Name: site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry
Uploaded: 2018-03-29T13:00:00
Description: Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Forfatterne takke Dr. M. Rubini (Konstanz, Tyskland), for at give plasmidet pyrrolysyl-tRNA-kodning og for at give pRSFduet-pyrtRNAsynth-kodning den tilsvarende aminoacyl-tRNA syntetase.

1. fremstilling af BMP2 Variant BMP2-K3Plk
<ol><li>Kloning af BMP2-K3Plk ved site-directed mutagenese ved hjælp af PCR 12<ol>
<li>Forstærke menneskelige modne BMP2 (hmBMP2) fra en p25N-hmBMP2 vektor (Se Tabel af materialer) med en fremad primer (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') og et omvendt primer (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') at indføre en rav stop codon ( TAG) på placeringen af den første lysin BMP2´s modne del. Udføre PCR reaktio...

<ol>
	<li>Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+substitutes:+An+update.">Bone substitutes: An update.</a> Injury. 36, S20-S27 (2005).</li><li>Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+proteins:+A+powerful+osteoinductive+compound+with+non-negligible+side+effects+and+limitations.">Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations.</a> Biofactors. 40 (5), 459-481 (2014).</li><li>Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+delivery+of+growth+factors+for+bone+repair.">Localized delivery of growth factors for bone repair.</a> Eur J Pharm Biopharm. 58 (2), 197-208 (2004).</li><li>Haidar, Z. S., Hamdy, R. C., Tabrizian, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+recombinant+bone+morphogenetic+proteins+for+bone+regeneration+and+repair.+Part+A:+Current+challenges+in+BMP+delivery.">Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery.</a> Biotechnol Lett. 31 (12), 1817-1824 (2009).</li><li>Hollinger, J. O., Uludag, H., Winn, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+release+emphasizing+recombinant+human+bone+morphogenetic+protein-2.">Sustained release emphasizing recombinant human bone morphogenetic protein-2.</a> Adv Drug Deliv Rev. 31 (3), 303-318 (1998).</li><li>Uludag, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implantation+of+recombinant+human+bone+morphogenetic+proteins+with+biomaterial+carriers:+A+correlation+between+protein+pharmacokinetics+and+osteoinduction+in+the+rat+ectopic+model.">Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model.</a> J Biomed Mater Res. 50 (2), 227-238 (2000).</li><li>Uludag, H., Golden, J., Palmer, R., Wozney, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinated+bone+morphogenetic+protein-2:+In+vivo+and+in+vitro+activity.">Biotinated bone morphogenetic protein-2: In vivo and in vitro activity.</a> Biotechnol Bioeng. 65 (6), 668-672 (1999).</li><li>Aono, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+ectopic+bone-inducing+activity+of+bone+morphogenetic+protein-4/7+heterodimer.">Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer.</a> Biochem Biophys Res Commun. 210 (3), 670-677 (1995).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alginate+hydrogel+linked+with+synthetic+oligopeptide+derived+from+BMP-2+allows+ectopic+osteoinduction+in+vivo.">Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo.</a> J Biomed Mater Res. 50 (3), 405-409 (2000).</li><li>Knaus, P., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperativity+of+binding+epitopes+and+receptor+chains+in+the+BMP/TGFbeta+superfamily.">Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily.</a> Biol Chem. 382 (8), 1189-1195 (2001).</li><li>Wang, L., Xie, J., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+genetic+code.">Expanding the genetic code.</a> Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).</li><li>Costa, G. L., Weiner, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+PCR+site-directed+mutagenesis.">Rapid PCR site-directed mutagenesis.</a> CSH Protoc. 2006 (1), (2006).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+recombinant+BMP+receptor+IA+ectodomain+and+its+2:1+complex+with+BMP-2.">Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2.</a> FEBS Lett. 468 (2-3), 215-219 (2000).</li><li>Tabisz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+immobilization+of+BMP-2:+Two+approaches+for+the+production+of+innovative+osteoinductive+scaffolds.">Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds.</a> Biomacromolecules. 18 (3), 695-708 (2017).</li><li>Duong-Ly, K. C., Gabelli, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+ion+exchange+chromatography+to+purify+a+recombinantly+expressed+protein.">Using ion exchange chromatography to purify a recombinantly expressed protein.</a> Methods Enzymol. 541, 95-103 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-dimensional+SDS-polyacrylamide+gel+electrophoresis+(1D+SDS-PAGE).">One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE).</a> Methods Enzymol. 541, 151-159 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coomassie+blue+staining.">Coomassie blue staining.</a> Methods Enzymol. 541, 161-167 (2014).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMP-2+antagonists+emerge+from+alterations+in+the+low-affinity+binding+epitope+for+receptor+BMPR-II.">BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II.</a> EMBO J. 19 (13), 3314-3324 (2000).</li><li>Hein, J. E., Fokin, V. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copper-catalyzed+azide-alkyne+cycloaddition+(CuAAC)+and+beyond:+new+reactivity+of+copper(I)+acetylides.">Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides.</a> Chem Soc Rev. 39 (4), 1302-1315 (2010).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+kinetics+analysis+of+BMP2+uptake+into+cells+and+its+modulation+by+BMP+antagonists.">Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists.</a> J Cell Sci. 126 (Pt 1), 117-127 (2013).</li><li>Paarmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamin-dependent+endocytosis+of+Bone+Morphogenetic+Protein2+(BMP2)+and+its+receptors+is+dispensable+for+the+initiation+of+Smad+signaling.">Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling.</a> Int J Biochem Cell Biol. 76, 51-63 (2016).</li><li>Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+immobilization+of+bone+morphogenetic+protein+2+via+a+self-assembled+monolayer+formation+induces+cell+differentiation.">Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation.</a> Acta Biomater. 8 (2), 772-780 (2012).</li></ol>

Generere tagged protein varianter af genetiske codon udvidelse tillader indførelse af forskellige ikke-naturlige aminosyre analoger hovedsagelig på enhver stilling af den primære protein sekvens. I tilfælde af BMP-filer som BMP2, fælles tags som en 6-histidin, (hans) tag kan kun være indført N-terminalt, da protein´s C-terminale ende er begravet inden for tertiær protein struktur, og der således ikke er tilgængelige udefra. På andre positioner, kan størrelsen af den indførte tag meget sandsynligt medføre s...

Det ultimative mål for knogle tissue engineering og knogle regenerering er at overvinde de ulemper og begrænsninger, der opstår under fælles behandlinger af ikke-union frakturer. Auto - eller allo-transplantationscentre er overvejende bruges som nuværende terapi strategier, selvom de begge har flere ulemper. Den ideelle knogletransplantation bør fremkalde osteogenesis osteoinduction samt osteoconduction, hvilket fører til osteointegration af graften i knoglen. I dag, betragtes kun auto-transplantation som den "gyldne standard", da det giver alle egenskaber, en ideel knogletransplantation. Desværre, det præsenterer også vigtige negative aspekter, såsom lange kirurgi gange, og en anden traume websted, der normalt indebærer flere komplikationer (fx, kroniske smerter, hæmatom formationer, infektioner, kosmetiske defekter, osv.). Allogen grafts, har på den anden side suboptimal karakteristika for alle generelle aspekter1. Alternative bone graft teknologier er blevet forbedret i de seneste år, med formålet at producere stilladser, der er osteoinduktive, osteoconductive, biokompatible, og bioresorbable. Da mange biomaterialer ikke viser alle disse osteogenic karakteristika, er forskellige vækstfaktorer, primært BMP2 og BMP7, medtaget for at forbedre den særlige stillads2osteogenic potentiale.
Som et væsentligt kriterium, bør sådanne vækstfaktor leveringssystemer giver en kontrolleret dosis frigivelse over tid for at lette de afgørende begivenheder som celle rekruttering og udlæg, celle indvækst og angiogenese. Dog immobiliseret BMP samt andre osteogenic vækstfaktorer har været almindeligt ikke-kovalent3. Fastklemning og adsorption teknikker kræver brug af supra-fysiologiske mængder af protein på grund af en indledende store udgivelse, som fører til alvorlige ulemper in vivo typisk påvirker det omgivende væv ved at inducere knogle overvækst, Osteolyse, hævelse og inflammation-4. Opbevaring af vækstfaktorer på webstedet levering i længere perioder kan således opnås ved kovalente immobilisering metoder. Kemisk modificerede BMP2 (succinylated5, acetyleret6 eller biotinylated7), manipuleret heterodimers8, eller BMP2 afledte oligopeptides9 er blevet designet og bruges til at overvinde begrænsningerne i forbindelse med absorption. Bio-aktivitet af disse konstruktioner er imidlertid ikke forudsigelig, da ordningen potentielt hæmmer bindingen af immobiliserede ligand på cellulære receptorer. Som tidligere vist er det vigtigt, at alle fire receptor kæder involveret i dannelsen af aktiverede ligand-receptor komplekser interagere med de immobiliserede BMP2 fuldt aktivere alle downstream signaling cascades10.
For at overvinde problemer af en inhomogene produkt resultatet med begrænsninger med hensyn til bioactivity, stabilitet og biotilgængelighed af immobiliserede faktor, vi har designet en BMP variant kan kovalent binding stilladser på en site-directed måde. Denne variant, kaldes BMP2-K3Plk, består af en kunstig aminosyre, som blev indført af genetiske codon ekspansion11. Denne variant har været succesfuldt forbundet med stilladser ved hjælp af en kovalent kobling strategi samtidig opretholde dens biologiske aktivitet.

<table border="0" cellpadding="0" cellspacing="0" style="width:1137px;" width="1138">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Material</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td style="width:403px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1-Step NBT/BCIP</td>
			<td style="width:203px;">Thermo Fisher</td>
			<td style="width:136px;">34042</td>
			<td style="width:403px;">Add solution to cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3-Azido-7-hydroxycoumarin</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCFA-047-1</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Agarose low melting point</td>
			<td style="width:203px;">Biozym</td>
			<td style="width:136px;">840101</td>
			<td>Agarose for ALP assay&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Azide agarose beads</td>
			<td style="width:203px;">Jena Bioscience</td>
			<td style="width:136px;">CLK-1038-2</td>
			<td style="width:403px;">Beads used for reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BamHI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>FD0054</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">BMP receptor IA (BMPR-IAEC)</td>
			<td>--</td>
			<td>--</td>
			<td>Produced in our lab</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Coomassie Brilliant Blue G-250 Dye</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:136px;">20279</td>
			<td>Chemical used for Coomassie Brilliant blue staining of SDS PAGE</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">Copper (II) sulfate anhydrous (CuSO4)</td>
			<td style="width:203px;">Alfa Aesar</td>
			<td style="width:136px;">A13986</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">DNA Polymerase and reaction buffer&#160;</td>
			<td>Kapabiosystems</td>
			<td>KK2102</td>
			<td>KAPA HiFi PCR Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM) GlutaMAX</td>
			<td style="width:203px;">Gibco</td>
			<td style="width:136px;">61965-026</td>
			<td style="width:403px;">Cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">ethylenediaminetetraacetic acid (EDTA)</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">E5134-1kg</td>
			<td style="width:403px;">Chemical used to stop click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Isopropyl &#223;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:203px;">Carl Roth GmbH</td>
			<td style="width:136px;">2316.5</td>
			<td>Bacteria induction (1mM final concentration)&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NdeI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0581</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">NHS-activated Texas Red</td>
			<td style="width:203px;">Life technologies</td>
			<td style="width:136px;">T6134</td>
			<td style="width:403px;">Coupled to receptor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">P- Nitrophenyl Phosphate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">N4645-1G</td>
			<td style="width:403px;">Alkaline Phosphatase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">p25N-hmBMP2&#160;</td>
			<td>--</td>
			<td>--</td>
			<td>Plasmid kindly provided from Walter Sebald to J. Nickel</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET11a-pyrtRNA</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">propargyl-L-lysine (Plk)</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSRFduet-pyrtRNAsynth</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen Gel Extraction Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td style="width:136px;">28704</td>
			<td>Gel Purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen PCR purification Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td>28104</td>
			<td style="width:403px;">PCR Purification&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Sodium L-ascorbate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">A7631-100G</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">T4 DNA Ligase</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">EL0011</td>
			<td>Ligation&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCMI-006-100</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td>X100-1L</td>
			<td style="width:403px;">Triton X 100&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Name</td>
			<td style="width:203px;">Company</td>
			<td style="width:136px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Equipment</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Amicon concentrating cell 400 ml&#160;</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFSC40001</td>
			<td style="width:403px;">Concentrating unit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amicon Ultra-15 Centrifugal Filter Units</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFC901024</td>
			<td style="width:403px;">Concentrating centrifugal unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">&#196;KTA avant FPLC</td>
			<td>&#196;KTA</td>
			<td>--</td>
			<td>FPLC machine</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Avanti J-26XP</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">393124</td>
			<td>Centrifuge for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Bacterial Shaking Incubator</td>
			<td style="width:203px;">Infors HT</td>
			<td style="width:136px;"></td>
			<td>Shaking incubator for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">FluorChem Q system</td>
			<td style="width:203px;">proteinsimple</td>
			<td style="width:136px;">--</td>
			<td>Imaging and analysis system for SDS-PAGE</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Fluorescent miscroscope</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;">BZ-9000 (BIOREVO)</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fractogel&#174; EMD SO3- (M)</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">116882</td>
			<td style="width:403px;">Ion Exchange Chromatography column material</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Greiner CELLSTAR&#174;&#160;96 well plates</td>
			<td style="width:203px;">Sigma</td>
			<td>M5811-40EA</td>
			<td>96 well plates for cell culture (ALP Assay)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Heraeus Multifuge X1R</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoScientific</td>
			<td style="width:136px;">75003624</td>
			<td>Rotor for Microcentrifuge for plate during ALP staining</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Microcentrifuge - 5417R</td>
			<td style="width:203px;">Eppendorf</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">OriginPro 9.1 G&#160;</td>
			<td style="width:203px;">OriginLab</td>
			<td style="width:136px;">--</td>
			<td>software for stastic analysis of ALP assay data</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polysine Slides</td>
			<td>ThermoScientific</td>
			<td>10143265</td>
			<td>microscope slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA-10</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JLA 8.1</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA 25.50</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tecan infinite M200 multiplate reader</td>
			<td style="width:203px;">Tecan Deutschland GmbH</td>
			<td style="width:136px;">--</td>
			<td>Multiplate reader for ALP assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Thermocycler - Labcycler Gradient</td>
			<td style="width:203px;">SensoQuest GmbH</td>
			<td style="width:136px;">--</td>
			<td>PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">TxRed - microscope filter</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;"></td>
			<td>Filter for fluorescent microscope&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 3 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLBC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 10 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLGC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
	</tbody>
</table>

site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry

Forskellige terapeutiske strategier til behandling af ikke-healing lange knogledefekter har været intensivt undersøgt. I øjeblikket anvendes behandlinger findes flere begrænsninger, der har ført til brugen af biomaterialer i kombination med osteogenic vækst faktorer, såsom ben morfogenetiske proteiner (BMP). Almindeligt anvendte absorption eller indkapsling metoder kræver supra-fysiologiske mængder af BMP2, typisk resulterer i en såkaldt indledende burst release effekt, som provokerer flere alvorlige bivirkninger. En mulig strategi at overvinde disse problemer ville være at kovalent par protein til skafottet. Desuden skal kobling udføres i en lokationsspecifik måde for at sikre en reproducerbar produkt resultat. Derfor, vi skabt en BMP2 variant, hvor en kunstig aminosyre (propargyl-L-lysin) blev indført i den ældre del af BMP2 proteinet af codon skik ekspansion (BMP2-K3Plk). BMP2-K3Plk var koblet til functionalized perler gennem kobber katalyseret indeholder-alkyn cycloaddition (CuAAC). Den biologiske aktivitet i den koblede BMP2-K3Plk blev bevist i vitro og osteogenic aktiviteten af de BMP2-K3Plk-functionalized perler blev bevist i celle-baserede assays. Functionalized perler i kontakt med C2C12 celler var i stand til at fremkalde alkalisk fosfatase (ALP) udtryk i lokalt begrænset nærhed af perle. Derfor, af denne teknik, functionalized stilladser kan produceres der kan udløse Celledifferentiering mod en osteogenic afstamning. Derudover er lavere BMP2 doser tilstrækkelig på grund af den kontrollerede orientering af site-directed koblede BMP2. Med denne metode, er BMP-filer altid udsat for deres receptorer på cellens overflade i den passende orientering, hvilket ikke er tilfældet hvis faktorer, der er koblet via ikke-site-directed kobling teknikker. Produkt resultatet er meget styrbar, og dermed resulterer i materialer med ensartede egenskaber, forbedre deres anvendelighed for reparation af kritiske størrelse knogle defekter.

I denne artikel vil beskrive vi en metode til at kovalent par en ny BMP2 variant, BMP2-K3Plk, til kommercielt tilgængelige indeholder functionalized Agarosen perler (figur 1). Bioactivity af de producerede BMP2-K3Plk variant blev valideret af induktion af alkalisk fosfatase (ALP) Gen-ekspression i C2C12 celler. In vitro- test viser lignende ALP udtryk niveauer induceret af vildtype BMP2 (BMP2-WT) og BMP2-K3Plk (figur 2)...

Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Biomaterialer doteret med ben morfogenetiske proteiner 2 (BMP2) har været brugt som en ny terapeutisk strategi for at helbrede ikke-union knoglebrud. For at overvinde bivirkninger som følge af en ukontrollabel frigivelsen af faktoren, vi foreslår en ny strategi til site-direkte immobilisere den faktor, således at skabe materialer med forbedret osteogenic kapaciteter.

Site-Directed immobilisering af ben morfogenetiske proteiner 2 til faste overflader af klik kemi

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present ...

Research

JoVE Journal

Bioengineering

Micropatterned Surfaces to Study Hyaluronic Acid Interactions with Cancer Cells

Cancer invasion and progression involves a motile cell phenotype, which is under complex regulation by growth factors/cytokines and extracellular matrix ...

Thermodynamics of Membrane Protein Folding Measured by Fluorescence Spectroscopy

Membrane protein folding is an emerging topic with both fundamental and health-related significance.  The abundance of membrane proteins in cells ...

Bacterial Immobilization for Imaging by Atomic Force Microscopy

AFM is a high-resolution (nm scale) imaging tool that mechanically probes a surface.  It has the ability to image cells and biomolecules, in a liquid ...

Fluorescence detection methods for microfluidic droplet platforms

Fluorescenspåvisning metoder for mikrofluide dråbe platforme

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Monitoring Protein Adsorption with Solid-state Nanopores

Overvågning Protein Adsorption med Solid-state Nanopores

Solid-state nanopores have been used to perform measurements at the single-molecule level to examine the local structure and flexibility of nucleic acids ...

Hydrophobic Salt-modified Nafion for Enzyme Immobilization and Stabilization

Over the last decade, there has been a wealth of application for immobilized and stabilized enzymes including biocatalysis, biosensors, and biofuel ...

Preparation of Thermoresponsive Nanostructured Surfaces for Tissue Engineering

Udarbejdelse af termoresponsiv nanostrukturerede overflader for Tissue Engineering

Thermoresponsive poly(N-isopropylacrylamide) (PIPAAm)-immobilized surfaces for controlling cell adhesion and detachment were fabricated by the ...

Wet Chemistry and Peptide Immobilization on Polytetrafluoroethylene for Improved Cell-adhesion

Wet Kemi og peptid Immobilisering på Polytetrafluorethylen for Forbedret Cell-vedhæftning

Endowing materials surface with cell-adhesive properties is a common strategy in biomaterial research and tissue engineering. This is particularly ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Engineering 'Gyldne' fluorescens af selektiv pres indarbejdelse af ikke-kanoniske aminosyrer og proteinanalyse af massespektrometri og fluorescens

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Making Conjugation-induced Fluorescent PEGylated Virus-like Particles by Dibromomaleimide-disulfide Chemistry

Gør konjugation-induceret fluorescerende pegyleret viruslignende partikler af Dibromomaleimide-disulfid kemi

The recent rise in virus-like particles (VLPs) in biomedical and materials research can be attributed to their ease of biosynthesis, discrete size, ...