedi, H. P., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection,+characterization+and+application+of+nucleic+acid+aptamers+for+the+capture+and+detection+of+human+norovirus+strains.">Selection, characterization and application of nucleic acid aptamers for the capture and detection of human norovirus strains.</a> PloS one. 9 (9), e106805 (2014).</li><li>Bhattacharjee, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DLS+and+zeta+potential+-+What+they+are+and+what+they+are+not?.">DLS and zeta potential - What they are and what they are not?.</a> Journal Control. Release. 235, 337-351 (2016).</li><li>Khodabandehloo, A., Chen, D. D. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Particle+sizing+methods+for+the+detection+of+protein+aggregates+in+biopharmaceuticals.">Particle sizing methods for the detection of protein aggregates in biopharmaceuticals.</a> Bioanalysis. 9 (3), 313-326 (2017).</li><li>Mattle, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+virus+aggregation+on+inactivation+by+peracetic+acid+and+implications+for+other+disinfectants.">Impact of virus aggregation on inactivation by peracetic acid and implications for other disinfectants.</a> Environ. Sci. Technol. 45, 7710-7717 (2011).</li><li>Samandoulgou, I., Fliss, I., Jean, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zeta+potential+and+aggregation+of+virus-like+particle+of+human+norovirus+and+feline+calicivirus+under+different+physicochemical+conditions.">Zeta potential and aggregation of virus-like particle of human norovirus and feline calicivirus under different physicochemical conditions.</a> Food Environ. Virol. 7 (3), 249-260 (2015).</li><li>Mertens, B. S., Velev, O. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Soft+matter+norovirus+interactions.">Soft matter norovirus interactions.</a> Soft Matter. 11, 8621-8631 (2015).</li><li>Panyukov, Y., Yudin, I., Drachev, V., Dobrov, E., Kurganov, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+study+of+amorphous+aggregation+of+tobacco+mosaic+virus+coat+protein+by+dynamic+light+scattering.">The study of amorphous aggregation of tobacco mosaic virus coat protein by dynamic light scattering.</a> Biophys. Chem. 127 (1-2), 9-18 (2007).</li><li>Moore, M. D., Escudero-Abarca, B. I., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Enzyme-Linked+Aptamer+Sorbent+Assay+to+Evaluate+Aptamer+Binding.">An Enzyme-Linked Aptamer Sorbent Assay to Evaluate Aptamer Binding.</a> Methods in Molecular Biology. 1575, 291-302 (2017).</li><li>Langlet, J., Gaboriaud, F., Gantzer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+pH+on+plaque+forming+unit+counts+and+aggregation+of+MS2+bacteriophage.">Effects of pH on plaque forming unit counts and aggregation of MS2 bacteriophage.</a> J. Appl. Microbiol. 103, 1632-1638 (2007).</li><li>Manuel, C. S., Moore, M. D., Jaykus, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Destruction+of+the+Capsid+and+Genome+of+GII.4+Human+Norovirus+Occurs+during+Exposure+to+Metal+Alloys+Containing+Copper.">Destruction of the Capsid and Genome of GII.4 Human Norovirus Occurs during Exposure to Metal Alloys Containing Copper.</a> Appl. Environ. Microbiol. 81 (15), 4940-4946 (2015).</li><li>Warnes, S. L., Summersgill, E. N., Keevil, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+murine+norovirus+on+a+range+of+copper+alloy+surfaces+is+accompanied+by+loss+of+capsid+integrity.">Inactivation of murine norovirus on a range of copper alloy surfaces is accompanied by loss of capsid integrity.</a> Appl. Environ. Microbiol. , (2014).</li><li>Manuel, C., Moore, M. D., Jaykus, L. -. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficacy+of+a+disinfectant+containing+silver+dihydrogen+citrate+against+GI.6+and+GII.4+human+norovirus.">Efficacy of a disinfectant containing silver dihydrogen citrate against GI.6 and GII.4 human norovirus.</a> J. Appl. Microbiol. 122 (1), 78-86 (2017).</li><li>Green, N. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avidin+and+streptavidin.">Avidin and streptavidin.</a> Methods Enzymol. 184, 51-67 (1990).</li><li>Kingsley, D. H., Vincent, E. M., Meade, G. K., Watson, C. L., Fan, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+human+norovirus+using+chemical+sanitizers.">Inactivation of human norovirus using chemical sanitizers.</a> Int. J. Food Microbiol. 171, 94-99 (2014).</li><li>Tian, P., Yang, D., Quigley, C., Chou, M., Jiang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inactivation+of+the+Tulane+virus,+a+novel+surrogate+for+the+human+norovirus.">Inactivation of the Tulane virus, a novel surrogate for the human norovirus.</a> J. Food Prot. 76 (4), 712-718 (2013).</li><li>Li, D., Baert, L., Van Coillie, E., Uyttendaele, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Critical+studies+on+binding-based+RT-PCR+detection+of+infectious+noroviruses.">Critical studies on binding-based RT-PCR detection of infectious noroviruses.</a> J. Virol. Methods. 177 (2), 153-159 (2011).</li></ol>

프로토콜 및 여기에 설명 된 기술을 인간의 노로바이러스 capsid 무결성/기능을 평가 하는 수단을 제공 합니다. 이러한 방법은 기계적 통찰력 비활성화는 바이러스에 대 한 치료의 효과 얻기 위해 사용할 수 있습니다 그리고 잠재적으로 더 전통적인 비활성화 평가 방법 RT 정량 또는 상 패 분석 결과 등을 보충할 수 있다. 예를 들어, 혼자 패 분석 실험에 의해 화학적 또는 물리적 비활성화의 평가 바?...

인간의 노로바이러스는 상당한 공중 보건 부담에 대 한 세계적으로, 대략 685 백만 질병 및 212,000의 죽음을 일으키는 매년1, 수십억 달러2,3의 비용에. 오늘, 노로바이러스 검출 및 정량화 게놈 증폭 및 리간드 기반 플랫폼 포함 됩니다. 이전은 일반적으로 선호 더 민감한, 양적 정보를 제공 하는 거짓 긍정적인 결과4의 일반적으로 낮은 위험이 있다. 가장 일반적인 노로바이러스 검출 및 정량화 게놈 증폭 기술은 역전사 정량적 중 합 효소 연쇄 반응 (RT-정량) 이다. 때문에 대상 인간의 노로바이러스 게놈의 작은 세그먼트를 증폭, RT-정량 혼자는 감염 사이 차별의 수와 비 전염 성 입자, 무료 게놈 RNA로 손상 capsids 게놈를 포함 하 고와 capsids 치명적 유전자 돌연변이 잘립니다 여전히 실시간 정량 Pcr에 의해 증폭 될 수 있습니다. 두 가지 새로운 체 외에서 재배 방법을 인간 노로바이러스5,6 최근에 보고 되었다, 그러나 둘 다 여전히 바이러스 정량화에 대 한 실시간 정량에 의존 하 고는 아직 일상적인 임상/환경에 대 한 실현 방법 인간의 noroviruses에 대 한 테스트. 따라서, 실시간 정량 임상/환경 테스트에 대 한 황금 표준 남아 있습니다.
다른 시험관에 방법 더 나은 노로바이러스 입자의 infectivity 상태를 추정 하기 위해에서 개발 되었습니다. 이러한 메서드는 일반적으로 노로바이러스 capsid의 무결성 및 게놈 무결성 평가로 분류할 수 있습니다. 전 방식은 더 많은 인기입니다. 일반적으로 사용 되는 방법은 이전 바이러스 성 게놈 RNA의 추출 RNase 전처리 인데이 바이러스 성 입자를 그대로 유지 하지만 호스트 수용 체/공동-요인, 바인딩할 능력 부족 뿐만 아니라가지고 심각 하 게 변이 된 바이러스 성 입자에 대 한 고려 하지 않습니다 또는 잘린 또는 소폭 손상 유전자7. Capsid 무결성 또한 평가 될 수 있습니다 인간의 노로바이러스 공동-receptor/공동-요인, 탄수화물에 바인딩할 바이러스의 능력에 따라 histo 혈액 그룹 항 원 (HBGAs)로 알려진. HBGAs는 glycoproteins 또는 glycolipids (중 여러 다른 조직)의 일환으로 호스트 장 상피 세포에 존재 하 고 타 액 같은 체액에 분 비 될 수 있습니다. 그들의 표면에 HBGA 같은 물질을 포함 하는 장 박테리아도 인간의 노로바이러스8,,910, 바인딩할 표시 되었습니다 그리고 그런 상호 작용 노로바이러스 감염5를 홍보 수 있습니다. HBGA 바인딩을 활용의 기본 개념은 세포를 감염 바이러스 성 입자는 상 상속 수용 체/공동-factor를 바인딩 수만 가능할. 여러 연구 제안 구슬 기반 HBGA 바인딩 선행 하는 핵 산 증폭 infectivity 차별11,12,,1314, 유망한 방법입니다. 15,16. HBGAs에 대 한 주요 도전이 이다 단일 HBGA 형식이 없으므로 모든 인간의 노로바이러스 genotypes을 바인딩할 수 있습니다. 이 해결 하기 위해 돼지 위 mucin, HBGAs를 포함 하는 합성, 일관성, 그리고 비용 절감된의 용이성을 위하여 순화 HBGA 탄수화물 대신 사용 되었습니다.
무어 그 외 여러분 에 의해 최근 간행물 17 인간 노로바이러스 capsid 무결성을 추정 하기 위한 새로운 기술 세트를 소개 했다. HBGAs, 무어 외. 대신 17 광범위 하 게 반응 핵 산 aptamer (M6-2)18 및 열 처리 GII.4 시드니 노로바이러스 capsids 바이러스 같은 입자 (VLPs)를 광범위 하 게 반응 단일 클론 항 체 (NS14)19 바인딩을 조사 하 고이 비교 합성 HBGAs binding입니다. 핵 산 aptamers는 짧은 (20 ~ 80 nt) 단일 좌초 핵 산 (ssDNA 또는 RNA) 순서 결과로 고유한 3 차원 구조로 이동 하 고 바인딩 대상. 왜냐하면 그들은 핵 산, 그들은 더 적은 비용; 쉽게 화학적 합성, 정제, 수정; 고 열에 안정. Aptamers noroviruses에 대 한 생성의 몇 가지 보고서 존재, 그들 중 일부와 함께 다양 한 변종18,20,,2122광범위 한 반응성을 보여주는. 예를 들어, 무어 외. 17 그 aptamer M6 2 순화, 조립 인간의 노로바이러스 capsids (VLPs)에 바인딩된와 마찬가지로 HBGA에 대 한 더 높은 순서 (예를 들어, 2 차 및 3 차) 단백질 구조를 유지 하기 위해 바이러스 성 capsid에 대 한 의존도에 행동 시연 발생 하는 바인딩. 다른 한편으로, 노로바이러스 VLP 바인딩 항 체의 상당한 비율이 NS14 후 남아 capsids 변성 완전히 했다. 노로바이러스 바인딩 무어 외에 의해 연구에서의 평가 17 이루어졌다 aptamers 항 체 대신 사용 하는 예외와 유사한 ELISA, 간단 하 고, 플레이트 기반 메서드를 사용 하 (따라서 메서드가 호출 ELASA). 이 높은 처리량 실험적인 방법 노로바이러스 capsid, 물리적 또는 화학적 스트레스에 노출 되 면 바이러스 성 비활성화의 메커니즘을 이해 하기 위한 귀중 한 작품에 다른 처리의 효과 평가 하기 위해 사용 되었다. 그러나,이 방법은 하나의 단점은 낮은 감도 일반적인 바인딩 aptamers에 의해 일으키는 원인이 되는 높은 수준에서 매트릭스 관련 오염 물질에 대 한 참을성의 부족입니다.
무어 외. 17 열 처리에 대 한 응답에서 바이러스 성 입자의 집계 모니터링 하 다른 방법, 동적 빛 산란 (DL)을 사용. DL은 일반적으로 나노 정지의 크기를 평가 하 고 단백질23,24 및 바이러스25,,2627확장 되었습니다. 솔루션에서 입자에 의해 뿌려 진 빛의 강도 확산 계수 그리고 확고 공식을 사용 하 여 입자 직경의 계산을 허용 하는 입자 크기의 기능으로 변동. DLS 기술은 분산 된 바이러스, 개별 capsid 단백질 또는 이합체, 크기27에 따라 바이러스 집계의 검출을 허용 하는 나노 스케일으로 분산 된 입자의 유체역학 직경을 구분할 수 있습니다. 바이러스 집계, 입자 크기의 증가 의해 표시 나타내는 capsid 무결성의 손실입니다. capsid 변성 및 구조 중단, 소수 성 잔류물 노출 되 고 함께 집계를 형성 하는 입자를 일으킬. DL은 지정된 치료 또는 실시간으로17,28집계의 활동 후 입자 크기를 측정 하기 위해 사용할 수 있습니다. 이 방법은 솔루션에서 capsid 행동의 관측을 허용의 이점이 있다 하지만 필요한 정화 capsid의 높은 농도 자연 상태에서 바이러스의 완전히 대표 하지 않을 수 있습니다.
마지막 방법은 무어 외 활용 17 전송 전자 현미경 (TEM) 했다. 이 방법은 감도 부족 하 고 양적 데이터를 생성 하지 않습니다, 하지만 그것은 바이러스 성 capsid 구조에 다른 처리의 효과의 시각화 수 있습니다. 비록 아직 임상/환경 설정에 대 한 좋지 않은, 조합에서 이러한 방법의 사용은 인간의 노로바이러스 비활성화 이해에 중요 합니다. 이 문서의 목적은 플레이트 기반 바인딩 분석 결과 (ELASA), DL에 대 한 깊이 있는 프로토콜을 제공 하 고 가장 준비 방법 하는 데 사용 capsid에 치료 효과의 맥락에서 노로바이러스 capsid에 열 치료의 효과 조사 무결성 무어 외 에 제시 17.

<table>
	<tbody>
		<tr>
			<td>Plate-Based Binding Assay for Evaluating Loss of Higher Order Norovirus Capsid Structure</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>96-well, medium-binding polystyrene EIA plate</td>
			<td>Fisher (Costar)</td>
			<td>07-200-36</td>
			<td></td>
		</tr>
		<tr>
			<td>Lid for 96-well plate</td>
			<td>Thermo Fisher</td>
			<td>3098</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraffin film (Parafilm)</td>
			<td>Thermo Fisher</td>
			<td>PM999</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2)</td>
			<td>Life Technologies</td>
			<td>20012-050</td>
			<td></td>
		</tr>
		<tr>
			<td>Polysorbate 20</td>
			<td>Sigma-Aldrich</td>
			<td>P9416</td>
			<td></td>
		</tr>
		<tr>
			<td>1x PBS (pH 7.2) + 0.05% Polysorbate 20</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Purified, assembled human norovirus GII.4 capsids</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Individual 0.2 ml PCR tubes</td>
			<td>Genesee Scientific</td>
			<td>22-154G</td>
			<td></td>
		</tr>
		<tr>
			<td>2 thermocyclers</td>
			<td>Bio-Rad</td>
			<td>1861096</td>
			<td></td>
		</tr>
		<tr>
			<td>Tabletop mini centrifuge</td>
			<td>Fisher Scientific</td>
			<td>12-006-901</td>
			<td></td>
		</tr>
		<tr>
			<td>Skim milk solids</td>
			<td>Thermo Fisher</td>
			<td>LP0031B</td>
			<td></td>
		</tr>
		<tr>
			<td>Synthetic histo-blood group type A disaccharide, biotinylated</td>
			<td>Glycotech</td>
			<td>01-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Biotinylated aptamer M6-2 (stock concentration 100 &#181;M in nuclease-free water): 5&#39;-/5Biosg/AGTATACGTATTACCTGCAGCTGGGAAGAGGTCCGGTAAATGCAGGGTCAGCCCGGAGAGCGATATCTCGGAGATCTTGC -3&#8217;</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin-horseradish peroxidase conjugate (ELISA grade), We use Life Technologies SNN2004</td>
			<td>Life Technologies</td>
			<td>SNN2004</td>
			<td></td>
		</tr>
		<tr>
			<td>3,3&#8217;,5,5&#8217;-tetramethylbenzidine (TMB) substrate, room temperature</td>
			<td>Thermo Fisher</td>
			<td>50-76-00</td>
			<td></td>
		</tr>
		<tr>
			<td>1 M phosphoric acid</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Microplate reader capable of reading 450 nm</td>
			<td>Tecan</td>
			<td>Infinite m200 Pro</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Analysis of Plate-Based Assay Results</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microsoft Excel or similar program</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Dynamic Light Scattering Experiments</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Zetasizer ZSP, or similar particle size analysis instrument</td>
			<td>Malvern Instruments</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex</td>
			<td>Fisher Scientifc</td>
			<td>02-215-365</td>
			<td></td>
		</tr>
		<tr>
			<td>Quartz cuvette</td>
			<td>Hellma</td>
			<td>104-002-10-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Small volume disposable cuvette (to reduce VLP use)</td>
			<td>Malvern Instruments</td>
			<td>ZEN0040</td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Transmission Electron Microscopy Sample Preparation</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nickel electron microscopy grids with carbon support film</td>
			<td>Ladd Research</td>
			<td>10880-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Self-closing reverse electron microscopy tweezers</td>
			<td>Ted Pella</td>
			<td>5372-NM</td>
			<td></td>
		</tr>
		<tr>
			<td>Qualitative filter paper</td>
			<td>Sigma-Aldrich (Whatman)</td>
			<td>WHA1002055</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass petri dishes</td>
			<td>Sigma-Aldrich</td>
			<td>BR455743</td>
			<td></td>
		</tr>
		<tr>
			<td>100 mM stock HEPES solution (pH 7.2)</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
		<tr>
			<td>2% uranyl acetate</td>
			<td>N/A</td>
			<td>N/A</td>
			<td></td>
		</tr>
	</tbody>
</table>

alternative in vitro methods for the determination of viral capsid structural integrity

인간의 노로바이러스 exacts 상당한 공중 보건 및 경제적 손실을 전세계. 생체 외에서 신흥 재배 발전 적용 되지 않습니다 아직 일상적인 바이러스의 검출에 대 한. 현재 탐지 및 정량화 기술, 핵 산 증폭에 주로 의존 하는 비 전염 성 바이러스 성 입자에서 전염 성 차별을 하지 않습니다. 이 문서의 목적은 최근 바이러스 성 입자의 infectivity 상태에 대 한 정보를 더 얻기 위해서는 함께 사용 되는 기술 발전에 구체적인 내용을 제시 하. 1 개의 기술은 capsids에 노로바이러스 ssDNA aptamer의 바인딩을 평가 포함 됩니다. Aptamers 쉽게 합성 하 고, 수정 되 고의 이점이 있고 저렴 하 고 안정적 이다. 또 다른 기술, 동적 빛 산란 (DL) 솔루션에서 capsid 행동 관찰의 이점이 있다. 전자 현미경 검사 법은 바이러스 성 capsids의 구조적 무결성의 시각화에 대 한 수 있습니다. 비록 유망한, 각 기술, 일반적인 aptamer 바인딩 같은 긍정적으로 위탁 한 분자를 샘플 행렬에서 DL에 대 한 정화 capsid의 요구와 가난한 감도 전자 현미경 검사 법에 대 한 몇 가지 단점이 있다. 그럼에도 불구 하 고, 조합에서 이러한 기술을 사용 하는 생산 데이터의 본문 보다 포괄적인 정보를를 제공 합니다 노로바이러스 capsid 무결성 infectivity의 정확한 평가 위해 필수적인 정보를 유추 하는 데 사용할 수 있습니다. 비활성화 방법 또는 바이러스 탐지의 해석입니다. 이 문서는 이러한 방법을 사용 하 여 인간의 노로바이러스 감염 입자를 차별에 대 한 프로토콜을 제공 합니다.

인간의 노로바이러스 GII.4 시드니 capsids (VLPs)의 구조적 무결성 무어 외 에 의해 발표로 여러 가지 새로운 방법을 사용 하 여 평가 했다 17. 먼저, 실험에서 행 해졌다는 상 상속 수용 체/공동 factor (HBGA) 또는 바인딩 ssDNA aptamer (M6-2)을 그들의 능력의 기능으로는 capsids의 무결성 비교 (그림 1). 표시 되는 결과 이전 무어 외. ?...

Watch this Scientific Journal Video about Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity at JoVE.com

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

일상적인 탐지 방법 바이러스 성 게놈 증폭을 이용 하는 비 전염 성 입자에서 전염 성 차별을 그들의 무 능력에 의해 제한 됩니다. 이 문서의 목적은 aptamer 바인딩, 동적 산란, 및 전송 전자 현미경 검사 법을 사용 하 여 감염 노로바이러스 입자의 차별에 도움이 다른 방법에 대 한 상세한 프로토콜을 제공 하는 것입니다.

대체 체 외에 바이러스 성 Capsid 구조적 무결성의 결정에 대 한 방법

Human norovirus exacts considerable public health and economic losses worldwide. Emerging in vitro cultivation advances are not yet applicable for routine ...

Research

JoVE Journal

Immunology and Infection

Alternative In Vitro Methods for the Determination of Viral Capsid Structural Integrity

Structure of HIV-1 Capsid Assemblies by Cryo-electron Microscopy and Iterative Helical Real-space Reconstruction

Cryo - 전자 현미경에 의해 HIV - 1 Capsid 어셈블리의 구조와 반복 나선형 실제 공간 재건

Cryo-electron microscopy (cryo-EM), combined with image processing, is an increasingly powerful tool for structure determination of macromolecular protein ...

연구

면역학 및 감염병학

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

양극화 인간기도 액체 덮인 문화를 구축 호흡기 병원균에 대한 숙주 세포 응답을 공부하는 상피 Calu-3 전지<em&gt; 체외에서</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

Total Protein Extraction and 2-D Gel Electrophoresis Methods for Burkholderia Species

총 단백질 추출 및 2-D 겔 전기 영동 방법에 대한<em&gt; Burkholderia의</em&gt; 종

The investigation of  the intracellular protein levels of bacterial species is of importance to  understanding the pathogenic mechanisms of diseases ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Jsubtomo을 사용하여 전자 Cryotomography 재건에서 바이러스 성 봉투 ​​당 단백질 스파이크의 평균화

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Viral Concentration Determination Through Plaque Assays: Using Traditional and Novel Overlay Systems

사용하여 전통과 소설 오버레이 시스템 : 플라크 분석 실험을 통해 바이러스 농도 결정

Plaque assays remain one of the most accurate methods for the direct quantification of infectious virons and antiviral substances through the counting of ...

Detecting Glycogen in Peripheral Blood Mononuclear Cells with Periodic Acid Schiff Staining

요오드 산 쉬프 염색 말초 혈액 단핵 세포에서 글리코겐을 감지

Periodic acid Schiff (PAS) staining is an immunohistochemical technique used on muscle biopsies and as a diagnostic tool for blood samples. ...

Utilizing the Antigen Capsid-Incorporation Strategy for the Development of Adenovirus Serotype 5-Vectored Vaccine Approaches

아데노 바이러스 혈청 형 5 된 벡터 백신 접근 방법의 개발을위한 항원 캡시드-설립 전략을 활용

Adenovirus serotype 5 (Ad5) has been extensively modified with traditional transgene methods for the vaccine development. The reduced efficacies of these ...

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

The Development of Lyophilized Loop-mediated Isothermal Amplification Reagents for the Detection of Coxiella burnetii

의 탐지를위한 동결 건조 루프 - 매개 등온 증폭 시약의 개발<em&gt; Coxiella burnetii의</em

Coxiella burnetii, the agent causing Q fever, is an obligate intracellular bacterium. PCR based diagnostic assays have been developed for detecting C. ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

표면에 인간의 노로 바이러스의 검출을위한 면봉 표본 추출 방법

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

In Vitro Methods for Comparing Target Binding and CDC Induction Between Therapeutic Antibodies: Applications in Biosimilarity Analysis

체외 방법에서 대상 바인딩 및 치료 항체 사이 CDC 유도 비교 : 응용 프로그램 생물학적 동등성 분석에

Therapeutic monoclonal antibodies (mAbs) are relevant to the treatment of different pathologies, including cancers. The development of biosimilar mAbs by ...