Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Wij danken de Cytometry faciliteit "CytoCell" (SFR Santé, Biogenouest, Nantes) voor deskundige technische bijstand. Wij danken ook al het personeel van de productie van recombinante eiwitten (P2R) en IMPACT platformen (INSERM 1232 SFR Santé, Biogenouest, Nantes) voor hun technische ondersteuning. Wij danken Emmanuel Scotet en Richard Breathnach voor constructieve opmerkingen over het manuscript. Dit werk werd financieel ondersteund door het IHU-Cesti project gefinancierd door de Franse regering «Investissements d'Avenir» programma, beheerd door de Franse nationale onderzoek Bureau (ANR) (ANR-10-IBHU-005). Het IHU-Cesti project wordt ook ondersteund door de Nantes Métropole en Région Pays de la Loire. Dit werk werd gerealiseerd in het kader van het programma van de LabEX IGO ondersteund door de National Research Agency via de investering van het toekomstige programma ANR-11-LABX-0016-01.

Alle perifere bloedmonsters werden anonieme volwassen donoren verkregen na de geïnformeerde toestemming, volgens de plaatselijke ethische Commissie (Etablissement Français du Sang, EFS, Nantes, procedure PLER NTS-2016-08).
1. isolatie van perifere bloed mononucleaire cellen
Opmerking: Grondstof kunnen totale perifere bloed of cytapheresis monsters. Monsters mag niet ouder zijn dan 8 h en aangevuld met anticoagulantia (b.v., heparine).
<ol><li>Verdun blo...

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

Het voorgestelde protocol is een krachtige methode voor het genereren van menselijke mAbs rechtstreeks vanuit Ag-specifieke B-cellen in het bloed circuleren. Het combineert drie belangrijke aspecten: (i) het gebruik van een tetrameer-geassocieerde magnetische verrijking, waarmee een ex vivo isolatie van zelfs zeldzame Ag-bindende B cellen; (ii) een gating strategie die gebruikmaakt van drie Ag tetramers (twee relevante enen en één irrelevant) geëtiketteerd met drie verschillende fluorochromes te isoleren, doo...

De hier beschreven methode kan de snelle en veelzijdige productie van volledig menselijke monoklonale antistoffen (mAbs) tegen een gewenste antigeen (Ag). mAbs zijn essentiële instrumenten in veel basisonderzoek toepassingen in vitro en in vivo: stroom cytometry, histologie, westelijke bevlekken en blokkerende experimenten bijvoorbeeld. Bovendien worden mAbs gebruikt meer en meer in de geneeskunde voor de behandeling van auto-immuunziekten, kanker, en zo de besturing van transplantatie afwijzing1. Bijvoorbeeld, werden de anti-CTLA-4 en anti-PD-1 (of anti-PD-L1) mAbs onlangs gebruikt als immuun checkpoint-remmers in kanker behandelingen2.
De eerste mAbs werden geproduceerd door immunoglobuline (Ig)-afscheidende hybridomas verkregen uit de milt cellen van geïmmuniseerde muizen of ratten. Echter, de sterke immuunrespons tegen RattenUitrustingen of rat mAbs belemmert hun therapeutisch gebruik bij de mens, als gevolg van hun snelle goedkeuring en de waarschijnlijke inductie van overgevoeligheid reacties3. Om dit probleem aan te pakken, zijn dierlijke eiwitten sequenties van mAbs gedeeltelijk vervangen door menselijke degenen voor het genereren van zogenaamde Chimeer muis-mens of gehumaniseerd antilichamen. Deze strategie vermindert echter slechts gedeeltelijk immunogeniciteit, terwijl zowel de kosten en de tijd-schaal van de productie aanzienlijk te verhogen. Een betere oplossing is het genereren van menselijke mAbs rechtstreeks uit menselijke B-cellen en verschillende strategieën daarvoor zijn beschikbaar. Een van hen is het gebruik van bacteriofaag of gist display. Hierbij weergeven van variabele domeinen vanuit een combinatorische bibliotheek met willekeurige menselijke Ig zware en lichte kettingen op bacteriofagen of gisten en het uitvoeren van een selectie stap met behulp van het specifieke antigeen van belang. Een groot nadeel van deze strategie is dat zware en lichte kettingen willekeurig gekoppeld zijn, leidt tot een zeer grote toename in de diversiteit van de gegenereerde antilichamen. Antilichamen verkregen zijn onwaarschijnlijk overeen moeten komen met degenen die uit een natuurlijke immuunrespons tegen een bepaalde Ag voortvloeien zou. Bovendien, menselijke eiwitvouwing en posttranslationele modificaties zijn niet systematisch gereproduceerd in prokaryoten of zelfs in gisten. Een tweede menselijke mAb productiemethode is de immortalization van natuurlijke menselijke B cellen, door Epstein - Barr virusinfectie of expressie van de anti-apoptotic factoren BCL-6 en BCL-XL4. Echter, deze methode is alleen van toepassing op geheugencellen B en is inefficiënt, vereisen screening van talrijke mAb-producerende vereeuwigd B cellen te identificeren van de weinig (eventuele) mAb-klonen met de gewenste antigene specificiteit. De methode is dus zowel dure en tijdrovende.
Onlangs werd een nieuw protocol voor de productie van menselijke mAbs van geïsoleerde één B cellen5beschreven. Zij beroept zich op een geoptimaliseerde eencellige Reverse transcriptie-polymerasekettingreactie (RT-PCR) voor versterking van zowel de zware - en licht-keten segmenten van een enkele cel voor gesorteerde B-codering. Dit wordt gevolgd door het klonen en de uitdrukking van deze segmenten in een eukaryoot expressie systeem, waardoor de wederopbouw van een volledig mens mAb. Dit protocol is gebruikt met succes vanaf B cellen van gevaccineerde donoren. Cellen zijn enkele weken na de vaccinatie verkrijgen van hogere frequenties van B-cellen die gericht is tegen de gewenste Ag, en dus het beperken van de tijd die nodig is voor het screenen van6geoogst. Er zijn ook andere volledig menselijk mAbs verkregen uit HIV+ (Human Immunodeficiency Virus) besmette patiënten7 en melanoom patiënten8. Ondanks deze vooruitgang is er nog steeds geen procedure beschikbaar waarmee het isolement van de Ag-specifieke B cellen onafhankelijk van hun geheugen fenotype of frequentie.
De procedure beschreven hier leidt tot efficiënte ex vivo isolatie van menselijke circulerende B cellen op basis van hun BHG specificiteit, gevolgd door de productie van volledig menselijk antigeen-specifieke mAbs in hoog rendement en met een tijd van lage screening. De methode is niet beperkt tot de geheugencellen B of antilichaam-afscheidende B cellen na een immuunrespons veroorzaakte, maar kan ook worden toegepast op het repertoire van de B-cel menselijke naïef. Dat het werkt zelfs vanaf Ag-specifieke B-cellen aanwezig bij zeer lage frequenties is een goede indicatie van de efficiëntie. Het uitgangspunt van de methode is als volgt: perifere bloed mononucleaire cellen (PBMC) zijn gekleurd met twee tetramers het antigeen van belang presenteren, elk gemarkeerd met een verschillende fluorescerende (b.v.Phycoerythrin (PE) en Allophycocyanin (APC)), en een derde tetrameer presenteren een verwant antigeen geconjugeerd met een derde fluorescerende (bijvoorbeeldBrillant Violet 421 (BV421)). Om te verrijken voor antigeen-bindende cellen, cellen worden vervolgens geïncubeerd met kralen met anti-PE gecoat en anti-APC Abs, en in cel scheiding kolommen gesorteerd. De Fractie van de cel PE+ APC+ is geselecteerd, gekleurd met een scala aan mAbs specifiek voor verschillende PBMC celtypes toe te staan van de identificatie van B-cellen, en onderworpen aan stroom cytometry cel sorteren. B-cellen die PE+ en APC+, maar briljante Violet-, zijn geïsoleerd. Deze stap selecteert tegen cellen die geen B-cellen of niet binden aan de tetramerized antigeen, maar binden aan PE of APC (deze cellen zullen PE+ - APC of PE- APC+) of aan het deel van de niet-antigeen van de tetramers gebruikt (deze cellen zullen BV421+). B-cellen niet zeer specifiek voor de epitoop van belang zijn ook contra geselecteerd bij deze stap (deze cellen zullen ook BV421+). Dus, kan deze methode zeer specifieke B-cellen, uiting van B-cel receptoren (BCRs) te discrimineren tussen twee zeer nauw verwante antigenen kunnen zuiveren. Enkele specifieke B-cellen worden verzameld in buizen en hun PCR-versterkte Ig cDNAs (complementaire deoxyribonucleic zuren) wordt gekloond en wordt geuit door een menselijke cellijn als secreted IgG mAbs.
Als een proof of concept, deze studie beschrijft de efficiënte generatie van menselijke mAbs, die herkennen een peptide gepresenteerd door een grote histocompatibility complex klasse ik (MHC-ik) molecuul en kan onderscheid maken tussen dit peptide en andere peptiden geladen op dezelfde MHC-ik allel. Hoewel het niveau van complexiteit van deze Ag is belangrijk, kunt met deze methode (i) hoge opbrengst herstel van Ag-specifieke mAbs; (ii) de productie van mAbs staat te discrimineren tussen twee structureel sluit Ags. Deze aanpak kan worden uitgebreid tot gevaccineerde en besmette patiënten zonder enige wijziging van het protocol, en ook al met succes is uitgevoerd in een gehumaniseerd rat systeem9. Deze studie beschrijft dus, een veelzijdige en efficiënte aanpak voor het genereren van volledig menselijk mAbs die kunnen worden gebruikt in basisonderzoek en immunotherapie.

<table>
	<tbody>
		<tr>
			<td>HEK 293A cell line</td>
			<td>Thermo Fisher scientific</td>
			<td>R70507</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (1X) Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Gibco by life technologies</td>
			<td>21969-035</td>
			<td>(+) 4,5g/L D-Glucose 
			0,11g/L Sodium Pyruvate 
			(-) L-Glutmine</td>
		</tr>
		<tr>
			<td>RPMI medium1640 (1X)</td>
			<td>Gibco by life technologies</td>
			<td>31870-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine (BSA)</td>
			<td>PAA</td>
			<td>K45-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutridoma-SP</td>
			<td>Roche</td>
			<td>11011375001</td>
			<td>100X Conc</td>
		</tr>
		<tr>
			<td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td>
			<td>Ambion</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td>
			<td>Invitrogen by Life Technologies</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine serum (FBS)</td>
			<td>Dominique Dutscher</td>
			<td>S1810-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll - lymphocytes separation medium</td>
			<td>EuroBio</td>
			<td>CMSMSL01-01</td>
			<td>density 1,0777+/-0,001</td>
		</tr>
		<tr>
			<td>streptavidin R-phycoerythrin conjugate</td>
			<td>Invitrogen by Life Technologies</td>
			<td>S21388</td>
			<td>premiun grade 1mg/ml contains 5mM sodium azide</td>
		</tr>
		<tr>
			<td>Streptavidin, allophycocyanin conjugate</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>S32362</td>
			<td>1mg/ml 
			2mM azide premium grade</td>
		</tr>
		<tr>
			<td>Brilliant violet 421 streptavidin</td>
			<td>Biolegend</td>
			<td>405225</td>
			<td>conc : 0,5mg/ml</td>
		</tr>
		<tr>
			<td>Anti-PE conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-801</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-APC conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-855</td>
			<td></td>
		</tr>
		<tr>
			<td>MidiMACs or QuadroMACS separotor</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-302/130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3 BV510 BD horizon</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>563109</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD19 FITC</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>345788</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD14 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>561116</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>CD16 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>338440</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>7AAD</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>51-68981E (559925)</td>
			<td>Used dilution 1:1000</td>
		</tr>
		<tr>
			<td>FACS ARIA III Cell Sorter Cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>8-strip PCR tubes</td>
			<td>Axygen</td>
			<td>321-10-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Racks for 96 microtubes</td>
			<td>Dominique Dutscher</td>
			<td>45476</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>10777-019</td>
			<td>qty:5000U (40U/ul)</td>
		</tr>
		<tr>
			<td>Distilled Water Dnase/Rnase Free</td>
			<td>Gibco</td>
			<td>10977-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligod(T)18 mRNA Primer</td>
			<td>New England BioLabs</td>
			<td>S1316S</td>
			<td>5.0 A260unit</td>
		</tr>
		<tr>
			<td>Random hexamers</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>N8080127</td>
			<td>qty : 50uM, 5nmoles</td>
		</tr>
		<tr>
			<td>Superscript III Reverse transcriptase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>18080-044</td>
			<td>qty : 10000U (200U/ul)</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP Set, Molecular biology grade</td>
			<td>Thermo Scientific</td>
			<td>R0182</td>
			<td>4*100umol</td>
		</tr>
		<tr>
			<td>5LVH1</td>
			<td>Eurofins</td>
			<td>ACAGGTGCCCACT 
			CCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH3</td>
			<td>Eurofins</td>
			<td>AAGGTGTCCAGTG 
			TGARGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVL4_6</td>
			<td>Eurofins</td>
			<td>CCCAGATGGGTCC 
			TGTCCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH5</td>
			<td>Eurofins</td>
			<td>CAAGGAGTCTGTT 
			CCGAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>3HuIgG_const_anti</td>
			<td>Eurofins</td>
			<td>TCTTGTCCACCTT 
			GGTGTTGCT</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>3CuCH1</td>
			<td>Eurofins</td>
			<td>GGGAATTCTCACA 
			GGAGACGA</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td>
		</tr>
		<tr>
			<td>5AgeIVH1_5_7</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			GAGGTGCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3_23</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGTTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTGCAGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4_34</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTACAGCAGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_18</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTTCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_24</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTCCAGCTGGTACAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3__9_30_33</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAAGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH6_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTACAGCTGCAGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3SalIJH1_2_4_5</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH3</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAAGAGACGGTGACCATTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH6</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk1_2</td>
			<td>Eurofins</td>
			<td>ATGAGGSTCCCYG 
			CTCAGCTGCTGG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk3</td>
			<td>Eurofins</td>
			<td>CTCTTCCTCCTGC 
			TACTCTGGCTCCCAG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk4</td>
			<td>Eurofins</td>
			<td>ATTTCTCTGTTGC 
			TCTGGATCTCTG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Ck543_566</td>
			<td>Eurofins</td>
			<td>GTTTCTCGTAGTC 
			TGCTTTGCTCA</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GACATCCAGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1_9_1&#8211;13</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGACATCCAGTTGACCCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1D_43_1_8</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTGT 
			GCCATCCGGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACCCAGAC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2_28_2_30</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACTCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_11_3D_11</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACACAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_15_3D_15</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCA 
			GAAATAGTGATGACGCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_20_3D_20</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACGCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk4_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCG 
			GACATCGTGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk1_2_4</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATYTCCACCTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk3</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATATCCACTTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk5</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TAATCTCCAGTCGTGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl1</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl2</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGCCCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl3</td>
			<td>Eurofins</td>
			<td>GCTCTGTGACCTC 
			CTATGAGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl4_5</td>
			<td>Eurofins</td>
			<td>GGTCTCTCTCSCA 
			GCYTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl6</td>
			<td>Eurofins</td>
			<td>GTTCTTGGGCCAA 
			TTTTATGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl7</td>
			<td>Eurofins</td>
			<td>GGTCCAATTCYCA 
			GGCTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5LVl8</td>
			<td>Eurofins</td>
			<td>GAGTGGATTCTCA 
			GACTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Cl</td>
			<td>Eurofins</td>
			<td>CACCAGTGTGGCC 
			TTGTTGGCTTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl1</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGTGCTGACKCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl2</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGCCCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl3</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTGTGACC 
			TCCTATGAGCTGACWCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl4_5</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTCTCTCS 
			CAGCYTGTGCTGACTCA</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl6</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTTGGGCC 
			AATTTTATGCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl8</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCAATTCY 
			CAGRCTGTGGTGACYCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>3&#39;XhoICl</td>
			<td>Eurofins</td>
			<td>CTCCTCACTCGAG 
			GGYGGGAACAGAGTG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -Reverse primers - Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>Ab-vec-sense</td>
			<td>Eurofins</td>
			<td>GCTTCGTTAGAAC 
			GCGGCTAC</td>
			<td>Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>QA Agarose-TM, Molecular Biology Grade</td>
			<td>MP Bio</td>
			<td>AGAH0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoFast 96 PCR Plate</td>
			<td>Macherey Nagel</td>
			<td>743.100.100</td>
			<td></td>
		</tr>
		<tr>
			<td>Enzyme Age I HF</td>
			<td>New England Biolabs</td>
			<td>R3552L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme SalI HF</td>
			<td>New England Biolabs</td>
			<td>R3138L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme Xho I</td>
			<td>New England Biolabs</td>
			<td>R0146L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme BSIWI</td>
			<td>New England Biolabs</td>
			<td>R0553L</td>
			<td>10000U/ml</td>
		</tr>
		<tr>
			<td>HCg1 (Genbank accession number FJ475055)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCk (Genbank accession number FJ475056 )</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCl (Genbank accession number FJ517647)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>15224.017</td>
			<td>100U (1U/ul)</td>
		</tr>
		<tr>
			<td>2X YT medium</td>
			<td>Sigma Aldrich</td>
			<td>Y1003-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma Aldrich</td>
			<td>10835242001</td>
			<td></td>
		</tr>
		<tr>
			<td>LB (Luria Bertani) Broth (Lennox)</td>
			<td>Sigma Aldrich</td>
			<td>L3022-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin Plasmid DNA, RNA and protein purification</td>
			<td>Macherey Nagel</td>
			<td>740588.250</td>
			<td></td>
		</tr>
		<tr>
			<td>Jet PEI DNA transfection reagent</td>
			<td>PolyPlus</td>
			<td>101-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Flat bottom96-well plate</td>
			<td>Falcon</td>
			<td>353072</td>
			<td></td>
		</tr>
		<tr>
			<td>V-bottom 96-well plate</td>
			<td>Nunc/Thermofisher</td>
			<td>055142</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc easy 175 cm2 flasks</td>
			<td>Nunc/Thermofisher</td>
			<td>12-562-000</td>
			<td></td>
		</tr>
		<tr>
			<td>ELISA/ELISPOT coating buffer</td>
			<td>eBiosciences</td>
			<td>00-0044-59</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc maxisorp flat bottom 96 well ELISA plates</td>
			<td>Nunc/Thermofisher</td>
			<td>44-2404-21</td>
			<td>high protein binding</td>
		</tr>
		<tr>
			<td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>55788</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB substrate</td>
			<td>BD Biosciences</td>
			<td>555214</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Sigma</td>
			<td>S0677</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL-HiTrap protein A HP column</td>
			<td>GE Healthcare</td>
			<td>17-0402-01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#196;KTA FPLC</td>
			<td>GE Healthcare</td>
			<td>18190026</td>
			<td></td>
		</tr>
		<tr>
			<td>Superdex 200 10/300 GL column</td>
			<td>GE Healthcare</td>
			<td>17517501</td>
			<td></td>
		</tr>
		<tr>
			<td>NGC Quest 10 Plus Chromatography System</td>
			<td>BioRad</td>
			<td>7880003</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

Monoclonal antilichamen (mAbs) zijn krachtige instrumenten nuttig voor zowel fundamenteel onderzoek en medische biologie. Hun hoge specificiteit is onmisbaar wanneer het antilichaam moet onderscheid worden gemaakt tussen sterk verwante structuur (b.v., een normaal eiwit en een gemuteerde versie ervan). De huidige manier van het genereren van dergelijke discriminerende mAbs omvat uitgebreide screening van meerdere B Ab-producerende cellen, die is zowel duur en tijdrovend. Wij stellen hier een snelle en kosteneffectieve methode voor de generatie van discriminatoire, volledig mens mAbs vanaf menselijk bloed circuleren van B-lymfocyten. De originaliteit van deze strategie is te wijten aan de celselectie specifiek antigeen bindende B gecombineerd met de contra selectie van alle andere cellen, met behulp van gemakkelijk beschikbare perifere bloed mononucleaire cellen (PBMC). Zodra bepaalde B-cellen geïsoleerd zijn, worden cDNA (bijkomende deoxyribonucleic acid) sequenties codering voor de overeenkomstige mAb verkregen met behulp van eencellige Reverse transcriptie-polymerasekettingreactie (RT-PCR) technologie en vervolgens uitgedrukt in mens cellen. Binnen zo weinig als 1 maand is het mogelijk om te produceren milligram van hoogst discriminatoire menselijke mAbs gericht tegen vrijwel elke gewenste antigeen natuurlijk gedetecteerd door de B-cel-repertoire.

Vanaf PBMC van gezonde donoren, dit project presenteert de generatie van menselijke mAbs, die de peptide Pp65495 herkennen (Pp65, van menselijke cytomegalovirus) gepresenteerd door de grote histocompatibility complex klasse ik (MHC-ik) molecuul HLA - A * 0201 () HLA-A2). Deze mAbs kan onderscheid maken tussen deze complex en complexen die andere peptiden geladen op de dezelfde MHC-ik molecuul.
PBMC werden gekleurd met...

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Beschrijven we een methode voor de productie van menselijke antilichamen specifiek voor een antigeen van belang vanaf zeldzame B-cellen die in menselijk bloed circuleren. Generatie van deze natuurlijke antilichamen is efficiënt en snel, en de verkregen antilichamen kunnen onderscheid maken tussen sterk verwante antigenen.

Generatie van discriminatoire menselijke monoklonale antistoffen uit zeldzame antigeen-specifieke B-cellen in bloed circuleert

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Research

JoVE Journal

Immunology and Infection

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Isolatie van Precursor B-cel subsets van navelstrengbloed

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial antigeen presenterende cellen (KaAPC) voor Efficient<em&gt; In Vitro</em&gt; Uitputting van Human Antigeen-specifieke T-cellen

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

Genereren van menselijke allogeen-specifieke T-cellen uit perifeer bloed

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Generering van recombinant humaan IgG Monoclonal Antibodies uit Onsterfelijk gesorteerde B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

The Isolation, Differentiation, and Quantification of Human Antibody-secreting B Cells from Blood: ELISpot as a Functional Readout of Humoral Immunity

De isolatie, differentiatie en kwantificering van menselijk antilichaam-uitscheidende B-cellen uit bloed: ELISpot als functionele Uitlezing van humorale immuniteit

The hallmark of humoral immunity is to generate functional ASCs, which synthesize and secrete Abs specific to an antigen (Ag), such as a pathogen, and are ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Genereren van monoklonale muizenantilichamen door Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

Genereren van Human-monocyten afgeleide dendritische cellen uit volbloed

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

Dextran verbetert de efficiëntie van de lentivirale transductie van lymfkliertest en menselijke primaire NK-cellen

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

Detectie en Verrijking van zeldzame antigeen-specifieke B-cellen voor analyse van fenotype en functie

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generatie van Escape varianten van het Influenza Virus monoklonale antistoffen neutraliseren

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...