Name: site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry
Uploaded: 2018-03-29T13:00:00
Description: Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Les auteurs remercient Dr M. Rubini (Constance, Allemagne) pour fournir le plasmide codant pyrrolysyl-tRNA et de fournir des pRSFduet-pyrtRNAsynth, codant la correspondante aminoacyl-ARNt synthétase.

1. production de la BMP2 variante BMP2-K3Plk
<ol><li>Clonage de BMP2-K3Plk par mutagénèse dirigée par PCR 12<ol>
<li>Amplifier la BMP2 maturité humaine (hmBMP2) d’un vecteur de p25N-hmBMP2 (voir la Table des matières) avec une amorce vers l’avant (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3') et une amorce de marche arrière (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3') présentant une (de codon stop ambre TAG) à la position de la lysine première partie matu...

<ol>
	<li>Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+substitutes:+An+update.">Bone substitutes: An update.</a> Injury. 36, S20-S27 (2005).</li><li>Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+proteins:+A+powerful+osteoinductive+compound+with+non-negligible+side+effects+and+limitations.">Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations.</a> Biofactors. 40 (5), 459-481 (2014).</li><li>Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+delivery+of+growth+factors+for+bone+repair.">Localized delivery of growth factors for bone repair.</a> Eur J Pharm Biopharm. 58 (2), 197-208 (2004).</li><li>Haidar, Z. S., Hamdy, R. C., Tabrizian, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+recombinant+bone+morphogenetic+proteins+for+bone+regeneration+and+repair.+Part+A:+Current+challenges+in+BMP+delivery.">Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery.</a> Biotechnol Lett. 31 (12), 1817-1824 (2009).</li><li>Hollinger, J. O., Uludag, H., Winn, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+release+emphasizing+recombinant+human+bone+morphogenetic+protein-2.">Sustained release emphasizing recombinant human bone morphogenetic protein-2.</a> Adv Drug Deliv Rev. 31 (3), 303-318 (1998).</li><li>Uludag, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implantation+of+recombinant+human+bone+morphogenetic+proteins+with+biomaterial+carriers:+A+correlation+between+protein+pharmacokinetics+and+osteoinduction+in+the+rat+ectopic+model.">Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model.</a> J Biomed Mater Res. 50 (2), 227-238 (2000).</li><li>Uludag, H., Golden, J., Palmer, R., Wozney, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinated+bone+morphogenetic+protein-2:+In+vivo+and+in+vitro+activity.">Biotinated bone morphogenetic protein-2: In vivo and in vitro activity.</a> Biotechnol Bioeng. 65 (6), 668-672 (1999).</li><li>Aono, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+ectopic+bone-inducing+activity+of+bone+morphogenetic+protein-4/7+heterodimer.">Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer.</a> Biochem Biophys Res Commun. 210 (3), 670-677 (1995).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alginate+hydrogel+linked+with+synthetic+oligopeptide+derived+from+BMP-2+allows+ectopic+osteoinduction+in+vivo.">Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo.</a> J Biomed Mater Res. 50 (3), 405-409 (2000).</li><li>Knaus, P., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperativity+of+binding+epitopes+and+receptor+chains+in+the+BMP/TGFbeta+superfamily.">Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily.</a> Biol Chem. 382 (8), 1189-1195 (2001).</li><li>Wang, L., Xie, J., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+genetic+code.">Expanding the genetic code.</a> Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).</li><li>Costa, G. L., Weiner, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+PCR+site-directed+mutagenesis.">Rapid PCR site-directed mutagenesis.</a> CSH Protoc. 2006 (1), (2006).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+recombinant+BMP+receptor+IA+ectodomain+and+its+2:1+complex+with+BMP-2.">Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2.</a> FEBS Lett. 468 (2-3), 215-219 (2000).</li><li>Tabisz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+immobilization+of+BMP-2:+Two+approaches+for+the+production+of+innovative+osteoinductive+scaffolds.">Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds.</a> Biomacromolecules. 18 (3), 695-708 (2017).</li><li>Duong-Ly, K. C., Gabelli, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+ion+exchange+chromatography+to+purify+a+recombinantly+expressed+protein.">Using ion exchange chromatography to purify a recombinantly expressed protein.</a> Methods Enzymol. 541, 95-103 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-dimensional+SDS-polyacrylamide+gel+electrophoresis+(1D+SDS-PAGE).">One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE).</a> Methods Enzymol. 541, 151-159 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coomassie+blue+staining.">Coomassie blue staining.</a> Methods Enzymol. 541, 161-167 (2014).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMP-2+antagonists+emerge+from+alterations+in+the+low-affinity+binding+epitope+for+receptor+BMPR-II.">BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II.</a> EMBO J. 19 (13), 3314-3324 (2000).</li><li>Hein, J. E., Fokin, V. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copper-catalyzed+azide-alkyne+cycloaddition+(CuAAC)+and+beyond:+new+reactivity+of+copper(I)+acetylides.">Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides.</a> Chem Soc Rev. 39 (4), 1302-1315 (2010).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+kinetics+analysis+of+BMP2+uptake+into+cells+and+its+modulation+by+BMP+antagonists.">Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists.</a> J Cell Sci. 126 (Pt 1), 117-127 (2013).</li><li>Paarmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamin-dependent+endocytosis+of+Bone+Morphogenetic+Protein2+(BMP2)+and+its+receptors+is+dispensable+for+the+initiation+of+Smad+signaling.">Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling.</a> Int J Biochem Cell Biol. 76, 51-63 (2016).</li><li>Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+immobilization+of+bone+morphogenetic+protein+2+via+a+self-assembled+monolayer+formation+induces+cell+differentiation.">Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation.</a> Acta Biomater. 8 (2), 772-780 (2012).</li></ol>

Générant des variants protéiques marqués par expansion de codon génétique permet l’introduction de divers acides aminés non naturels analogues, principalement dans la position de la séquence protéique primaire. Dans le cas de PGB comme BMP2, common tags comme une balise 6-Histidine (His) ne peut être introduit N-terminale, depuis la fin de protein´s C-terminal est enterrée au sein de la structure tertiaire protéique et n’est donc pas accessible de l’extérieur. En d’autres positions, la taille de la ...

Le but ultime de la régénération de génie et d’os tissulaire osseuse est de surmonter les inconvénients et les limites qui se produisent durant les traitements courants des fractures non syndiqués. Auto - ou allo-greffes sont utilisés principalement comme des stratégies de traitement actuelles, même s’ils ont plusieurs inconvénients. La greffe osseuse idéale doit inciter l’ostéogénèse par Ostéoinduction ainsi qu’osteoconduction, ce qui entraîne l’ostéointégration de la prothèse dans l’OS. De nos jours, seulement auto-transplantation est considérée comme le « gold standard » puisqu’elle offre toutes les caractéristiques d’un greffon osseux idéal. Malheureusement, il présente aussi des aspects négatifs importants, tels que la chirurgie long temps et un second site de traumatisme qui généralement entraîne plus de complications (par exemple, la douleur chronique, formations de l’hématome, infections, défauts cosmétiques, etc.). Les greffes allogènes, ont en revanche sous-optimale caractéristiques pour tous les aspects généraux1. Technologies de greffe d’OS alternatifs ont été améliorées dans les dernières années, dans le but de produire des échafaudages ostéo-inducteurs, ostéoconducteur, biocompatible, et biorésorbables. Étant donné que nombreux biomatériaux ne présente pas toutes ces caractéristiques ostéogéniques, différents facteurs de croissance, principalement la BMP2 et la BMP7, ont été incorporés afin d’améliorer le potentiel ostéogénique de l' échafaudage particulier2.
Comme un critère essentiel, ces vecteurs de facteur de croissance devrait fournir une dose contrôlée de libération au fil du temps afin de faciliter les événements essentiels comme la cellule recrutement et attachement, interposition cellulaire et l’angiogenèse. Cependant, PGB ainsi que d’autres facteurs de croissance ostéogéniques ont été généralement immobilisés façon non covalente3. Techniques de piégeage et d’adsorption nécessitent l’utilisation de quantités supra-physiologique de protéine suite à un communiqué de l’éclatement initial, qui entraîne des inconvénients graves in vivo, affectant généralement les tissus environnants en induisant la prolifération osseuse, 4ostéolyse, gonflement et l’inflammation. Ainsi, le maintien de facteurs de croissance sur le site de livraison pour des périodes plus longues sont possibles par des méthodes d’immobilisation covalente. Chimiquement modifiées BMP2 (succinylé5, acétylés6 ou biotinylé7), ingénierie des hétérodimères8ou BMP2 oligopeptides dérivées9 ont été conçues et utilisées pour surmonter les limitations liées à absorption. Toutefois, la bio-activité de ces constructions n’est pas prévisible puisque l’arrangement potentiellement inhibe la liaison du ligand immobilisé sur les récepteurs cellulaires. Comme indiqué précédemment, il est essentiel que tous les quatre chaînes de récepteurs impliqués dans la formation des complexes activés ligand-récepteur interagissent avec la BMP2 immobilisée afin d’activer pleinement tout en aval de cascades signalisation10.
Pour surmonter les problèmes de l’issue de produits non homogènes avec des limitations en termes de bioactivité, stabilité et la biodisponibilité du facteur "immobilisé", nous avons conçu une variante BMP capable de se lier par covalence échafaudages de façon dirigée. Cette variante, appelée BMP2-K3Plk, comprend un acide aminé artificiel qui a été présenté par codon génétique expansion11. Cette variante a été liée avec succès pour les échafaudages en utilisant une stratégie de couplage covalent tout en conservant son activité biologique.

<table border="0" cellpadding="0" cellspacing="0" style="width:1137px;" width="1138">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Material</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td style="width:403px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1-Step NBT/BCIP</td>
			<td style="width:203px;">Thermo Fisher</td>
			<td style="width:136px;">34042</td>
			<td style="width:403px;">Add solution to cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3-Azido-7-hydroxycoumarin</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCFA-047-1</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Agarose low melting point</td>
			<td style="width:203px;">Biozym</td>
			<td style="width:136px;">840101</td>
			<td>Agarose for ALP assay&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Azide agarose beads</td>
			<td style="width:203px;">Jena Bioscience</td>
			<td style="width:136px;">CLK-1038-2</td>
			<td style="width:403px;">Beads used for reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BamHI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>FD0054</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">BMP receptor IA (BMPR-IAEC)</td>
			<td>--</td>
			<td>--</td>
			<td>Produced in our lab</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Coomassie Brilliant Blue G-250 Dye</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:136px;">20279</td>
			<td>Chemical used for Coomassie Brilliant blue staining of SDS PAGE</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">Copper (II) sulfate anhydrous (CuSO4)</td>
			<td style="width:203px;">Alfa Aesar</td>
			<td style="width:136px;">A13986</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">DNA Polymerase and reaction buffer&#160;</td>
			<td>Kapabiosystems</td>
			<td>KK2102</td>
			<td>KAPA HiFi PCR Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM) GlutaMAX</td>
			<td style="width:203px;">Gibco</td>
			<td style="width:136px;">61965-026</td>
			<td style="width:403px;">Cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">ethylenediaminetetraacetic acid (EDTA)</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">E5134-1kg</td>
			<td style="width:403px;">Chemical used to stop click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Isopropyl &#223;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:203px;">Carl Roth GmbH</td>
			<td style="width:136px;">2316.5</td>
			<td>Bacteria induction (1mM final concentration)&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NdeI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0581</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">NHS-activated Texas Red</td>
			<td style="width:203px;">Life technologies</td>
			<td style="width:136px;">T6134</td>
			<td style="width:403px;">Coupled to receptor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">P- Nitrophenyl Phosphate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">N4645-1G</td>
			<td style="width:403px;">Alkaline Phosphatase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">p25N-hmBMP2&#160;</td>
			<td>--</td>
			<td>--</td>
			<td>Plasmid kindly provided from Walter Sebald to J. Nickel</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET11a-pyrtRNA</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">propargyl-L-lysine (Plk)</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSRFduet-pyrtRNAsynth</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen Gel Extraction Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td style="width:136px;">28704</td>
			<td>Gel Purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen PCR purification Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td>28104</td>
			<td style="width:403px;">PCR Purification&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Sodium L-ascorbate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">A7631-100G</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">T4 DNA Ligase</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">EL0011</td>
			<td>Ligation&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCMI-006-100</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td>X100-1L</td>
			<td style="width:403px;">Triton X 100&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Name</td>
			<td style="width:203px;">Company</td>
			<td style="width:136px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Equipment</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Amicon concentrating cell 400 ml&#160;</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFSC40001</td>
			<td style="width:403px;">Concentrating unit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amicon Ultra-15 Centrifugal Filter Units</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFC901024</td>
			<td style="width:403px;">Concentrating centrifugal unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">&#196;KTA avant FPLC</td>
			<td>&#196;KTA</td>
			<td>--</td>
			<td>FPLC machine</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Avanti J-26XP</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">393124</td>
			<td>Centrifuge for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Bacterial Shaking Incubator</td>
			<td style="width:203px;">Infors HT</td>
			<td style="width:136px;"></td>
			<td>Shaking incubator for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">FluorChem Q system</td>
			<td style="width:203px;">proteinsimple</td>
			<td style="width:136px;">--</td>
			<td>Imaging and analysis system for SDS-PAGE</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Fluorescent miscroscope</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;">BZ-9000 (BIOREVO)</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fractogel&#174; EMD SO3- (M)</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">116882</td>
			<td style="width:403px;">Ion Exchange Chromatography column material</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Greiner CELLSTAR&#174;&#160;96 well plates</td>
			<td style="width:203px;">Sigma</td>
			<td>M5811-40EA</td>
			<td>96 well plates for cell culture (ALP Assay)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Heraeus Multifuge X1R</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoScientific</td>
			<td style="width:136px;">75003624</td>
			<td>Rotor for Microcentrifuge for plate during ALP staining</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Microcentrifuge - 5417R</td>
			<td style="width:203px;">Eppendorf</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">OriginPro 9.1 G&#160;</td>
			<td style="width:203px;">OriginLab</td>
			<td style="width:136px;">--</td>
			<td>software for stastic analysis of ALP assay data</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polysine Slides</td>
			<td>ThermoScientific</td>
			<td>10143265</td>
			<td>microscope slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA-10</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JLA 8.1</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA 25.50</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tecan infinite M200 multiplate reader</td>
			<td style="width:203px;">Tecan Deutschland GmbH</td>
			<td style="width:136px;">--</td>
			<td>Multiplate reader for ALP assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Thermocycler - Labcycler Gradient</td>
			<td style="width:203px;">SensoQuest GmbH</td>
			<td style="width:136px;">--</td>
			<td>PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">TxRed - microscope filter</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;"></td>
			<td>Filter for fluorescent microscope&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 3 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLBC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 10 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLGC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
	</tbody>
</table>

site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry

Différentes stratégies thérapeutiques pour le traitement des défauts d’os longs non-guérison ont été intensivement étudiées. Actuellement utilisé traitements présentes plusieurs limites qui ont conduit à l’utilisation des biomatériaux en combinaison avec les facteurs de croissance ostéogéniques, tels que les protéines morphogénétiques osseuses (PGB). Méthodes couramment utilisées, absorption ou encapsulation requièrent des quantités supra-physiologique de BMP2, qui généralement donne un effet de sortie dite éclatement initial qui provoque plusieurs effets secondaires indésirables graves. Une stratégie possible de surmonter ces problèmes serait de façon covalente coupler la protéine à l’échafaud. En outre, couplage doit être effectuée d’une manière spécifique afin de garantir un résultat reproductible produit. Par conséquent, nous avons créé une variante de la BMP2, dans lequel un aminoacide artificiel (propargyle-L-lysine) a été introduit dans la partie mature de la protéine BMP2 par l’expansion de son utilisation de codon (BMP2-K3Plk). BMP2-K3Plk a été couplé à des perles fonctionnalisés par cycloaddition cuivre azoture-alcyne catalysée (CuAAC). L’activité biologique de la BMP2-K3Plk couplé a été prouvée in vitro et l’activité ostéogénique des perles BMP2-K3Plk-fonctionnalisés a été prouvée dans des essais sur des cellules de base. Les perles fonctionnalisés en contact avec les cellules C2C12 étaient capables d’induire l’expression de la phosphatase alcaline (ALP) localement limitée près du talon. Ainsi, fonctionnalisés échafaudages peuvent être produites par cette technique, qui peut déclencher la différenciation des cellules vers une lignée ostéogénique. En outre, des doses plus faibles de BMP2 sont suffisantes en raison de l’orientation contrôlée du BMP2 couplés dirigée. Avec cette méthode, les PGB est toujours exposés à leurs récepteurs sur la surface de la cellule dans l’orientation appropriée, ce qui n’est pas le cas si les facteurs sont couplés via des techniques de couplage non-dirigée. Le résultat produit est très contrôlable et, ainsi, résultats en matériaux dotés de propriétés homogènes, améliorer leur applicabilité pour la réparation de taille critique OS défauts.

Dans cet article, nous décrivons une méthode pour atteler par covalence une nouvelle variante de la BMP2, BMP2-K3Plk, à commercialement disponible azoture fonctionnalisé agarose perles (Figure 1). La bioactivité de la variante de BMP2-K3Plk produite a été validée par l’induction de l’expression génique dans les cellules C2C12 phosphatase alcaline (ALP). Le test in vitro montre des niveaux d’expression semblables ALP induites par le typ...

Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Biomatériaux dopé avec Bone Morphogenetic Protein 2 (BMP2) ont servi d’une nouvelle stratégie thérapeutique pour guérir des fractures osseuses non syndiqués. Pour surmonter les effets secondaires résultant d’une incontrôlable libération du facteur, nous proposons une nouvelle stratégie au site-immobiliser directement au facteur, créant ainsi des matériaux avec des capacités améliorées d’ostéogéniques.

Immobilisation dirigée de protéine morphogénétique osseuse 2 aux Surfaces solides par Click Chemistry

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present ...

Research

JoVE Journal

Bioengineering

Micropatterned Surfaces to Study Hyaluronic Acid Interactions with Cancer Cells

Surfaces Micropatterned pour étudier les interactions acide hyaluronique avec les cellules cancéreuses

Cancer invasion and progression involves a motile cell phenotype, which is under complex regulation by growth factors/cytokines and extracellular matrix ...

Recherche

Bio-ingénierie

Thermodynamics of Membrane Protein Folding Measured by Fluorescence Spectroscopy

Thermodynamique du repliement des protéines membranaires mesuré par fluorescence Spectroscopie

Membrane protein folding is an emerging topic with both fundamental and health-related significance.  The abundance of membrane proteins in cells ...

Bacterial Immobilization for Imaging by Atomic Force Microscopy

Immobilisation bactérienne pour l&#39;imagerie par microscopie à force atomique

AFM is a high-resolution (nm scale) imaging tool that mechanically probes a surface.  It has the ability to image cells and biomolecules, in a liquid ...

Fluorescence detection methods for microfluidic droplet platforms

Méthodes de détection par fluorescence pour les plateformes microfluidiques gouttelettes

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Monitoring Protein Adsorption with Solid-state Nanopores

Surveillance des protéines par adsorption à semi-conducteurs Nanopores

Solid-state nanopores have been used to perform measurements at the single-molecule level to examine the local structure and flexibility of nucleic acids ...

Hydrophobic Salt-modified Nafion for Enzyme Immobilization and Stabilization

Hydrophobe sel modifié Nafion pour l&#39;immobilisation d&#39;enzymes et de stabilisation

Over the last decade, there has been a wealth of application for immobilized and stabilized enzymes including biocatalysis, biosensors, and biofuel ...

Preparation of Thermoresponsive Nanostructured Surfaces for Tissue Engineering

Préparation de thermosensible surfaces nanostructurées pour l&#39;ingénierie tissulaire

Thermoresponsive poly(N-isopropylacrylamide) (PIPAAm)-immobilized surfaces for controlling cell adhesion and detachment were fabricated by the ...

Wet Chemistry and Peptide Immobilization on Polytetrafluoroethylene for Improved Cell-adhesion

Wet Chemistry and Peptide Immobilisation sur polytétrafluoroéthylène pour l&#39;amélioration de l&#39;adhérence cellulaire

Endowing materials surface with cell-adhesive properties is a common strategy in biomaterial research and tissue engineering. This is particularly ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

Ingénierie « Golden » Fluorescence par l’Incorporation de la pression sélective d’amino-acides Non canoniques et analyse des protéines par spectrométrie de masse et de Fluorescence

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Making Conjugation-induced Fluorescent PEGylated Virus-like Particles by Dibromomaleimide-disulfide Chemistry

Faire induite par la conjugaison Fluorescent pégylé Pseudo-particules virales de chimie Dibromomaleimide-disulfure

The recent rise in virus-like particles (VLPs) in biomedical and materials research can be attributed to their ease of biosynthesis, discrete size, ...