Name: site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry
Uploaded: 2018-03-29T13:00:00
Description: Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Forfatterne takker Dr. M. Rubini (Konstanz, Tyskland) for å gi plasmider koding pyrrolysyl-tRNA og for pRSFduet-pyrtRNAsynth koding tilsvarende aminoacyl-tRNA synthetase.

1. produksjon av BMP2 Variant BMP2-K3Plk
<ol><li>Kloning av BMP2-K3Plk av området-rettet mutagenese bruker PCR 12<ol>
<li>Forsterke human moden BMP2 (hmBMP2) fra en p25N-hmBMP2-vektor (se Tabell for materiale) med en frem primer (5' GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3) og en omvendt primer (5' CCAGGAGGATCCTTAGCGACACCCACAACCCT 3) introdusere en oransje stopp codon ( TAG) på plasseringen av den første lysin av BMP2´s kjønnsmodne del. Utføre PCR reaksjonen...

<ol>
	<li>Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+substitutes:+An+update.">Bone substitutes: An update.</a> Injury. 36, S20-S27 (2005).</li><li>Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+proteins:+A+powerful+osteoinductive+compound+with+non-negligible+side+effects+and+limitations.">Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations.</a> Biofactors. 40 (5), 459-481 (2014).</li><li>Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+delivery+of+growth+factors+for+bone+repair.">Localized delivery of growth factors for bone repair.</a> Eur J Pharm Biopharm. 58 (2), 197-208 (2004).</li><li>Haidar, Z. S., Hamdy, R. C., Tabrizian, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+recombinant+bone+morphogenetic+proteins+for+bone+regeneration+and+repair.+Part+A:+Current+challenges+in+BMP+delivery.">Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery.</a> Biotechnol Lett. 31 (12), 1817-1824 (2009).</li><li>Hollinger, J. O., Uludag, H., Winn, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+release+emphasizing+recombinant+human+bone+morphogenetic+protein-2.">Sustained release emphasizing recombinant human bone morphogenetic protein-2.</a> Adv Drug Deliv Rev. 31 (3), 303-318 (1998).</li><li>Uludag, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implantation+of+recombinant+human+bone+morphogenetic+proteins+with+biomaterial+carriers:+A+correlation+between+protein+pharmacokinetics+and+osteoinduction+in+the+rat+ectopic+model.">Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model.</a> J Biomed Mater Res. 50 (2), 227-238 (2000).</li><li>Uludag, H., Golden, J., Palmer, R., Wozney, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinated+bone+morphogenetic+protein-2:+In+vivo+and+in+vitro+activity.">Biotinated bone morphogenetic protein-2: In vivo and in vitro activity.</a> Biotechnol Bioeng. 65 (6), 668-672 (1999).</li><li>Aono, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+ectopic+bone-inducing+activity+of+bone+morphogenetic+protein-4/7+heterodimer.">Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer.</a> Biochem Biophys Res Commun. 210 (3), 670-677 (1995).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alginate+hydrogel+linked+with+synthetic+oligopeptide+derived+from+BMP-2+allows+ectopic+osteoinduction+in+vivo.">Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo.</a> J Biomed Mater Res. 50 (3), 405-409 (2000).</li><li>Knaus, P., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperativity+of+binding+epitopes+and+receptor+chains+in+the+BMP/TGFbeta+superfamily.">Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily.</a> Biol Chem. 382 (8), 1189-1195 (2001).</li><li>Wang, L., Xie, J., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+genetic+code.">Expanding the genetic code.</a> Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).</li><li>Costa, G. L., Weiner, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+PCR+site-directed+mutagenesis.">Rapid PCR site-directed mutagenesis.</a> CSH Protoc. 2006 (1), (2006).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+recombinant+BMP+receptor+IA+ectodomain+and+its+2:1+complex+with+BMP-2.">Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2.</a> FEBS Lett. 468 (2-3), 215-219 (2000).</li><li>Tabisz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+immobilization+of+BMP-2:+Two+approaches+for+the+production+of+innovative+osteoinductive+scaffolds.">Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds.</a> Biomacromolecules. 18 (3), 695-708 (2017).</li><li>Duong-Ly, K. C., Gabelli, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+ion+exchange+chromatography+to+purify+a+recombinantly+expressed+protein.">Using ion exchange chromatography to purify a recombinantly expressed protein.</a> Methods Enzymol. 541, 95-103 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-dimensional+SDS-polyacrylamide+gel+electrophoresis+(1D+SDS-PAGE).">One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE).</a> Methods Enzymol. 541, 151-159 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coomassie+blue+staining.">Coomassie blue staining.</a> Methods Enzymol. 541, 161-167 (2014).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMP-2+antagonists+emerge+from+alterations+in+the+low-affinity+binding+epitope+for+receptor+BMPR-II.">BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II.</a> EMBO J. 19 (13), 3314-3324 (2000).</li><li>Hein, J. E., Fokin, V. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copper-catalyzed+azide-alkyne+cycloaddition+(CuAAC)+and+beyond:+new+reactivity+of+copper(I)+acetylides.">Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides.</a> Chem Soc Rev. 39 (4), 1302-1315 (2010).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+kinetics+analysis+of+BMP2+uptake+into+cells+and+its+modulation+by+BMP+antagonists.">Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists.</a> J Cell Sci. 126 (Pt 1), 117-127 (2013).</li><li>Paarmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamin-dependent+endocytosis+of+Bone+Morphogenetic+Protein2+(BMP2)+and+its+receptors+is+dispensable+for+the+initiation+of+Smad+signaling.">Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling.</a> Int J Biochem Cell Biol. 76, 51-63 (2016).</li><li>Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+immobilization+of+bone+morphogenetic+protein+2+via+a+self-assembled+monolayer+formation+induces+cell+differentiation.">Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation.</a> Acta Biomater. 8 (2), 772-780 (2012).</li></ol>

Generere merket protein varianter av genetisk codon utvidelsen lar innføring av ulike ikke-naturlige aminosyre analogs hovedsakelig på enhver posisjon av primære protein sekvensen. Hvis BMP som BMP2, felles koder som en 6-histidin (hans) kode kan bare være introdusert N-Terminal, siden protein´s C-terminalen slutten er gravlagt i tertiær protein strukturen, og er derfor ikke tilgjengelig fra utsiden. På andre stillinger, kan størrelsen på introdusert koden svært sannsynlig forårsake strukturelle endringer som ...

Det endelige målet med bein vev engineering og bein gjenfødelse er å overvinne ulemper og begrensninger oppstår under vanlige behandlinger av ikke-unionen frakturer. Auto - eller allo-transplantasjoner brukes hovedsakelig som gjeldende terapi strategier, selv om de begge har flere ulemper. Ideell benet pode skal indusere osteogenesis av osteoinduction samt osteoconduction, fører til osteointegration av graftet i benet. I dag, er bare auto-transplantasjon regnet som "gullstandarden" siden det gir alle karakteristikkene av en ideell bein pode. Dessverre også presenterer viktige negative aspekter som lang kirurgi ganger, og en andre traumer nettsted som vanligvis innebærer mer komplikasjoner (f.eks, kroniske smerter, hematoma formasjoner, infeksjoner, kosmetiske feil, etc.). Allogenic grafts, har derimot suboptimal egenskaper for alle generelle aspektene1. Alternative bein pode teknologi forbedret de siste årene, med sikte på å produsere stillaser som er osteoinductive, osteoconductive, biokompatible, og bioresorbable. Siden mange biologisk materiale ikke viser alle disse osteogenic egenskaper, er ulike vekstfaktorer, hovedsakelig BMP2 og BMP7, innarbeidet for å forbedre osteogenic potensialet av bestemt stillaset2.
Som en viktig kriterium, bør slik vekstfaktor leveringssystemer gi en kontrollert dose utgivelse over tid for å lette viktige hendelser som celle rekruttering og vedlegg, cellen ingrowth og angiogenese. Imidlertid immobilisert BMPs samt andre osteogenic vekst faktorer er vanligvis ikke-covalently3. Entrapment og adsorpsjon teknikker krever bruk av supra fysiologiske mengder protein på grunn av en første burst utgivelse, som fører til alvorlige ulemper i vivo, vanligvis påvirker omkringliggende vev ved å fremkalle bein overvekst, osteolysis, hevelse og betennelse4. Oppbevaring av vekstfaktorer på leveringssted for lengre perioder kan dermed oppnås ved kovalente immobilisering metoder. Kjemisk endret BMP2 (succinylated5, acetylated6 eller biotinylated7), utviklet heterodimerer8eller BMP2 avledede oligopeptides9 er utviklet og brukt til å overvinne begrensningene knyttet til absorpsjon. Bio-aktiviteten til disse konstruerer er imidlertid ikke forutsigbar siden ordningen potensielt hemmer binding av ligand immobilisert på mobilnettet reseptorene. Som tidligere vist er det viktig at alle fire reseptor kjeder involvert i dannelsen av aktivert ligand-reseptor komplekser samhandle med immobilisert BMP2 vil fullt aktivere alle nedstrøms signalnettverk cascades10.
For å overvinne problemene med ikke-homogen produktet resultat med begrensninger i bioactivity, stabilitet og biotilgjengelighet av immobilisert faktor, utviklet vi en BMP variant kan covalently bindende stillaser i en område-rettet måte. Denne varianten, kalt BMP2-K3Plk, omfatter en kunstig aminosyre som ble introdusert av genetisk codon ekspansjon11. Denne varianten er koblet til stillaser bruker en kovalente kopling strategi samtidig opprettholde sin biologiske aktivitet.

<table border="0" cellpadding="0" cellspacing="0" style="width:1137px;" width="1138">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Material</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td style="width:403px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">1-Step NBT/BCIP</td>
			<td style="width:203px;">Thermo Fisher</td>
			<td style="width:136px;">34042</td>
			<td style="width:403px;">Add solution to cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">3-Azido-7-hydroxycoumarin</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCFA-047-1</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Agarose low melting point</td>
			<td style="width:203px;">Biozym</td>
			<td style="width:136px;">840101</td>
			<td>Agarose for ALP assay&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Azide agarose beads</td>
			<td style="width:203px;">Jena Bioscience</td>
			<td style="width:136px;">CLK-1038-2</td>
			<td style="width:403px;">Beads used for reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">BamHI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>FD0054</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">BMP receptor IA (BMPR-IAEC)</td>
			<td>--</td>
			<td>--</td>
			<td>Produced in our lab</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Coomassie Brilliant Blue G-250 Dye</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:136px;">20279</td>
			<td>Chemical used for Coomassie Brilliant blue staining of SDS PAGE</td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;width:396px;">Copper (II) sulfate anhydrous (CuSO4)</td>
			<td style="width:203px;">Alfa Aesar</td>
			<td style="width:136px;">A13986</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">DNA Polymerase and reaction buffer&#160;</td>
			<td>Kapabiosystems</td>
			<td>KK2102</td>
			<td>KAPA HiFi PCR Kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Dulbecco&#8217;s modified Eagle&#8217;s medium (DMEM) GlutaMAX</td>
			<td style="width:203px;">Gibco</td>
			<td style="width:136px;">61965-026</td>
			<td style="width:403px;">Cell culture media</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">ethylenediaminetetraacetic acid (EDTA)</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">E5134-1kg</td>
			<td style="width:403px;">Chemical used to stop click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Isopropyl &#223;-D-1-thiogalactopyranoside (IPTG)</td>
			<td style="width:203px;">Carl Roth GmbH</td>
			<td style="width:136px;">2316.5</td>
			<td>Bacteria induction (1mM final concentration)&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">NdeI (Fast Digest enzyme)</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0581</td>
			<td>Restriction enzyme</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">NHS-activated Texas Red</td>
			<td style="width:203px;">Life technologies</td>
			<td style="width:136px;">T6134</td>
			<td style="width:403px;">Coupled to receptor</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">P- Nitrophenyl Phosphate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">N4645-1G</td>
			<td style="width:403px;">Alkaline Phosphatase</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">p25N-hmBMP2&#160;</td>
			<td>--</td>
			<td>--</td>
			<td>Plasmid kindly provided from Walter Sebald to J. Nickel</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">pET11a-pyrtRNA</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">propargyl-L-lysine (Plk)</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">pSRFduet-pyrtRNAsynth</td>
			<td>--</td>
			<td>--</td>
			<td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen Gel Extraction Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td style="width:136px;">28704</td>
			<td>Gel Purification</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Qiagen PCR purification Kit</td>
			<td style="width:203px;">Qiagen</td>
			<td>28104</td>
			<td style="width:403px;">PCR Purification&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Sodium L-ascorbate</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td style="width:136px;">A7631-100G</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">T4 DNA Ligase</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">EL0011</td>
			<td>Ligation&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)</td>
			<td style="width:203px;">BaseClick</td>
			<td style="width:136px;">BCMI-006-100</td>
			<td style="width:403px;">Chemical used for click reaction</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol</td>
			<td style="width:203px;">Sigma Aldrich GmbH</td>
			<td>X100-1L</td>
			<td style="width:403px;">Triton X 100&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Name</td>
			<td style="width:203px;">Company</td>
			<td style="width:136px;">Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Equipment</td>
			<td style="width:203px;"></td>
			<td style="width:136px;"></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Amicon concentrating cell 400 ml&#160;</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFSC40001</td>
			<td style="width:403px;">Concentrating unit</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Amicon Ultra-15 Centrifugal Filter Units</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">UFC901024</td>
			<td style="width:403px;">Concentrating centrifugal unit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">&#196;KTA avant FPLC</td>
			<td>&#196;KTA</td>
			<td>--</td>
			<td>FPLC machine</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Avanti J-26XP</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">393124</td>
			<td>Centrifuge for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Bacterial Shaking Incubator</td>
			<td style="width:203px;">Infors HT</td>
			<td style="width:136px;"></td>
			<td>Shaking incubator for bacterial culture</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">FluorChem Q system</td>
			<td style="width:203px;">proteinsimple</td>
			<td style="width:136px;">--</td>
			<td>Imaging and analysis system for SDS-PAGE</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Fluorescent miscroscope</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;">BZ-9000 (BIOREVO)</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fractogel&#174; EMD SO3- (M)</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">116882</td>
			<td style="width:403px;">Ion Exchange Chromatography column material</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Greiner CELLSTAR&#174;&#160;96 well plates</td>
			<td style="width:203px;">Sigma</td>
			<td>M5811-40EA</td>
			<td>96 well plates for cell culture (ALP Assay)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Heraeus Multifuge X1R</td>
			<td style="width:203px;">ThermoScientific</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">M-20 Microplate Swinging Bucket Rotor</td>
			<td>ThermoScientific</td>
			<td style="width:136px;">75003624</td>
			<td>Rotor for Microcentrifuge for plate during ALP staining</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Microcentrifuge - 5417R</td>
			<td style="width:203px;">Eppendorf</td>
			<td style="width:136px;">--</td>
			<td>Centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">OriginPro 9.1 G&#160;</td>
			<td style="width:203px;">OriginLab</td>
			<td style="width:136px;">--</td>
			<td>software for stastic analysis of ALP assay data</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Polysine Slides</td>
			<td>ThermoScientific</td>
			<td>10143265</td>
			<td>microscope slides</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA-10</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JLA 8.1</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Rotor JA 25.50</td>
			<td style="width:203px;">Beckman Coulter&#160;</td>
			<td style="width:136px;">--</td>
			<td>rotor for Avanti J-26XP centrifuge</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tecan infinite M200 multiplate reader</td>
			<td style="width:203px;">Tecan Deutschland GmbH</td>
			<td style="width:136px;">--</td>
			<td>Multiplate reader for ALP assay</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">Thermocycler - Labcycler Gradient</td>
			<td style="width:203px;">SensoQuest GmbH</td>
			<td style="width:136px;">--</td>
			<td>PCR</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:396px;">TxRed - microscope filter</td>
			<td style="width:203px;">Keyence</td>
			<td style="width:136px;"></td>
			<td>Filter for fluorescent microscope&#160;</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 3 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLBC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:396px;">Ultrafiltration regenerated cellulose discs 10 kDa</td>
			<td style="width:203px;">Merck KGaA</td>
			<td style="width:136px;">PLGC04310</td>
			<td style="width:403px;">used with amicon concentrating cell 400ml</td>
		</tr>
	</tbody>
</table>

site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry

Forskjellige strategier for behandling av ikke-healing lange ben mangler har vært intenst undersøkt. For øyeblikket brukes behandlinger finnes flere begrensninger som har ført til bruk av biologisk materiale i kombinasjon med osteogenic vekst faktorer, som bein Morfogenetiske proteiner (BMP). Brukte absorpsjon eller innkapsling metodene krever supra fysiologiske mengder BMP2, vanligvis resulterer i en såkalt første burst utgivelse effekt som provoserer flere alvorlige uønskede bivirkninger. En mulig strategi for å overvinne disse problemene vil være å covalently par protein til stillaset. Videre skal kopling utføres på en områdespesifikk måte for å garantere en reproduserbar produktet utfall. Derfor opprettet vi en BMP2 variant, der en kunstige aminosyre (propargyl-L-lysine) ble introdusert i den eldre delen av BMP2 protein ved codon behandling ekspansjon (BMP2-K3Plk). BMP2-K3Plk ble koblet til functionalized perler gjennom kobber catalyzed azide-alkyne cycloaddition (CuAAC). Kombinert BMP2-K3Plk biologiske aktivitet ble påvist i vitro og osteogenic aktiviteten av BMP2-K3Plk-functionalized perler ble påvist i cellen basert analyser. Functionalized perler i kontakt med C2C12 celler klarte å indusere alkalisk fosfatase (ALP) uttrykket i lokalt begrenset nærhet perlen. Derfor, av denne teknikken, functionalized stillaser kan produseres som kan utløse celledifferensiering mot en osteogenic avstamning. I tillegg er lavere BMP2 doser nok på grunn av kontrollert orienteringen av området-rettet kombinert BMP2. Med denne metoden utsatt BMPs alltid for deres reseptorer på cellens overflate i riktig retning, hvilke ikke er saken hvis faktorene er koplet via nettstedet-Uadresserte kopling teknikker. Produktet Resultatet er svært kontrollerbare og dermed resulterer i materialer med homogen egenskaper, forbedre deres anvendelighet for reparasjon av kritisk størrelse bein mangler.

I denne artikkelen beskriver vi en metode for å covalently par en ny BMP2 variant, BMP2-K3Plk, til kommersielt tilgjengelig azide functionalized agarose perler (figur 1). Bioactivity for den produserte BMP2-K3Plk-varianten ble godkjent av induksjon av alkalisk fosfatase (ALP) genuttrykk i C2C12 celler. I vitro testen viser lignende ALP uttrykk nivåer av vill-type BMP2 (BMP2-WT) og BMP2-K3Plk (figur 2).
<p class="jo...

Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Biologisk materiale dopet med bein Morfogenetiske proteinet 2 (BMP2) har blitt brukt som en ny terapeutiske strategi for å helbrede ikke-unionen benbrudd. For å overvinne bivirkninger som følge av en ukontrollert utgivelse av faktor, foreslår vi en ny strategi området-direkte nakkens faktoren, dermed skape materialer med forbedret osteogenic evner.

Nettsted rettet immobilisering av bein Morfogenetiske proteinet 2 Solid overflater av Klikk kjemi

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present ...

Research

JoVE Journal

Bioengineering

Micropatterned Surfaces to Study Hyaluronic Acid Interactions with Cancer Cells

Cancer invasion and progression involves a motile cell phenotype, which is under complex regulation by growth factors/cytokines and extracellular matrix ...

Thermodynamics of Membrane Protein Folding Measured by Fluorescence Spectroscopy

Membrane protein folding is an emerging topic with both fundamental and health-related significance.  The abundance of membrane proteins in cells ...

Bacterial Immobilization for Imaging by Atomic Force Microscopy

AFM is a high-resolution (nm scale) imaging tool that mechanically probes a surface.  It has the ability to image cells and biomolecules, in a liquid ...

Fluorescence detection methods for microfluidic droplet platforms

Fluorescens deteksjon metoder for microfluidic dråpe plattformer

The development of microfluidic platforms for performing chemistry and biology has in large part been driven by a range of potential benefits that ...

Monitoring Protein Adsorption with Solid-state Nanopores

Overvåking Protein Adsorpsjon med Solid-state nanopores

Solid-state nanopores have been used to perform measurements at the single-molecule level to examine the local structure and flexibility of nucleic acids ...

Hydrophobic Salt-modified Nafion for Enzyme Immobilization and Stabilization

Over the last decade, there has been a wealth of application for immobilized and stabilized enzymes including biocatalysis, biosensors, and biofuel ...

Preparation of Thermoresponsive Nanostructured Surfaces for Tissue Engineering

Utarbeidelse av Thermoresponsive nanostrukturerte overflater for Tissue Engineering

Thermoresponsive poly(N-isopropylacrylamide) (PIPAAm)-immobilized surfaces for controlling cell adhesion and detachment were fabricated by the ...

Wet Chemistry and Peptide Immobilization on Polytetrafluoroethylene for Improved Cell-adhesion

Wet kjemi og Peptide Immobilisering på Polytetrafluoroethylene for Forbedret Cell-adhesjon

Endowing materials surface with cell-adhesive properties is a common strategy in biomaterial research and tissue engineering. This is particularly ...

Engineering 'Golden' Fluorescence by Selective Pressure Incorporation of Non-canonical Amino Acids and Protein Analysis by Mass Spectrometry and Fluorescence

'Golden' fluorescens av seleksjonspress innlemmelse av ikke-kanoniske aminosyrer og proteiner analyse av massespektrometri og fluorescens

Fluorescent proteins are fundamental tools for the life sciences, in particular for fluorescence microscopy of living cells. While wild-type and ...

Making Conjugation-induced Fluorescent PEGylated Virus-like Particles by Dibromomaleimide-disulfide Chemistry

Gjør Bøyning-indusert fluorescerende pegylert Virus-lignende partikler av Dibromomaleimide-disulfide kjemi

The recent rise in virus-like particles (VLPs) in biomedical and materials research can be attributed to their ease of biosynthesis, discrete size, ...