Name: site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry
Uploaded: 2018-03-29T13:00:00
Description: Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

De auteurs bedanken Dr. M. Rubini (Konstanz, Duitsland) voor het verstrekken van de plasmide codering pyrrolysyl-tRNA en voor het verstrekken van pRSFduet-pyrtRNAsynth de overeenkomstige aminoacyl-tRNA synthetase-codering.

1. de productie van de BMP2 Variant BMP2-K3Plk
<ol><li>Klonen van BMP2-K3Plk door plaats-geleide mutagenese met behulp van PCR 12<ol>
<li>Versterken van menselijke volwassen BMP2 (hmBMP2) van een p25N-hmBMP2-vector (Zie Tabel van materialen) met een voorwaartse primer (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') en een omgekeerde primer (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') invoering van een amber stop codon ( Label) op de positie van de eerste lysine van vol...

<ol>
	<li>Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+substitutes:+An+update.">Bone substitutes: An update.</a> Injury. 36, S20-S27 (2005).</li><li>Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+proteins:+A+powerful+osteoinductive+compound+with+non-negligible+side+effects+and+limitations.">Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations.</a> Biofactors. 40 (5), 459-481 (2014).</li><li>Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+delivery+of+growth+factors+for+bone+repair.">Localized delivery of growth factors for bone repair.</a> Eur J Pharm Biopharm. 58 (2), 197-208 (2004).</li><li>Haidar, Z. S., Hamdy, R. C., Tabrizian, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+recombinant+bone+morphogenetic+proteins+for+bone+regeneration+and+repair.+Part+A:+Current+challenges+in+BMP+delivery.">Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery.</a> Biotechnol Lett. 31 (12), 1817-1824 (2009).</li><li>Hollinger, J. O., Uludag, H., Winn, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+release+emphasizing+recombinant+human+bone+morphogenetic+protein-2.">Sustained release emphasizing recombinant human bone morphogenetic protein-2.</a> Adv Drug Deliv Rev. 31 (3), 303-318 (1998).</li><li>Uludag, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implantation+of+recombinant+human+bone+morphogenetic+proteins+with+biomaterial+carriers:+A+correlation+between+protein+pharmacokinetics+and+osteoinduction+in+the+rat+ectopic+model.">Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model.</a> J Biomed Mater Res. 50 (2), 227-238 (2000).</li><li>Uludag, H., Golden, J., Palmer, R., Wozney, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinated+bone+morphogenetic+protein-2:+In+vivo+and+in+vitro+activity.">Biotinated bone morphogenetic protein-2: In vivo and in vitro activity.</a> Biotechnol Bioeng. 65 (6), 668-672 (1999).</li><li>Aono, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+ectopic+bone-inducing+activity+of+bone+morphogenetic+protein-4/7+heterodimer.">Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer.</a> Biochem Biophys Res Commun. 210 (3), 670-677 (1995).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alginate+hydrogel+linked+with+synthetic+oligopeptide+derived+from+BMP-2+allows+ectopic+osteoinduction+in+vivo.">Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo.</a> J Biomed Mater Res. 50 (3), 405-409 (2000).</li><li>Knaus, P., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperativity+of+binding+epitopes+and+receptor+chains+in+the+BMP/TGFbeta+superfamily.">Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily.</a> Biol Chem. 382 (8), 1189-1195 (2001).</li><li>Wang, L., Xie, J., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+genetic+code.">Expanding the genetic code.</a> Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).</li><li>Costa, G. L., Weiner, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+PCR+site-directed+mutagenesis.">Rapid PCR site-directed mutagenesis.</a> CSH Protoc. 2006 (1), (2006).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+recombinant+BMP+receptor+IA+ectodomain+and+its+2:1+complex+with+BMP-2.">Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2.</a> FEBS Lett. 468 (2-3), 215-219 (2000).</li><li>Tabisz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+immobilization+of+BMP-2:+Two+approaches+for+the+production+of+innovative+osteoinductive+scaffolds.">Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds.</a> Biomacromolecules. 18 (3), 695-708 (2017).</li><li>Duong-Ly, K. C., Gabelli, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+ion+exchange+chromatography+to+purify+a+recombinantly+expressed+protein.">Using ion exchange chromatography to purify a recombinantly expressed protein.</a> Methods Enzymol. 541, 95-103 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-dimensional+SDS-polyacrylamide+gel+electrophoresis+(1D+SDS-PAGE).">One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE).</a> Methods Enzymol. 541, 151-159 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coomassie+blue+staining.">Coomassie blue staining.</a> Methods Enzymol. 541, 161-167 (2014).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMP-2+antagonists+emerge+from+alterations+in+the+low-affinity+binding+epitope+for+receptor+BMPR-II.">BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II.</a> EMBO J. 19 (13), 3314-3324 (2000).</li><li>Hein, J. E., Fokin, V. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copper-catalyzed+azide-alkyne+cycloaddition+(CuAAC)+and+beyond:+new+reactivity+of+copper(I)+acetylides.">Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides.</a> Chem Soc Rev. 39 (4), 1302-1315 (2010).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+kinetics+analysis+of+BMP2+uptake+into+cells+and+its+modulation+by+BMP+antagonists.">Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists.</a> J Cell Sci. 126 (Pt 1), 117-127 (2013).</li><li>Paarmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamin-dependent+endocytosis+of+Bone+Morphogenetic+Protein2+(BMP2)+and+its+receptors+is+dispensable+for+the+initiation+of+Smad+signaling.">Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling.</a> Int J Biochem Cell Biol. 76, 51-63 (2016).</li><li>Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+immobilization+of+bone+morphogenetic+protein+2+via+a+self-assembled+monolayer+formation+induces+cell+differentiation.">Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation.</a> Acta Biomater. 8 (2), 772-780 (2012).</li></ol>

Genereren van gecodeerde eiwit varianten door genetische codon expansie kan de invoering van verschillende niet-natuurlijke aminozuur-analogen voornamelijk op elke positie van de primaire eiwit sequentie. In het geval van BMP's zoals BMP2, gemeenschappelijke tags, zoals een 6-Histidine (zijn)-tag kan alleen worden aangebracht N-terminaal, sedert het einde van de protein´s C-terminal is begraven in de tertiaire eiwitstructuur, en dus niet toegankelijk vanaf de buitenkant is. Op andere posities, kan de grootte van de geï...

Het uiteindelijke doel van bot weefselregeneratie engineering en bot is het overwinnen van de nadelen en beperkingen die zich voordoen tijdens voorkomende behandelingen van non-adhesie fracturen. Auto - of allo-transplantaties worden voornamelijk gebruikt als huidige therapie strategieën, ook al ze beide verschillende nadelen hebben. De ideale bottransplantatie moet induceren osteogenesis door zowel osteoinduction als osteoconduction, wat leidt tot de osteointegration van de prothese in het bot. Alleen auto-transplantatie wordt tegenwoordig beschouwd als de "gouden standaard" omdat het voorziet alle karakteristieken van een ideale bottransplantatie. Helaas presenteert het ook belangrijke negatieve aspecten, zoals lange chirurgie times, en een tweede trauma site dien meestal meer complicaties (bijvoorbeeldchronische pijn, hematoom formaties, infecties, cosmetische defecten, enz.). Allogene transplantaten, hebben aan de andere kant suboptimaal kenmerken voor alle algemene aspecten1. Alternatieve bone graft technologieën zijn verbeterd in de afgelopen jaren, met als doel het produceren van steigers die osteo-inductief, osteoconductive, biocompatibel, en bioresorbable. Aangezien veel biomaterialen niet al deze osteogenic kenmerken vertonen, zijn verschillende groeifactoren, voornamelijk BMP2 en BMP7, ter verbetering van het osteogenic potentieel van de bijzondere steiger2opgenomen.
Als een essentieel criterium dienen dergelijke groeifactor levering systemen een release van de gecontroleerde dosis na verloop van tijd ter vergemakkelijking van de essentiële gebeurtenissen zoals cel aanwerving en bijlage, cel ingroei en angiogenese. Echter BMP's evenals andere osteogenic groeifactoren zijn vaak geïmmobiliseerd non-covalent3. Entrapment en adsorptie technieken vereisen het gebruik van supra-fysiologische hoeveelheden eiwit door de vrijval van een eerste uitbarsting, die tot ernstige nadelen in vivo meestal invloed op de omliggende weefsels leidt door het inducerende bot begroeiing, Osteolyse, zwelling en ontsteking4. Dus, het behoud van groeifactoren op de site van de levering voor langere perioden kan worden bereikt door covalente immobilisatie methoden. Chemisch gewijzigd BMP2 (succinylated5, geacetyleerd6 of biotinyleerd7) heterodimers8ontworpen, of BMP2 afgeleide oligopeptides9 zijn ontworpen en gebruikt voor het overwinnen van de beperkingen met betrekking tot absorptie. De bio-activiteit van deze constructies is echter niet voorspelbaar omdat de regeling mogelijk de binding van de geïmmobiliseerdet ligand aan de cellulaire receptoren remt. Als eerder is laten zien is het essentieel dat alle vier receptor ketens die betrokken zijn bij de vorming van complexen van de geactiveerde ligand-receptor interactie met de geïmmobiliseerdet BMP2 om alle downstream signalering cascades10volledig te activeren.
Om de problemen van een inhomogene product resultaat met beperkingen in termen van topicale, stabiliteit en biologische beschikbaarheid van de geïmmobiliseerdet factor, ontwierpen we een BMP variant kan covalent verbindend steigers in een plaats-geleide manier. Deze variant, aangeduid als BMP2-K3Plk, bestaat uit een kunstmatige aminozuur werd geïntroduceerd door genetische codon uitbreiding11. Deze variant is met succes gekoppeld aan steigers met behulp van een covalente koppeling strategie met behoud van de biologische activiteit.

<table border="0" cellpadding="0" cellspacing="0" style="width:1137px;" width="1138">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Material</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td style="width:403px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1-Step NBT/BCIP</td>
			<td style="width:203px;">Thermo Fisher</td>
			<td style="width:136px;">34042</td>
			<td style="width:403px;">Add solution to cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3-Azido-7-hydroxycoumarin</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCFA-047-1</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Agarose low melting point</td>
			<td style="width:203px;">Biozym</td>
			<td style="width:136px;">840101</td>
			<td>Agarose for ALP assay&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Azide agarose beads</td>
			<td style="width:203px;">Jena Bioscience</td>
			<td style="width:136px;">CLK-1038-2</td>
			<td style="width:403px;">Beads used for reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BamHI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>FD0054</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">BMP receptor IA (BMPR-IAEC)</td>
			<td>--</td>
			<td>--</td>
			<td>Produced in our lab</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Coomassie Brilliant Blue G-250 Dye</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:136px;">20279</td>
			<td>Chemical used for Coomassie Brilliant blue staining of SDS PAGE</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">Copper (II) sulfate anhydrous (CuSO4)</td>
			<td style="width:203px;">Alfa Aesar</td>
			<td style="width:136px;">A13986</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">DNA Polymerase and reaction buffer&#160;</td>
			<td>Kapabiosystems</td>
			<td>KK2102</td>
			<td>KAPA HiFi PCR Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM) GlutaMAX</td>
			<td style="width:203px;">Gibco</td>
			<td style="width:136px;">61965-026</td>
			<td style="width:403px;">Cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">ethylenediaminetetraacetic acid (EDTA)</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">E5134-1kg</td>
			<td style="width:403px;">Chemical used to stop click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Isopropyl &#223;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:203px;">Carl Roth GmbH</td>
			<td style="width:136px;">2316.5</td>
			<td>Bacteria induction (1mM final concentration)&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NdeI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0581</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">NHS-activated Texas Red</td>
			<td style="width:203px;">Life technologies</td>
			<td style="width:136px;">T6134</td>
			<td style="width:403px;">Coupled to receptor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">P- Nitrophenyl Phosphate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">N4645-1G</td>
			<td style="width:403px;">Alkaline Phosphatase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">p25N-hmBMP2&#160;</td>
			<td>--</td>
			<td>--</td>
			<td>Plasmid kindly provided from Walter Sebald to J. Nickel</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET11a-pyrtRNA</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">propargyl-L-lysine (Plk)</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSRFduet-pyrtRNAsynth</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen Gel Extraction Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td style="width:136px;">28704</td>
			<td>Gel Purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen PCR purification Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td>28104</td>
			<td style="width:403px;">PCR Purification&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Sodium L-ascorbate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">A7631-100G</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">T4 DNA Ligase</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">EL0011</td>
			<td>Ligation&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCMI-006-100</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td>X100-1L</td>
			<td style="width:403px;">Triton X 100&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Name</td>
			<td style="width:203px;">Company</td>
			<td style="width:136px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Equipment</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Amicon concentrating cell 400 ml&#160;</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFSC40001</td>
			<td style="width:403px;">Concentrating unit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amicon Ultra-15 Centrifugal Filter Units</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFC901024</td>
			<td style="width:403px;">Concentrating centrifugal unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">&#196;KTA avant FPLC</td>
			<td>&#196;KTA</td>
			<td>--</td>
			<td>FPLC machine</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Avanti J-26XP</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">393124</td>
			<td>Centrifuge for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Bacterial Shaking Incubator</td>
			<td style="width:203px;">Infors HT</td>
			<td style="width:136px;"></td>
			<td>Shaking incubator for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">FluorChem Q system</td>
			<td style="width:203px;">proteinsimple</td>
			<td style="width:136px;">--</td>
			<td>Imaging and analysis system for SDS-PAGE</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Fluorescent miscroscope</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;">BZ-9000 (BIOREVO)</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fractogel&#174; EMD SO3- (M)</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">116882</td>
			<td style="width:403px;">Ion Exchange Chromatography column material</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Greiner CELLSTAR&#174;&#160;96 well plates</td>
			<td style="width:203px;">Sigma</td>
			<td>M5811-40EA</td>
			<td>96 well plates for cell culture (ALP Assay)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Heraeus Multifuge X1R</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoScientific</td>
			<td style="width:136px;">75003624</td>
			<td>Rotor for Microcentrifuge for plate during ALP staining</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Microcentrifuge - 5417R</td>
			<td style="width:203px;">Eppendorf</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">OriginPro 9.1 G&#160;</td>
			<td style="width:203px;">OriginLab</td>
			<td style="width:136px;">--</td>
			<td>software for stastic analysis of ALP assay data</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polysine Slides</td>
			<td>ThermoScientific</td>
			<td>10143265</td>
			<td>microscope slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA-10</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JLA 8.1</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA 25.50</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tecan infinite M200 multiplate reader</td>
			<td style="width:203px;">Tecan Deutschland GmbH</td>
			<td style="width:136px;">--</td>
			<td>Multiplate reader for ALP assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Thermocycler - Labcycler Gradient</td>
			<td style="width:203px;">SensoQuest GmbH</td>
			<td style="width:136px;">--</td>
			<td>PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">TxRed - microscope filter</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;"></td>
			<td>Filter for fluorescent microscope&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 3 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLBC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 10 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLGC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
	</tbody>
</table>

site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry

Verschillende therapeutische strategieën voor de behandeling van niet-genezende lang bot gebreken zijn intensief onderzocht. Momenteel gebruikt behandelingen aanwezig verschillende beperkingen die hebben geleid tot het gebruik van biomaterialen in combinatie met osteogenic groeifactoren, zoals bot morfogenetische eiwitten (BMP's). Veelgebruikte methoden voor absorptie of inkapseling vereisen supra-fysiologische hoeveelheden BMP2, typisch resulterend in een zogenaamde eerste uitbarsting release effect dat diverse ernstige nadelige bijwerkingen lokt. Covalent het eiwit te koppelen aan het schavot zou een mogelijke strategie om deze problemen te overwinnen. Koppeling, moet bovendien, teneinde een reproduceerbare product resultaat op een specifieke wijze te worden uitgevoerd. Dus we gemaakt een BMP2 variant, waarin een kunstmatige aminozuur (propargyl-L-lysine) werd geïntroduceerd in het volwassen deel van de BMP2 proteïne door codon gebruik expansie (BMP2-K3Plk). BMP2-K3Plk werd gekoppeld aan matiemaatschappij kralen door koper gekatalyseerde azide-alkyn cycloadditie (CuAAC). De biologische activiteit van de gekoppelde BMP2-K3Plk in vitro werd bewezen, en de osteogenic activiteit van de BMP2-K3Plk-matiemaatschappij parels werd bewezen in cellen gebaseerd. De functionalized kralen in contact met C2C12 cellen konden voor het opwekken van expressie van het alkalisch fosfatase (ALP) in de nabijheid van het lokaal beperkt van de parel. Dus, door deze techniek, matiemaatschappij steigers kunnen worden geproduceerd dat kan leiden tot celdifferentiatie naar een osteogenic afstamming. Bovendien, volstaan lagere BMP2 doses als gevolg van de gecontroleerde oriëntatie van plaats-geleide gekoppelde BMP2. Met deze methode worden de BMP's altijd blootgesteld aan hun receptoren op het celoppervlak in de juiste oriëntatie, die niet het geval is als de factoren zijn gekoppeld via niet-plaats-geleide koppeling technieken. Het resultaat van het product is zeer controleerbaar en dus resultaten in materialen met homogene eigenschappen, verbetering van hun toepasbaarheid voor de reparatie van kritische omvang bot gebreken.

In dit artikel beschrijven we een methode om te koppelen covalent een nieuwe variant van de BMP2, BMP2-K3Plk, aan verkrijgbare azide matiemaatschappij agarose kralen (Figuur 1). De topicale van de geproduceerde BMP2-K3Plk-variant werd gevalideerd door de inductie van alkalische fosfatase (ALP) genexpressie in cellen van de C2C12. De in vitro -test toont vergelijkbare ALP expressie niveaus geïnduceerd door wild type BMP2 (BMP2-WT) en BMP2-K3Plk (<str...

Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Biomaterialen doped met bot morfogenetische eiwit 2 (BMP2) zijn gebruikt als een nieuwe therapeutische strategie om non-adhesie botbreuken genezen. Om te overwinnen bijwerkingen als gevolg van een oncontroleerbare release van de factor, stellen wij voor een nieuwe strategie aan site-direct immobiliseren de factor, waardoor materialen met verbeterde mogelijkheden voor osteogenic.

Plaats-geleide immobilisatie van bot morfogenetische proteïne 2 op vaste oppervlakken door klik chemie

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present ...

Research

JoVE Journal

Bioengineering

Micropatterned Surfaces to Study Hyaluronic Acid Interactions with Cancer Cells

Micropatterned Oppervlakken aan hyaluronzuur Interacties met kanker cellen te bestuderen

Cancer invasion and progression involves a motile cell phenotype, which is under complex regulation by growth factors/cytokines and extracellular matrix ...

Thermodynamics of Membrane Protein Folding Measured by Fluorescence Spectroscopy

Thermodynamica van membraaneiwit Folding Gemeten door fluorescentiespectroscopie

Membrane protein folding is an emerging topic with both fundamental and health-related significance.  The abundance of membrane proteins in cells ...

Bacterial Immobilization for Imaging by Atomic Force Microscopy

Bacteriële Immobilisatie for Imaging door Atomic Force Microscopy

AFM is a high-resolution (nm scale) imaging tool that mechanically probes a surface.  It has the ability to image cells and biomolecules, in a liquid ...

Fluorescence detection methods for microfluidic droplet platforms

Fluorescentie detectiemethoden voor microfluïdische druppel platforms

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Monitoring Protein Adsorption with Solid-state Nanopores

Monitoring eiwitadsorptie met Solid-state Nanoporiën

Solid-state nanopores have been used to perform measurements at the single-molecule level to examine the local structure and flexibility of nucleic acids ...

Hydrophobic Salt-modified Nafion for Enzyme Immobilization and Stabilization

Hydrofobe Salt gemodificeerde Nafion voor enzym immobilisatie en stabilisatie

Over the last decade, there has been a wealth of application for immobilized and stabilized enzymes including biocatalysis, biosensors, and biofuel ...

Preparation of Thermoresponsive Nanostructured Surfaces for Tissue Engineering

Voorbereiding van de thermoresponsieve nanogestructureerde oppervlakken voor Tissue Engineering

Thermoresponsive poly(N-isopropylacrylamide) (PIPAAm)-immobilized surfaces for controlling cell adhesion and detachment were fabricated by the ...

Wet Chemistry and Peptide Immobilization on Polytetrafluoroethylene for Improved Cell-adhesion

Natte Chemie en Peptide immobilisatie op Polytetrafluoroethyleen voor betere Cel-adhesie

Endowing materials surface with cell-adhesive properties is a common strategy in biomaterial research and tissue engineering. This is particularly ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Engineering 'Golden' fluorescentie door selectieve druk opneming van niet-canonieke aminozuren en eiwit analyse door massaspectrometrie en fluorescentie

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Making Conjugation-induced Fluorescent PEGylated Virus-like Particles by Dibromomaleimide-disulfide Chemistry

Vervoeging-geïnduceerde fluorescerende gepegyleerde virusachtige deeltjes door Dibromomaleimide-disulfide chemie maken

The recent rise in virus-like particles (VLPs) in biomedical and materials research can be attributed to their ease of biosynthesis, discrete size, ...