Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Agradecemos el servicio de citometría "CytoCell" (SFR Santé, Biogenouest, Nantes) asistencia técnica experta. Agradecemos también todo el personal de producción de proteína recombinante (P2R) y de plataformas de impacto (INSERM 1232 Santé SFR, Biogenouest, Nantes) por su apoyo técnico. Agradecemos Emmanuel Scotet y Richard Breathnach comentarios constructivos sobre el manuscrito. Este trabajo fue apoyado financieramente por el proyecto IHU-Cesti financiado por el programa de gobierno francés «Investissements Avenir», administrado por la Agencia de investigación nacional de francés (ANR) (ANR-10-IBHU-005). El proyecto IHU-Cesti es apoyado también por Nantes Métropole y Région Pays de la Loire. Este trabajo fue realizado en el contexto del programa IGO LabEX apoyado por la Agencia Nacional de investigación a través de la inversión del futuro programa ANR-11-LABX-0016-01.

Todas las muestras de sangre periférica fueron obtenidas de donantes adultos anónimos después de consentimiento informado, según el Comité de ética local (Etablissement Français du Sang, EFS, Nantes, procedimiento Sampler NTS-2016-08).
1. aislamiento de células mononucleares de sangre periférica
Nota: Material de partida puede ser sangre total periférica o cytapheresis muestras. Las muestras no deben ser mayores de 8 h y complementan con los anticoagulantes ...

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

El protocolo propuesto es un método eficaz para la generación de mAbs humana directamente de las células B Ag específicos circulantes en la sangre. Combina tres aspectos importantes: (i) el uso de un enriquecimiento magnético asociado de tetrámero, que permite un aislamiento ex vivo incluso raras Unión Ag de células de B; (ii) una estrategia bloquea que utiliza tres tetrámeros Ag (dos relevantes y uno irrelevante) etiquetados con tres fluorocromos diferentes para aislar, mediante citometría de flujo, s...

El método aquí descrito permite la producción rápida y versátil de anticuerpos monoclonales completamente humanos (mAbs) contra un antígeno deseado (Ag). mAbs son herramientas esenciales en muchas aplicaciones de investigación básica in vitro e in vivo: flujo cytometry, histología, experimentos de western-blotting y bloqueo, por ejemplo. Además, mAbs se utilizan más en medicina para tratar enfermedades autoinmunes, cáncer y para el control de rechazo de trasplante1. Por ejemplo, mAbs anti-CTLA-4 y anti-PD-1 (o anti-PD-L1) recientemente fueron utilizados como inhibidores de control inmune en cáncer tratamientos2.
Los mAbs primeros fueron producidos por inmunoglobulina (Ig)-secretoras de hibridomas obtienen de las células esplénicas de ratones inmunizados o ratas. Sin embargo, la fuerte respuesta inmune contra mAbs murino o rata impide su uso terapéutico en humanos, debido a su rápida separación y el probable inducción de reacciones de hipersensibilidad3. Para abordar este problema, secuencias de la proteína animal de mAbs han sido parcialmente reemplazadas por los humanos para generar anticuerpos de ratón-humano o humanizados quiméricos llamados. Sin embargo, esta estrategia sólo parcialmente disminuye la inmunogenicidad, aumentando substancialmente el costo y la escala de tiempo de producción. Hay varias estrategias para esto y una mejor solución es generar mAbs humana directamente de las células B humanas. Uno de ellos es el uso de la visualización de fagos o levadura. Se trata de mostrar los dominios variables de una biblioteca combinatoria de Ig humana al azar pesado y luz cadenas en fagos o levaduras y llevar a cabo un paso de selección utilizando el antígeno específico de interés. Un gran inconveniente de esta estrategia es que las cadenas pesadas y ligeras están aleatoriamente asociadas, llevando a un incremento muy grande en la diversidad de los anticuerpos generados. Anticuerpos obtenidos no corresponden a las que surgirían de una respuesta inmune natural contra un Ag particular. Por otra parte, plegamiento de la proteína humana y modificaciones postraduccionales no son sistemáticamente reproducidas en procariotas o en levaduras. Un segundo método de producción humana mAb es la inmortalización de células B humanas naturales, por infección del virus Epstein - Barr o expresión de los factores anti-apoptótica BCL-6 y BCL-XL4. Sin embargo, este método sólo es aplicable a las células de memoria B y es ineficiente, que requieren la proyección de numerosos mAb inmortalizado B células productoras para identificar los clones de mAb pocos (si cualquier) con la especificidad antigénica deseada. El método es costoso y desperdiciador de tiempo.
Un nuevo protocolo recientemente se ha descrito para la producción de mAbs humano aislado solo de células B5. Se basa en un optimizado unicelular revertir la transcripción-polimerasa reacción en cadena (RT-PCR) para la amplificación de ambos la pesada luz cadena y codificación de segmentos de una sola célula B ordenado. Esto es seguido por la clonación y expresión de estos segmentos en un sistema de expresión eucariotas, lo que permite la reconstrucción de un mAb plenamente humana. Este protocolo se ha utilizado con éxito a partir de las células de B de donantes vacunados. Las células se cosecharon varias semanas después de la vacunación para obtener frecuencias más altas de las células B contra el Ag deseado y así limitar el tiempo requerido para la detección del6. También se han producido otros mAbs plenamente humanas de infectados por el VIH+ (Virus de inmunodeficiencia humana) pacientes7 y melanoma pacientes8. A pesar de estos avances, todavía hay no hay procedimiento disponible que permite el aislamiento de células B Ag específica independientemente de su fenotipo de memoria o de frecuencia.
El procedimiento aquí descrito conduce a aislamiento eficiente ex vivo de las células B humanas circulantes basados en su especificidad BCR, seguido por la producción de plenamente humana mAbs específicos de antígeno en alto rendimiento y con un tiempo de proyección baja. El método no se limita a las células de memoria B o células B secretoras de anticuerpos inducidas después de una respuesta inmune, pero puede aplicarse también al repertorio de células B humanos ingenuos. Que funciona incluso a partir de las células B Ag-específica presentes en muy baja frecuencia es un buen indicador de su eficacia. El principio del método es como sigue: se tiñen las células mononucleares periféricas en sangre (PBMC) con dos tetrámeros que presentan el antígeno de interés, cada uno marcado con un fluorocromo diferente (por ejemplo, ficoeritrina (PE) y Allophycocyanin (APC)), y un tercer tetrámero que presenta un antígeno estrechamente relacionado conjugado con un fluorocromo terceros (p. ej., brillante violeta 421 (BV421)). Para enriquecer las células de antígeno-que ata, las células se incuban luego con bolas recubiertas con anti-PE y Abs anti-APC y ordenados en columnas de separación celular. La fracción de células APC PE+ + es seleccionada, manchadas con una variedad de mAbs específicos para diferentes tipos de células PBMC permitir la identificación de las células B y sometida a clasificación de celda de citometría de flujo. Las células de B PE+ y APC+, pero brillante violeta-, están aisladas. Este paso selecciona en células que no son las células de B o no se unen al antígeno tetramerized, pero unen a PE o APC (estas células serán PE+ APC– o PE– APC+) o a la parte no-antígeno de los tetrámeros usado (estos las células serán BV421+). Las células de B no altamente específicas para el epitopo de interés también se seleccionan en este paso (estas células también será BV421+). Por lo tanto, este método puede purificar células B altamente específicas expresan receptores de las células B (BCR) capaces de discriminar entre antígenos relacionados muy de cerca conexos dos. Las células B específicas se recogen en tubos y su cDNAs de la polimerización en cadena-amplificados de la Ig (los ácidos desoxirribonucleico complementarios) clonado y expresado por una línea de células humanas como mAbs IgG secretada.
Como una prueba de concepto, este estudio describe la generación eficiente de mAbs humanos, que reconoce un péptido presentado por una clase complejo mayor de histocompatibilidad I (MHC-I) molécula y puede discriminar entre este péptido y otros péptidos cargados en el mismo MHC-I alelo. Aunque el nivel de complejidad de este Ag es importante, este método permite (i) recuperación de alto rendimiento de mAbs específicos de Ag; (ii) producción de mAbs capaces de discriminar entre dos estructuralmente cerca de Ags. Este enfoque puede ser extendido a pacientes infectados o vacunados sin ninguna modificación del protocolo y también ya ha sido implementado con éxito en un sistema humanizado de la rata del9. Por lo tanto, este estudio describe un enfoque versátil y eficiente para generar mAbs plenamente humana que pueden ser utilizados en la inmunoterapia y la investigación básica.

<table>
	<tbody>
		<tr>
			<td>HEK 293A cell line</td>
			<td>Thermo Fisher scientific</td>
			<td>R70507</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (1X) Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Gibco by life technologies</td>
			<td>21969-035</td>
			<td>(+) 4,5g/L D-Glucose 
			0,11g/L Sodium Pyruvate 
			(-) L-Glutmine</td>
		</tr>
		<tr>
			<td>RPMI medium1640 (1X)</td>
			<td>Gibco by life technologies</td>
			<td>31870-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine (BSA)</td>
			<td>PAA</td>
			<td>K45-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutridoma-SP</td>
			<td>Roche</td>
			<td>11011375001</td>
			<td>100X Conc</td>
		</tr>
		<tr>
			<td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td>
			<td>Ambion</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td>
			<td>Invitrogen by Life Technologies</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine serum (FBS)</td>
			<td>Dominique Dutscher</td>
			<td>S1810-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll - lymphocytes separation medium</td>
			<td>EuroBio</td>
			<td>CMSMSL01-01</td>
			<td>density 1,0777+/-0,001</td>
		</tr>
		<tr>
			<td>streptavidin R-phycoerythrin conjugate</td>
			<td>Invitrogen by Life Technologies</td>
			<td>S21388</td>
			<td>premiun grade 1mg/ml contains 5mM sodium azide</td>
		</tr>
		<tr>
			<td>Streptavidin, allophycocyanin conjugate</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>S32362</td>
			<td>1mg/ml 
			2mM azide premium grade</td>
		</tr>
		<tr>
			<td>Brilliant violet 421 streptavidin</td>
			<td>Biolegend</td>
			<td>405225</td>
			<td>conc : 0,5mg/ml</td>
		</tr>
		<tr>
			<td>Anti-PE conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-801</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-APC conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-855</td>
			<td></td>
		</tr>
		<tr>
			<td>MidiMACs or QuadroMACS separotor</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-302/130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3 BV510 BD horizon</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>563109</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD19 FITC</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>345788</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD14 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>561116</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>CD16 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>338440</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>7AAD</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>51-68981E (559925)</td>
			<td>Used dilution 1:1000</td>
		</tr>
		<tr>
			<td>FACS ARIA III Cell Sorter Cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>8-strip PCR tubes</td>
			<td>Axygen</td>
			<td>321-10-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Racks for 96 microtubes</td>
			<td>Dominique Dutscher</td>
			<td>45476</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>10777-019</td>
			<td>qty:5000U (40U/ul)</td>
		</tr>
		<tr>
			<td>Distilled Water Dnase/Rnase Free</td>
			<td>Gibco</td>
			<td>10977-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligod(T)18 mRNA Primer</td>
			<td>New England BioLabs</td>
			<td>S1316S</td>
			<td>5.0 A260unit</td>
		</tr>
		<tr>
			<td>Random hexamers</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>N8080127</td>
			<td>qty : 50uM, 5nmoles</td>
		</tr>
		<tr>
			<td>Superscript III Reverse transcriptase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>18080-044</td>
			<td>qty : 10000U (200U/ul)</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP Set, Molecular biology grade</td>
			<td>Thermo Scientific</td>
			<td>R0182</td>
			<td>4*100umol</td>
		</tr>
		<tr>
			<td>5LVH1</td>
			<td>Eurofins</td>
			<td>ACAGGTGCCCACT 
			CCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH3</td>
			<td>Eurofins</td>
			<td>AAGGTGTCCAGTG 
			TGARGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVL4_6</td>
			<td>Eurofins</td>
			<td>CCCAGATGGGTCC 
			TGTCCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH5</td>
			<td>Eurofins</td>
			<td>CAAGGAGTCTGTT 
			CCGAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>3HuIgG_const_anti</td>
			<td>Eurofins</td>
			<td>TCTTGTCCACCTT 
			GGTGTTGCT</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>3CuCH1</td>
			<td>Eurofins</td>
			<td>GGGAATTCTCACA 
			GGAGACGA</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td>
		</tr>
		<tr>
			<td>5AgeIVH1_5_7</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			GAGGTGCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3_23</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGTTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTGCAGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4_34</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTACAGCAGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_18</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTTCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_24</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTCCAGCTGGTACAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3__9_30_33</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAAGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH6_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTACAGCTGCAGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3SalIJH1_2_4_5</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH3</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAAGAGACGGTGACCATTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH6</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk1_2</td>
			<td>Eurofins</td>
			<td>ATGAGGSTCCCYG 
			CTCAGCTGCTGG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk3</td>
			<td>Eurofins</td>
			<td>CTCTTCCTCCTGC 
			TACTCTGGCTCCCAG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk4</td>
			<td>Eurofins</td>
			<td>ATTTCTCTGTTGC 
			TCTGGATCTCTG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Ck543_566</td>
			<td>Eurofins</td>
			<td>GTTTCTCGTAGTC 
			TGCTTTGCTCA</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GACATCCAGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1_9_1&#8211;13</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGACATCCAGTTGACCCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1D_43_1_8</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTGT 
			GCCATCCGGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACCCAGAC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2_28_2_30</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACTCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_11_3D_11</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACACAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_15_3D_15</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCA 
			GAAATAGTGATGACGCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_20_3D_20</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACGCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk4_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCG 
			GACATCGTGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk1_2_4</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATYTCCACCTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk3</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATATCCACTTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk5</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TAATCTCCAGTCGTGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl1</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl2</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGCCCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl3</td>
			<td>Eurofins</td>
			<td>GCTCTGTGACCTC 
			CTATGAGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl4_5</td>
			<td>Eurofins</td>
			<td>GGTCTCTCTCSCA 
			GCYTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl6</td>
			<td>Eurofins</td>
			<td>GTTCTTGGGCCAA 
			TTTTATGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl7</td>
			<td>Eurofins</td>
			<td>GGTCCAATTCYCA 
			GGCTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5LVl8</td>
			<td>Eurofins</td>
			<td>GAGTGGATTCTCA 
			GACTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Cl</td>
			<td>Eurofins</td>
			<td>CACCAGTGTGGCC 
			TTGTTGGCTTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl1</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGTGCTGACKCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl2</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGCCCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl3</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTGTGACC 
			TCCTATGAGCTGACWCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl4_5</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTCTCTCS 
			CAGCYTGTGCTGACTCA</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl6</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTTGGGCC 
			AATTTTATGCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl8</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCAATTCY 
			CAGRCTGTGGTGACYCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>3&#39;XhoICl</td>
			<td>Eurofins</td>
			<td>CTCCTCACTCGAG 
			GGYGGGAACAGAGTG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -Reverse primers - Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>Ab-vec-sense</td>
			<td>Eurofins</td>
			<td>GCTTCGTTAGAAC 
			GCGGCTAC</td>
			<td>Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>QA Agarose-TM, Molecular Biology Grade</td>
			<td>MP Bio</td>
			<td>AGAH0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoFast 96 PCR Plate</td>
			<td>Macherey Nagel</td>
			<td>743.100.100</td>
			<td></td>
		</tr>
		<tr>
			<td>Enzyme Age I HF</td>
			<td>New England Biolabs</td>
			<td>R3552L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme SalI HF</td>
			<td>New England Biolabs</td>
			<td>R3138L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme Xho I</td>
			<td>New England Biolabs</td>
			<td>R0146L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme BSIWI</td>
			<td>New England Biolabs</td>
			<td>R0553L</td>
			<td>10000U/ml</td>
		</tr>
		<tr>
			<td>HCg1 (Genbank accession number FJ475055)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCk (Genbank accession number FJ475056 )</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCl (Genbank accession number FJ517647)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>15224.017</td>
			<td>100U (1U/ul)</td>
		</tr>
		<tr>
			<td>2X YT medium</td>
			<td>Sigma Aldrich</td>
			<td>Y1003-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma Aldrich</td>
			<td>10835242001</td>
			<td></td>
		</tr>
		<tr>
			<td>LB (Luria Bertani) Broth (Lennox)</td>
			<td>Sigma Aldrich</td>
			<td>L3022-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin Plasmid DNA, RNA and protein purification</td>
			<td>Macherey Nagel</td>
			<td>740588.250</td>
			<td></td>
		</tr>
		<tr>
			<td>Jet PEI DNA transfection reagent</td>
			<td>PolyPlus</td>
			<td>101-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Flat bottom96-well plate</td>
			<td>Falcon</td>
			<td>353072</td>
			<td></td>
		</tr>
		<tr>
			<td>V-bottom 96-well plate</td>
			<td>Nunc/Thermofisher</td>
			<td>055142</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc easy 175 cm2 flasks</td>
			<td>Nunc/Thermofisher</td>
			<td>12-562-000</td>
			<td></td>
		</tr>
		<tr>
			<td>ELISA/ELISPOT coating buffer</td>
			<td>eBiosciences</td>
			<td>00-0044-59</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc maxisorp flat bottom 96 well ELISA plates</td>
			<td>Nunc/Thermofisher</td>
			<td>44-2404-21</td>
			<td>high protein binding</td>
		</tr>
		<tr>
			<td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>55788</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB substrate</td>
			<td>BD Biosciences</td>
			<td>555214</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Sigma</td>
			<td>S0677</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL-HiTrap protein A HP column</td>
			<td>GE Healthcare</td>
			<td>17-0402-01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#196;KTA FPLC</td>
			<td>GE Healthcare</td>
			<td>18190026</td>
			<td></td>
		</tr>
		<tr>
			<td>Superdex 200 10/300 GL column</td>
			<td>GE Healthcare</td>
			<td>17517501</td>
			<td></td>
		</tr>
		<tr>
			<td>NGC Quest 10 Plus Chromatography System</td>
			<td>BioRad</td>
			<td>7880003</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

Anticuerpos monoclonales (mAbs) son poderosas herramientas útiles para tanto investigación fundamental y en biomedicina. Su alta especificidad es indispensable cuando el anticuerpo tiene que distinguir entre estructuras muy relacionadas (por ejemplo, una proteína normal y su una versión mutada). La actual forma de generar estos mAbs discriminativa implica investigación extensa de múltiples células B productoras de AC, que es costosa y consume tiempo. Proponemos aquí un método rápido y rentable para la generación de discriminativo, mAbs plenamente humana a partir de linfocitos B circulantes de sangre humana. La originalidad de esta estrategia es debido a la selección de antígeno específico células de Unión B combinada con la selección contra de todas las otras células, usando disponible periféricos sanguíneos mononucleares células (PBMC). Una vez que las células B específicas aisladas, secuencias de ADNc (complementario ácido desoxirribonucleico) que codifica para el mAb correspondiente se obtienen utilizando la tecnología de reacción en cadena de la transcripción-polimerasa reversa (RT-PCR) unicelular y expresado posteriormente en humanos células. Dentro de tan poco como 1 mes, es posible producir miligramos de mAbs humano altamente discriminativo contra prácticamente cualquier antígeno deseado naturalmente detectado por el repertorio de células B.

A partir de PBMC procedentes de donantes sanos, presenta proyecto la generación de mAbs humana, que reconocen el péptido Pp65495 (Pp65, de citomegalovirus humano) presentado por la clase complejo mayor de histocompatibilidad I (MHC-I) molécula (HLA - A * 0201 HLA-A2). Estos mAbs pueden discriminar entre este complejo y complejos que representan otros péptidos cargados en el mismo MHC-I molécula.
PBMC fueron manch...

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Se describe un método para la producción de anticuerpos humanos específicos para un antígeno de interés, a partir de células B circulantes en la sangre humana. Generación de estos anticuerpos naturales es eficiente y rápido, y los anticuerpos obtenidos pueden discriminar entre antígenos muy similares.

Generación de anticuerpos monoclonales humanos discriminativo de células B antígeno específicas raras circulan en sangre

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Research

JoVE Journal

Immunology and Infection

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Aislamiento de los precursores de células B subconjuntos de Sangre del Cordón Umbilical

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Investigación

Inmunología e Infección

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial células presentadoras de antígenos (KaAPC) para la utilización eficiente<em&gt; In Vitro</em&gt; El agotamiento de células T humanas específicas de antígeno

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

Generación de células T humanas aloantígeno-específicos de la sangre periférica

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Generación de recombinante humano IgG anticuerpos monoclonales a partir de células inmortalizadas B Ordenada

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

The Isolation, Differentiation, and Quantification of Human Antibody-secreting B Cells from Blood: ELISpot as a Functional Readout of Humoral Immunity

El aislamiento, diferenciación y cuantificación de Human secretoras de anticuerpos células B de sangre: ELISpot como una lectura funcional de la inmunidad humoral

The hallmark of humoral immunity is to generate functional ASCs, which synthesize and secrete Abs specific to an antigen (Ag), such as a pathogen, and are ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Generación de anticuerpos monoclonales murino por el hibridoma Tecnología

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

Generación de células dendríticas derivadas de monocitos humanos de sangre entera

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

Dextrano mejora la eficiencia de transducción lentivirales de las células NK primaria murinas y humanas

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

Detección y enriquecimiento de Rare células B específicas de antígeno para el análisis del fenotipo y la función

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Generación de variantes de Escape de neutralizar anticuerpos Monoclonal del Virus de la Influenza

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...