Name: on-site molecular detection of soil-borne phytopathogens using a portable real-time pcr system
Uploaded: 2018-02-23T13:30:00
Duration: 14 min 15 s
Description: Watch this Scientific Journal Video about On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System at JoVE.com

우리는 노스 다코타 주립 대학에서 박사 닐 C. Gudmestad에 게 감사 S. subterranea 플라스 미드 DNA를 제공 하기 위한 박사 Hanu 허니문에 워싱턴 주립 대학 (WSU) PMTV RNA, 제공에 대 한 제공 R. solani AG3 wsu 박사 브 Inglis. 원고에 WSU CAHNRS 통신 videography 의견 제공을 위한 특별 닥터 제레미 주 얼 WSU에 감사 합니다. 이 연구는 노스 웨스트 감자 연구 컨소시엄 및 워싱턴 주 무부-전문 작물 블록 부여 프로그램에 의해 지원 되었다 (no를 부여 합니다. K1764)입니다. PPNS 제 0741, 병 리과 식물, 농업 대학, 인간 및 자연 자원 과학, 농업 연구 센터, 해치 프로젝트 번호 WNP00833, 워싱턴 주립 대학, 풀 먼, 워싱턴, 미국.

1. 현장 분자 검출 휴대용 실시간 PCR 시스템을 사용 하 여 병원 균의
참고: 그림 1을 참조 하십시오.
<ol><li>마그네틱 비드 기반 DNA 추출 참고: 마그네틱 비드 기반 DNA 추출 키트 (예: Primerdesign에서)는 제조업체의 지침에 따라 사용 되었다. 모든 시 약은 실 온 (18-25 ° C)에 저장 되어야 합니다. 동결 건조 된 성분을 K (병 1 호) (병 No.1a를 사용 하 여), 일시 중단 되 면-20 ° c.에 저장<ol>
<li>토양 샘플의 20-50 mg는 microtube에 샘플 준비 솔루션의 500 µ L 믹스. 참고: 토양: 준비 솔루션의 비율이 중요 하다 다른 비율에서 그들을 혼합 다운스트림 실험 (예를들면, 오염 억제제에 의해 PCR의)의 오류가 발생할 수 있습니다.</li>
		<li>해결책은 흐린 때까지 작은 살 균 방 앗 공이 사용 하 여 튜브의 바닥에 흙을 갈아. 더는 microtube 떨고 하 여 솔루션에 토양 입자를 일시 중단 하 고 서, 그대로, 토양 입자는 완전히 정착 하도록 하자 (일반적으로 5 ~ 10 분) 사이.</li>
		<li>신선한 microtube로 상쾌한의 200 µ L를 전송 하 고 세포의 용 해 버퍼의 200 µ L을 추가 (병 2: Guanidine 염 산 염 솔루션)와 20 µ L의 성분을 K (병 1 호).</li>
		<li>튜브를 거꾸로 하 여 철저 하 게는 lysate 혼합 하 고 15 분 동안 주위 온도에 품 어. 참고: lysate에 있으면 microtube 뚜껑, 튜브를 누르거나 뚜껑에서 제거 가능한 경우는 원심 분리기를 사용 합니다.</li>
		<li>Lysed 샘플 바인딩 버퍼/자석 구슬 믹스 (병 3 호)의 500 µ L를 추가 합니다. 아래로 pipetting으로 잘 혼합 하 고 자기 튜브 랙에서 5 분 동안 주위 온도에 품 어. 참고: 혼합 되도록 구슬 aliquoted 균등 하 게 저장 병에서 사용 하기 전에 잘 구슬 솔루션을 확인 하십시오.</li>
		<li>자기 튜브 랙 microtube 장소입니다. 적어도 2 분 또는 때까지 자기 쪽 벽을 첨부는 microtube 모든 구슬에 기다립니다. 그런 다음 제거 하 고 모두는 상쾌한 pipetting으로 삭제. 참고: 자성된 구슬을 제거 하 고 발음은 상쾌한 하는 동안 방해 하지 마십시오. DNA는 지금 자성 구슬에 의해 점령 되었습니다.</li>
		<li>자기 튜브 랙에서 microtube 제거, 500 µ L 워시 버퍼-1의 추가 (병 제 4: 나트륨과 염화/에탄올 솔루션) 다시 구슬 구슬 균일 하 게 분산 될 때까지 반복 pipetting으로 중단. 이 세척 단계 샘플에서 단백질 및 소금 제거를 수행 합니다. 혼합물이 30 앉아 보자 s.</li>
		<li>1.1.6 단계를 반복 합니다.</li>
		<li>자기 튜브 랙에서 microtube 제거, 500 µ L 워시 버퍼 2의 추가 (5 호 병: 나트륨과 염화/에탄올 솔루션) 다시 구슬 구슬 균일 하 게 분산 될 때까지 반복 pipetting으로 중단. 혼합물이 30 앉아 보자 s.</li>
		<li>1.1.6 단계를 반복 합니다.</li>
		<li>microtube 자기 관 선반에서 제거 하 고 80% 에탄올 (6 번 병)의 500 µ L를 추가 합니다. 참고: 이 단계는 샘플에서 잔여 염 분의 제거를 위한 필요.<ol>
<li>다시 구슬을 균일 하 게 분산 될 때까지 반복 pipetting으로 구슬을 일시 중단 합니다. 가끔 반전에 의해 혼합과 10 분 동안이 스탠드를 하자.</li>
		</ol>
</li>
		<li>1.1.6 단계를 반복 합니다.</li>
		<li>공기 건조 microtube 뚜껑 열려 주위 온도에서 10 분의 마그네틱 비드 펠 렛. 참고: 구슬 어떤 보이는 잔여 에탄올에서 자유로워야 하지만 완전히 밖으로 건조.</li>
		<li>자기 튜브 랙에서는 microtube를 제거 하 고, 차입 버퍼 (7 번 병)의 50-200 µ L을 추가 하 고 다시 구슬을 구슬과 균일 하 게 분산 된 그것은 30 대에 서 게 될 때까지 반복 pipetting으로 일시 중단 s. 참고: 위의 단계에서 순화 된 DNA는 자성 구슬에서 차입 버퍼에 발표 했다.</li>
		<li>자기 튜브 랙 microtube 장소입니다. 적어도 2 분 또는 때까지 자기 쪽 벽을 첨부는 microtube 모든 구슬에 기다립니다.</li>
		<li>이제 다운스트림 단계에서 사용 하기 위해 0.5 mL microtube에 순화 된 DNA/RNA를 포함 하는 상쾌한 전송.</li>
	</ol></li>
	<li>휴대용 실시간 PCR 참고: 휴대용 thermocycler와 PCR 분석 실험 키트 제조업체의 지침에 따라 사용 ( 재료의 표참조).<ol>
<li>오픈 및 thermocycler 관련 소프트웨어를 실행, 대상 검출 테스트 를 선택 하 고 이름 및 세부 정보, 노트, 예제 및 테스트 데이터 입력 필드에 모든 설명 정보를 입력. 참고: 웰 스 # 1과 #2 부정적인 제어 및 긍정적인 제어 소프트웨어에 의해 각각 지정 됩니다.</li>
		<li>사용 하 여 PCR 시 약 사전 준비. 반전에 의해 잘 튜브 포함 동결 건조 된 마스터 믹스 및 믹스 마스터 믹스 다시 정지 버퍼의 500 µ L를 전송. 프라이 머/프로브 (표 2) 라는 갈색 microtube에 전체 마스터 믹스를 전송 합니다.<ol>
<li>모자 하 고 흔들어 섞어 microtube. 철저 한 섞는 모든 구성 요소는 완전히 중단 다시 확인 합니다. 이 혼합물을 사용 하기 전에 5 분 동안 앉아 보자. 참고: 사용 후-20 ° C에서 반응 혼합을 저장 합니다.</li>
		</ol>
</li>
		<li>0.2 mL PCR 관으로 이전 단계에서 준비 된 반응 혼합의 10 µ L를 전송 하 여 부정적인 제어를 준비 하 고 nuclease 무료 살 균 이온된 수의 10 µ L를 추가 합니다.</li>
		<li>0.2 mL PCR 튜브에 1.2.2 단계에서 준비 된 반응 혼합의 10 µ L를 전송 하 여 긍정적인 통제를 준비 하 고 긍정적인 컨트롤 템플릿의 10 µ L를 추가 합니다.</li>
		<li>각 샘플에 대 한 0.2 mL PCR 튜브에 이전 단계에서 준비 된 반응 혼합의 10 µ L를 전송 하 고 샘플 DNA 단계 1.1.16에서에서 준비의 10 µ L를 추가 합니다.</li>
		<li>2.1.1 단계에서 설명한 내용으로 thermocycler의 우물 그들의 각각 PCR 튜브에서 로드 합니다.</li>
		<li>일단 모든 필요한 정보는 입력 하 고 확인, 실행 시작 을 선택 하 고 이더넷 연결 악기 또는 USB 드라이브를 선택 하십시오. 참고: USB 드라이브 옵션을 선택 하는 경우 실행된 파일 thermocycler (예, F:\genesig)와 함께 사용 되는 드라이브에 저장 해야 합니다. 실행은 드라이브는 thermocycler에 삽입 한 후에 즉시 시작 됩니다.</li>
	</ol></li>
	<li>휴대용 실시간 PCR의 데이터 분석입니다.
	<ol>
<li>실행 완료 되 면, 실행된 파일 (.usb) thermocycler 관련 소프트웨어를 사용 하 여 USB 드라이브에서 열거나 직접 결과클릭 하 여 소프트웨어에서 실행된 결과 볼.</li>
		<li>결과 분석 하기 전에 데이터 손실을 방지 하려면 완료 된 실행을 저장 합니다.</li>
		<li>결과 탭에는 실행의 상태를 보려면 샘플에 의해 분류 됩니다. 참고: 이 탭에서 얻을 수 있는 데이터 결과의 상태 이며 샘플에서 발견 하는 번호를 복사.</li>
		<li>증폭 곡선을 보려면 자세히 탭을 클릭 하십시오. 대상이 성공적으로 감지 될 때 대상 내부 제어의 Cq (정량화 주기) 값이 표시 됩니다. 참고: 이러한 값 최종 보고서에서 계산 되 고 샘플 인지 대상에 대 한 긍정적인 반응 또는 DNA 샘플 문제가 결정 하는 데 사용 됩니다.</li>
	</ol></li>
</ol>2. 기타 프로토콜
<ol><li>
대체 실험실 기반의 DNA 추출 방법
	<ol>
<li>
CTAB 클로 페 놀 프롬-기반 방법
		<ol>
<li>CTAB-페 놀-클로 프롬 기반 방법, 앞에서 설명한 대로 일 방법18 및19 의 Dellaporta 메서드 다음을 수행 합니다.</li>
		</ol>
</li>
		<li>
DNA 미니 준비 방법 참고: 20 에드워즈 메서드 다음과 같이 수행 되었다.<ol>
<li>추가 토양, 5 1.4 m m 세라믹 구슬 및 에드워즈 버퍼 (200 mM Tris, pH 8.0, 200 m m NaCl, 25 mM EDTA, 0.5 %SDS)의 750 µ L의 500 mg microtube 및 혼합 잘.</li>
			<li>5 분 동안 65 ° C에서 microtube 품 어.</li>
			<li>60 대 한 비드 때리는 균질 화기와 샘플을 균질 s (또는 박격포 및 방 앗 공이 사용 하 여).</li>
			<li>샘플 5 분 14000 x g에서 원심</li>
			<li>500 µ L 상쾌한의 신선한 microtube 전송 하 고 500 µ L 냉장된 소 프로 파 놀의 혼합. 10 번 튜브를 거꾸로 하 여 혼합.</li>
			<li>DNA를 이용할 15 분 14000 x g에서 샘플 원심</li>
			<li>가만히 따르다는 상쾌한 고 나머지 에탄올은 증발 때까지 실 온에서 건조 DNA 펠 릿 공기.</li>
			<li>냉장된 70% 에탄올의 750 µ L로 DNA 펠 릿을 세척.</li>
			<li>공기 건조 한 펠 릿 테 버퍼 (10 mM Tris HCl, pH 8.0 및 1 mM EDTA)의 50-100 µ L에 다시 일시 중단 하기 전에.</li>
		</ol>
</li>
		<li>
다른 대체 방법
		<ol>
<li>실리 카-기초 DNA 추출 키트 #1 (MP 바이오 빠른 DNA 회전)를 사용 하 여 수행 하 고 제조업체의 지시에 따라 #2 (Zymo 생명체학 DNA Miniprep Kit) 키트.</li>
		</ol>
</li>
	</ol>
</li>
	<li>
기존의 연구소 기반 실시간 PCR입니다. 참고: 기존의 thermocycler mastermix와 프로브 기반 PCR, 다양 한 뇌관 및 oligonucleotide 조사 (표 2) 사용 되었다.<ol>
<li>비 투명 바닥된 PCR를 사용 하 여 튜브 또는 PCR 접시 20 µ L 반응 분석, 모든 DNA 샘플에 대 한 준비로 부정적인 제어 (nuclease-무료 이온된 수) 그리고 긍정적인 템플릿 컨트롤 자체 준비.</li>
		<li>각 PCR 튜브 또는 잘, 준비는 mastermix의 10 µ L, 이온 물 nuclease 무료 7 µ L, 2 µ M 프라이 머/프로브, 2 µ L (단계 1.1.16, 또는 2.1)에서 DNA 샘플 또는 컨트롤 템플릿, 샘플 당 1 µ L를 포함 하 여 혼합.</li>
		<li>PCR 튜브 또는 판 닫고 적절 한 PCR 프로그램을 선택 하 여 반응을 시작 합니다.</li>
	</ol>
</li>
	<li>
기존의 연구소 기반 실시간 PCR의 데이터 분석
	<ol>
<li>Thermocycler 관련 소프트웨어를 사용 하 여 기존의 thermocycler에서 결과 분석 하. 데이터 분석 시작, USB 드라이브는 thermocycler에서 실행된 파일을 전송 하 고 USB 드라이브를 삽입 한 내보내기를 선택 합니다.</li>
		<li>오픈 데이터 파일 (.pcrd)에서 내보낸 thermocycler 관련 소프트웨어에서 실행 됩니다.</li>
		<li>악기에 해당 하는 그것의 위치에 의해 샘플의 우물을 강조 표시 합니다. 증폭 곡선 및 표준 곡선 (있는 경우) 자동으로 생성 됩니다. 샘플 정보 입력 되지 않습니다, 플레이트 설치 또는 비슷한 함수를 데이터를 분석 하기 전에 데이터 입력을 시작을 클릭 합니다.</li>
		<li>보기 데이터 정량화 탭; 이 CSV, XML, 또는 HTML 파일 판독기 같은 제 3 자 소프트웨어와 데이터 분석에 대 한 내보낼 수 있습니다.</li>
		<li>결정된 임계값에 기반 하는 Cq 데이터를 얻을 하 고 긍정적이 고 부정적인 컨트롤과 비교 합니다. 참고: 분석 결과에 대상의 DNA 표준 사용, Cq 인하를 결정 하는 표준의 샘플 Cq 데이터 비교</li>
	</ol>
</li>
</ol>

<ol>
	<li>Malcolm, G. M., Kuldau, G. A., Gugino, B. K., Jim&#233;nez-Gasco, M. d. e. l. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hidden+Host+Plant+Associations+of+Soil-borne+Fungal+Pathogens:+An+Ecological+Perspective.">Hidden Host Plant Associations of Soil-borne Fungal Pathogens: An Ecological Perspective.</a> Phytopathology. 103 (6), 538-544 (2013).</li><li>Posthuma-Trumpie, G. A., Korf, J., van Amerongen, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lateral+flow+(immuno)assay:+its+strengths,+weaknesses,+opportunities+and+threats.+A+literature+survey.">Lateral flow (immuno)assay: its strengths, weaknesses, opportunities and threats. A literature survey.</a> Anal Bioanal Chem. 393 (2), 569-582 (2009).</li><li>Hill, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-Mediated+Isothermal+Amplification+Assay+for+Rapid+Detection+of+Common+Strains+of+Escherichia+coli.">Loop-Mediated Isothermal Amplification Assay for Rapid Detection of Common Strains of Escherichia coli.</a> J Clin Microbiol. 46 (8), 2800-2804 (2008).</li><li>Mumford, R. A., Walsh, K., Barker, I., Boonham, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Potato+mop+top+virus+and+Tobacco+rattle+virus+Using+a+Multiplex+Real-Time+Fluorescent+Reverse-Transcription+Polymerase+Chain+Reaction+Assay.">Detection of Potato mop top virus and Tobacco rattle virus Using a Multiplex Real-Time Fluorescent Reverse-Transcription Polymerase Chain Reaction Assay.</a> Phytopathology. 90 (5), 448-453 (2000).</li><li>Schena, L., Nigro, F., Ippolito, A., Gallitelli, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+quantitative+PCR:+a+new+technology+to+detect+and+study+phytopathogenic+and+antagonistic+fungi.">Real-time quantitative PCR: a new technology to detect and study phytopathogenic and antagonistic fungi.</a> European Journal of Plant Pathology. 110 (9), 893-908 (2004).</li><li>Brierley, J. L., Stewart, J. A., Lees, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantifying+potato+pathogen+DNA+in+soil.">Quantifying potato pathogen DNA in soil.</a> Applied Soil Ecology. 41 (2), 234-238 (2009).</li><li>Tomlinson, J. A., Boonham, N., Hughes, K. J. D., Griffin, R. L., Barker, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On-Site+DNA+Extraction+and+Real-Time+PCR+for+Detection+of+Phytophthora+ramorum+in+the+Field.">On-Site DNA Extraction and Real-Time PCR for Detection of Phytophthora ramorum in the Field.</a> Appl Environ Microbiol. 71 (11), 6702-6710 (2005).</li><li>Harrison, J. G., Searle, R. J., Williams, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Powdery+scab+disease+of+potato+-+a+review.">Powdery scab disease of potato - a review.</a> Plant Pathology. 46 (1), 1-25 (1997).</li><li>Johnson, D. A., Miliczky, E. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distribution+and+development+of+black+dot,+Verticillium+wilt,+and+powdery+scab+on+Russet+Burbank+potatoes+in+Washington+State.">Distribution and development of black dot, Verticillium wilt, and powdery scab on Russet Burbank potatoes in Washington State.</a> Plant Disease. 77 (1), 74-79 (1993).</li><li>Merz, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Powdery+Scab+of+Potato-Occurrence,+Life+Cycle+and+Epidemiology.">Powdery Scab of Potato-Occurrence, Life Cycle and Epidemiology.</a> Am J Pot Res. 85 (4), 241 (2008).</li><li>Jones, R. a. C., Harrison, B. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+behaviour+of+potato+mop-top+virus+in+soil,+and+evidence+for+its+transmission+by+Spongospora+subterranea+(Wallr).+Lagerh.">The behaviour of potato mop-top virus in soil, and evidence for its transmission by Spongospora subterranea (Wallr). Lagerh.</a> Annals of Applied Biology. 63 (1), 1-17 (1969).</li><li>Carnegie, S. F., Davey, T., Saddler, G. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+temperature+on+the+transmission+of+Potato+mop-top+virus+from+seed+tuber+and+by+its+vector,+Spongospora+subterranea.">Effect of temperature on the transmission of Potato mop-top virus from seed tuber and by its vector, Spongospora subterranea.</a> Plant Pathology. 59 (1), 22-30 (2010).</li><li>Woodhall, J. W., Adams, I. P., Peters, J. C., Harper, G., Boonham, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+quantitative+real-time+PCR+assay+for+Rhizoctonia+solani+AG3-PT+and+the+detection+of+AGs+of+Rhizoctonia+solani+associated+with+potato+in+soil+and+tuber+samples+in+Great+Britain.">A new quantitative real-time PCR assay for Rhizoctonia solani AG3-PT and the detection of AGs of Rhizoctonia solani associated with potato in soil and tuber samples in Great Britain.</a> Eur J Plant Pathol. 136 (2), 273-280 (2013).</li><li>Banville, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Yield+losses+and+damage+to+potato+plants+caused+by+Rhizoctonia+solani+Kuhn.">Yield losses and damage to potato plants caused by Rhizoctonia solani Kuhn.</a> American Potato Journal. 66 (12), 821-834 (1989).</li><li>Crosslin, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Potato+mop-top+virus+on+Potatoes+in+Washington+State.">First Report of Potato mop-top virus on Potatoes in Washington State.</a> Plant Disease. 95 (11), 1483-1483 (2011).</li><li>Whitworth, J. L., Crosslin, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+Potato+mop+top+virus+(Furovirus)+on+potato+in+southeast+Idaho.">Detection of Potato mop top virus (Furovirus) on potato in southeast Idaho.</a> Plant Disease. 97 (1), 149-149 (2012).</li><li>Kaur, N., Cating, R. A., Dung, J. K. S., Frost, K. E., Robinson, B. A., Hamm, P. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=First+Report+of+Potato+mop-top+virus+Infecting+Potato+in+Oregon.">First Report of Potato mop-top virus Infecting Potato in Oregon.</a> Plant Disease. 100 (11), 2337 (2016).</li><li>Doyle, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+plant+DNA+from+fresh+tissue.">Isolation of plant DNA from fresh tissue.</a> Focus. 12, 13-15 (1990).</li><li>Dellaporta, S. L., Wood, J., Hicks, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+plant+DNA+minipreparation:+Version+II.">A plant DNA minipreparation: Version II.</a> Plant Mol Biol Rep. 1 (4), 19-21 (1983).</li><li>Edwards, K., Johnstone, C., Thompson, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+and+rapid+method+for+the+preparation+of+plant+genomic+DNA+for+PCR+analysis.">A simple and rapid method for the preparation of plant genomic DNA for PCR analysis.</a> Nucleic Acids Research. 19 (6), 1349 (1991).</li><li>Bittara, F. G., Secor, G. A., Gudmestad, N. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chloropicrin+Soil+Fumigation+Reduces+Spongospora+subterranea+Soil+Inoculum+Levels+but+Does+Not+Control+Powdery+Scab+Disease+on+Roots+and+Tubers+of+Potato.">Chloropicrin Soil Fumigation Reduces Spongospora subterranea Soil Inoculum Levels but Does Not Control Powdery Scab Disease on Roots and Tubers of Potato.</a> Am J Potato Res. 94 (2), 129-147 (2017).</li><li>van de Graaf, P., Lees, A. K., Cullen, D. W., Duncan, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+and+Quantification+of+Spongospora+subterranea+in+Soil,+Water+and+Plant+Tissue+Samples+Using+Real-Time+PCR.">Detection and Quantification of Spongospora subterranea in Soil, Water and Plant Tissue Samples Using Real-Time PCR.</a> European Journal of Plant Pathology. 109 (6), 589-597 (2003).</li><li>Maldonado, H., Falloon, R. E., Butler, R. C., Conner, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spongospora+subterranea+root+infection+assessed+in+two+potato+cultivars+differing+in+susceptibility+to+tuber+powdery+scab.">Spongospora subterranea root infection assessed in two potato cultivars differing in susceptibility to tuber powdery scab.</a> Plant Pathology. 62 (5), 1089-1096 (2013).</li><li>Braid, M. D., Daniels, L. M., Kitts, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Removal+of+PCR+inhibitors+from+soil+DNA+by+chemical+flocculation.">Removal of PCR inhibitors from soil DNA by chemical flocculation.</a> Journal of Microbiological Methods. 52 (3), 389-393 (2003).</li><li>Lees, A. K., Cullen, D. W., Sullivan, L., Nicolson, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+conventional+and+quantitative+real-time+PCR+assays+for+the+detection+and+identification+of+Rhizoctonia+solani+AG-3+in+potato+and+soil.">Development of conventional and quantitative real-time PCR assays for the detection and identification of Rhizoctonia solani AG-3 in potato and soil.</a> Plant Pathology. 51 (3), 293-302 (2002).</li><li>Davey, T., Carnegie, S. F., Saddler, G. S., Mitchell, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+importance+of+the+infected+seed+tuber+and+soil+inoculum+in+transmitting+Potato+mop-top+virus+to+potato+plants.">The importance of the infected seed tuber and soil inoculum in transmitting Potato mop-top virus to potato plants.</a> Plant Pathol. 63 (1), 88-97 (2014).</li><li>Boonham, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+in+virus+diagnostics:+From+ELISA+to+next+generation+sequencing.">Methods in virus diagnostics: From ELISA to next generation sequencing.</a> Virus Research. 186, 20-31 (2014).</li><li>Mohan, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cross-reactivity+of+antiserum+raised+against+Phytophthora+fragariae+with+other+Phytophthora+species+and+its+evaluation+as+a+genus-detecting+antiserum.">Cross-reactivity of antiserum raised against Phytophthora fragariae with other Phytophthora species and its evaluation as a genus-detecting antiserum.</a> Plant Pathology. 38 (3), 352-363 (1989).</li><li>Ophel-Keller, K., McKay, A., Hartley, D., Curran Herdina, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+routine+DNA-based+testing+service+for+soil-borne+diseases+in+Australia.">Development of a routine DNA-based testing service for soil-borne diseases in Australia.</a> Austral Plant Pathol. 37 (3), 243-253 (2008).</li><li>Woodhall, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+new+large-scale+soil+DNA+extraction+procedure+and+real-time+PCR+assay+for+the+detection+of+Sclerotium+cepivorum+in+soil.">A new large-scale soil DNA extraction procedure and real-time PCR assay for the detection of Sclerotium cepivorum in soil.</a> Eur J Plant Pathol. 134 (3), 467-473 (2012).</li><li>Miles, T. D., Martin, F. N., Coffey, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Rapid+Isothermal+Amplification+Assays+for+Detection+of+Phytophthora+spp+in+Plant+Tissue.">Development of Rapid Isothermal Amplification Assays for Detection of Phytophthora spp in Plant Tissue.</a> Phytopathology. 105 (2), 265-278 (2014).</li><li>Notomi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loop-mediated+isothermal+amplification+of+DNA.">Loop-mediated isothermal amplification of DNA.</a> Nucleic Acids Res. 28 (12), e63-e63 (2000).</li><li>Narayanasamy, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Microbial Plant Pathogens: Detection and Management in Seeds and Propagules. , (2016).</li><li>Braun-Kiewnick, A., Altenbach, D., Oberh&#228;nsli, T., Bitterlin, W., Duffy, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+lateral-flow+immunoassay+for+phytosanitary+detection+of+Erwinia+amylovora+and+on-site+fire+blight+diagnosis.">A rapid lateral-flow immunoassay for phytosanitary detection of Erwinia amylovora and on-site fire blight diagnosis.</a> Journal of Microbiological Methods. 87 (1), 1-9 (2011).</li></ol>

저자 아무 경쟁 금융 관심사를 선언합니다.

표 1에서 같이, 병원 성 대리인의 분자 식별에 최근의 기술 진보는 효능, 정확도 및 속도 진단의 사전 징후 감염27의 검출에 기여한 증가 했다. 현장 진단에 관한 램프 및 측면 흐름 방법 자주 사용 됩니다 그들은 휴대용 및 저렴 한 비용에 즉각적인 결과 제공 하기 때문에. 그러나, 혈 청 학적인 방법의 경우 종의 탐지 달성 하기 힘들 수 있습니다. 때때로 일반적인 토양 주민 등을 대상 미생물의 misdetection을 발생합니다. 예를 들어 있을 수 있습니다 교차 반응성 Phytophthora 종의 혈 청 학적인 검사와 감자 병원 체28, 대상된 식물을 감지 하는 어려움은 때때로 나타내는 경우 Pythium 종 사이 병원 체입니다.
현재 연구에서 기존의 실험실 기반의 실시간 PCR 시스템의 기능을 비교 하 여 휴대용 실시간 PCR 시스템을 사용 하 여 감자 토양 품 어진 병원 체의 현장 분자 검출을 위한 최적화 된 프로토콜을 개발 했습니다. 감도 ~ 10 번 해당 연구소 기반 분석 결과 보다 낮은 우리는 현장 메서드는 구체적으로 토양 샘플에서 감자 병원 체를 검색 발견. 그것은 또한는 경우에 실험실 및 필드 테스트 사용 하지 않았다 생물학 관련 샘플 크기를 고려 가치가 있다입니다. 큰 샘플 크기는 앞에서 설명한29,30, 필드 토양을 정기적으로 심사에 사용 하기 위해 필요 어디 1 킬로그램 250 g 사이 샘플 크기, 하지만 이러한 방법은 숙련 된 연산자를 요구 하 고 정교한 처리 됩니다. DNA를 추출 하는 장비. 일반적으로, 대규모 토양 DNA 추출 1 ~ 4 헥타르6,,2930이상 수많은 하위의 단일 집계 토양 샘플 대표에서 가져옵니다. 그러나, 여기 개발 프로토콜은 빠르고, 쉬운--사용 사용자를 위한 분자 진단에 사전 경험 없이 고 실험실의 이상으로 사용 될 수 있다. 방법은 신속 하 고 상대적으로 저렴 한 대규모 토양 추출에 비해, 그것은 유사한 샘플링 지역에서 대규모 집계 샘플을 가져온 많은 소규모 샘플 화면을 사용할 수 수 있습니다. 이 작은 샘플 크기의 결함 들을 극복 하 고 필드에 병원 체의 공간적 분포에 대 한 추가 정보를 확인할 수 있습니다. 또한, 이동성 및 속도 방법의 그것은 또한 재배 자에 대 한 시범 활동에 사용 될 수 있다을 의미 교육 및 참여 목적.
또 다른 고려 사항은 많은 실시간 PCR 분석 실험은 식물 병원 균5의 광범위 한 이미 게시 된입니다. 이 시스템을 만들 수 있는 필드 테스트에 사용할 수 있도록 새로운 램프 뇌관 디자인을 필요 없이이 기존 분석의 사용. 램프 분석 실험의 빈번한 비판이 이다 그들은31를 디자인 하기가 어려울 수 있습니다. 휴대용 PCR, 따라서 상대적으로 쉬운 구현의 다양 한 현장 테스트에 대 한 쉽게 사용할 수 있는 병원 체 테스트를 수 있습니다.
전통적인 방법, 힘 드는, 부정확, 비용과 시간이 많이 소요 자주 될 수 있습니다. 우리 개발 현장 방법의 단순 재배 자 및 산업 근로자 스스로 병원 체 탐지를 수행 하 여 아마도 멀리 어떤 거리를 될 수 있는 진단 실험실에 보내는 것 보다 훨씬 더 빠른 결과 생성 수 있습니다. 신속 및 휴대용 PCR 방법의 감도 더 수 이차 감염 병원 체 인구 (장비 또는 인간)를 통해 실수로 확산의 증가 가능성을 방지 하는 재배 자 수 있습니다. 결론적으로, 현재 연구에서 개발 현장 메서드는 정확 하 고 상대적으로 민감한 분야에서 중요 한 토양을 매개로 병원 균의 검출을 수 있습니다. 우리의 희망은이 연구 개발 현장 메서드는 현재 진단 파이프라인 (그림 6)에 기여할 것입니다 뿐만 아니라 필드에 식 물병에 대 한 역학 질문에 신속 하 고 정확한 답변을 제공 하 여 또한 제공 하 여 생물학과 식물 병원 균의 역학의 이해를 증가 했다.

원인 병원 체의 정확 하 고 신속한 식별 식물 질병 관리에 관한 결정에 크게 영향을 미칩니다. 토양 품 어진 질병은 특히 토양 환경 질량, 및 복잡 한, 토양 품 어진 질병의 모든 측면을 이해 하는 도전 그것을 만드는 공장에 상대적으로 매우 크기 때문에 진단 하기가 어렵습니다. 또한, 토양 품 어진 질병 초기 단계 감염, 환경 스트레스, 의존 symptomless 수 있으며 일부는 긴 잠 기간을 지연된 진단1. 많은 토양을 매개로 병원 체 생존 구조, 전문화 된 포자 또는 토양에서 그들의 호스트의 부재에도 몇 년 동안 살아남을 수 있습니다 melanized 균 등을 개발 했습니다. 토양 품 어진 질병 관리에 대 한 활용된 방법을 포함: 알려진된 감염된 분야를 피하고, 병원 체-무료 인증된 종자 및 묘 목을 사용 하 여, 위생, 장비 유지 및 토양과 물 가능한 경우의 움직임을 제한. 분자 탐지 전략을 통해 병원 체 존재의 지식 또한 초기 단계 치료에 대 한 적시 결정을 알리는 유용한 역할을 하거나 사전 평가 분야의 공장 수 있습니다. 현장 테스트는 아마 어떤 거리 멀리 또한 수 관여 재배 자가 이러한 진단 경우 진단 실험실 샘플을 보내지 않고 빠른 결과 제공 하는 추가적인 이점을 그들의 존재에 ' 필드-측면 '을 수행을 제공 합니다.
분자 검출, 감도, 특이성, 견고성 (반복성 및 재현성), 및 효율에 따라 현장 진단에 대 한 (즉., 단순 하 고 비용 성능) 고려에 대 한 중요 한 요소가 됩니다. Immunostrip 및 PocketDiagnostic 같은 흐름 장치 (LFDs) lateral, 현장 병원 체 검출을 위한 인기 있는 방법으로 1 단계 분석 결과 그들의 단순. 그러나, LFDs 되지 않을 수 있습니다. 모든 상황에서 바로 진단 도구 때문에 그들은 감도 특이성, 부족 하 고 때때로 모호한 결과 제공 하는 경우 대상 병원 체 낮은 농도에서 비슷한 종 또는 속 cross-react 수 있습니다. 2. 등온 증폭 루프 중재 (램프)도 현장 병원 체 탐지에 대 한 적용 이며 특히 비싼 저가 시 약, 반응 조건, 일정 하 게 유지 하 고 간단한 색도계 시각적 분석 때문 이다. 그러나, LFDs와 램프는 일반적으로 사용 질적으로, 두 가지 방법을 더 비싼 장비3양적 사용할 수 있지만. 중 합 효소 연쇄 반응 (PCR)는 높은 특이성, 높은 감도, 및 탐지의 상기 방법에 비해 양적 기능을 제공합니다. 그러나, 기존의 연구소 기반 PCR 기술 필요 비싼 실험실 장비 및 숙련 된 인력, 방문 목적에 대 한 검색 방법으로이 기술을 채택에 중요 한 불리는 합니다.
이 프로토콜에서 휴대용 실시간 PCR 악기를 사용 하 여 현장 진단 방법 시연입니다. 실시간 PCR 기술 정량적 정확도, 감도, 및 다양성, 다른 방법을 통해 장점을 제공 하며, 다양 한 식물 병원 균4,5, 다양 한을 포함 하 여의 검출을 위한 널리 이용 되는 토양6감자 병원 체입니다. 빠른 성장, 경쟁력 있는 시장 최근 동향 때문에 PCR 기술에 필요한 장비는 더 콤팩트 하 고 덜 비싼7개발을 계속 하고있다. 다음 단계는 프로토콜 구성: 자석 구슬 기반 핵 산 추출, 휴대용 실시간 PCR (fluorogenic 프로브 기반 분석 결과), 그리고 양적 데이터 분석 할 수 있는 모든 원격으로 (그림 1) 랩톱 컴퓨터를 사용 하 여.
휴대용 PCR 프로토콜을 사용 하 여 여기에 개발, 토양 샘플 토양 품 어진 병원 체, Spongospora subterranea를 검색 분석 했다. Spongospora 가루 딱지8의 인과 대리인으로 서 중요 한 감자 병원 체로 선정 되었다. 최근 수십 년간,이 질병의 존재는 감자9,10재배 되 고 있는 많은 지역에 확산으로 간주 됩니다. 괴 경은 병 변 같은 여드름의 존재를 통해 가루 딱지 감자 재배 자 상당한 질적 수율 손실을 발생할 수 있습니다. 또한, S. subterranea 감자 청소 탑 바이러스 (PMTV), tubers (spraing 라고도 함)11,12내부 병 변 증상을 일으킬 수 있는 벡터 수 있습니다. 따라서, 그것은 미 subterranea 6을 설치 하기 전에 필드에 존재 하는 경우 아는 것이 중요입니다. 우리는 또한 Rhizoctonia solani 의 검출을 위한이 프로토콜의 유용성을 보여 문 합 그룹 3 (AG3) 및 PMTV. 여러 문 합 그룹 Rhizoctonia solani 의 감자에 질병을 일으킬, AG3 이지만 틀림 없이 가장 중요 한 전세계13, 줄기 해독 및 최대 30%의 시장성이 수율 손실의 결과로 검은 비 듬 발생14. PMTV는 일반적으로 spraing 이라고 tubers 내 괴 사 성 병 변 발생 합니다. 이 바이러스 퍼시픽 노스 웨스트15,,1617, 여러 주에서 처음으로 최근 보고 되었습니다 그리고이 중요 한 감자 성장 지구에 있는 재배 자에 증가 관심사의 이다. 이 중요 한 질병에 대 한 휴대용 PCR의 효율성을 결정, 뿐만 아니라 최적의 DNA 추출 방법론 및 토양 샘플 크기 또한이 연구에서 조사 되었다.
결과 휴대용 PCR 방법은 다양 하 고 다른 병원 균의 검출에 대 한 적용 가능한 것이 좋습니다. 우리가 개발 하는 현장 검출 방식 농업 (예를들면, 재배 자) 회전, 다양 한 선택 등 질병 관리에 관한 이전 결정을 전선 노동자를 허용할 수 있고 샘플에서 식물 병원 체를 계량 수 있습니다. 동안 필드 조사, 심기, 잠재적인 질병 발생을 방지 하기 전에.

<table border="0" cellpadding="0" cellspacing="0" width="1073">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">White shell PCR plate</td>
			<td style="width:183px;">Bio-Rad</td>
			<td style="width:195px;">HSP9601</td>
			<td style="width:247px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">CFX Manager</td>
			<td style="width:183px;">Bio-Rad</td>
			<td style="width:195px;">1845000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">SsoAdvanced Universal Probes Supermix&#160;</td>
			<td style="width:183px;">Bio-Rad</td>
			<td style="width:195px;">1725280</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">CFX96 Touch qPCR instrument</td>
			<td style="width:183px;">Bio-Rad&#160;</td>
			<td style="width:195px;">1855195</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Ethylalcohol, pure 200 proof</td>
			<td style="width:183px;">Decon Laboratories</td>
			<td style="width:195px;">04-355-222</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Masterclear cap strips &#38; real&#8209;time PCR tube strips</td>
			<td style="width:183px;">Eppendorf</td>
			<td>9510222109</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Ethylenediaminetetraacetic Acid (EDTA)</td>
			<td style="width:183px;">Fisher BioReagents</td>
			<td style="width:195px;">BP118-500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Phenol, Saturated&#160;</td>
			<td style="width:183px;">Fisher BioReagents</td>
			<td style="width:195px;">BP1750I-400</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Tris(hydroxymethyl)aminomethane (Tris)</td>
			<td style="width:183px;">Fisher BioReagents</td>
			<td style="width:195px;">BP152-5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">q16 real-time PCR machine</td>
			<td style="width:183px;">genesig</td>
			<td style="width:195px;">MBS486001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Ultrapure Sodium Dodecyl Sulfate (SDS)</td>
			<td style="width:183px;">Invitrogen</td>
			<td style="width:195px;">15525-017</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">2-Propanol (Isopropanol)</td>
			<td style="width:183px;">JT Baker</td>
			<td style="width:195px;">67-63-0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Chloroform</td>
			<td style="width:183px;">JT Baker</td>
			<td style="width:195px;">9180-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Hydrochloric Acid, 36.5-38.0% (HCl)</td>
			<td style="width:183px;">JT Baker</td>
			<td style="width:195px;">9535-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">iso-Amyl Alcohol</td>
			<td style="width:183px;">JT Baker</td>
			<td style="width:195px;">9038-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">FastDNA Spin kit&#160;</td>
			<td style="width:183px;">MP Biomedicals</td>
			<td style="width:195px;">6560-200</td>
			<td>Silica-based DNA extraction kit #1</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Luna Universal One-Step RT-qPCR Kit</td>
			<td style="width:183px;">New England Biolabs</td>
			<td style="width:195px;">E3005S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">0.1ml Low Profile Individual PCR Tubes</td>
			<td style="width:183px;">Phenix Research</td>
			<td style="width:195px;">MPC-100LP</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Easy DNA/RNA Extraction Kit&#160;</td>
			<td style="width:183px;">Primerdesign</td>
			<td style="width:195px;">genesigEASY-EK</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">genesig Easy 1.5 mL tubes</td>
			<td style="width:183px;">Primerdesign</td>
			<td style="width:195px;">genesigEASY-1.5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Magnetic tube rack</td>
			<td style="width:183px;">Primerdesign</td>
			<td style="width:195px;">genesigEASY-MR</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Spongospora subterranea f. sp. subterranea genesig Easy Kit</td>
			<td style="width:183px;">Primerdesign</td>
			<td style="width:195px;">Path-S.subterranea-EASY</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Hexadecyltrimethylammonium bromide (CTAB)</td>
			<td style="width:183px;">Sigma-Aldrich</td>
			<td style="width:195px;">H6269-100G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Pellet pestles</td>
			<td style="width:183px;">Thermo Fisher Scientific</td>
			<td style="width:195px;">12-141-364</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:451px;">Sodium chloride (NaCl)</td>
			<td style="width:183px;">Thermo Fisher Scientific</td>
			<td style="width:195px;">7647-14-5</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:451px;">DNA Miniprep kit&#160;</td>
			<td style="width:183px;">ZymoBIOMICS</td>
			<td style="width:195px;">D4300</td>
			<td>Silica-based DNA extraction kit #2</td>
		</tr>
	</tbody>
</table>

on-site molecular detection of soil-borne phytopathogens using a portable real-time pcr system

식 물병의 현장 진단 이전 구현의 질병 관리 전략을 질병의 영향을 줄일 수 있도록 시기 적절 한 결정에 대 한 재배 자에 대 한 유용한 도구 수 있습니다. 현재 많은 진단 실험실, 중 합 효소 연쇄 반응 (PCR)에 특히 실시간 PCR, 식물 병원 체 탐지에 대 한 가장 정확 하 고 민감한 방법으로 간주 됩니다. 그러나, 실험실 기반 PCRs 일반적으로 고가의 실험 장비와 숙련 된 인력을 필요합니다. 이 연구에서 감자의 토양을 매개로 병원 체는 현장 분자 검출에 대 한 가능성을 입증 하는 데 사용 됩니다. 이 자석 구슬 기반 핵 산 추출, 휴대용 실시간 PCR (fluorogenic 프로브 기반 분석 결과)의 구성 된 신속 하 고 간단한 프로토콜을 사용 하 여 달성 되었다. 휴대용 실시간 PCR 접근 한 실험실 기반 시스템, 감지에서 DNA의 100 복사본으로 몇와 호의적으로 비교 Spongospora subterranea. 휴대용 실시간 PCR 방법 여기 개발 연구소-기반 접근 및 병원 체 진단에 대 한 유용한 사이트 도구 대신 사용할 수 있습니다.

DNA 추출 방법의 비교
마그네틱 비드 기반 DNA 추출 방법의 호환성 실시간 PCR 병원 체와 감염 분야에서 토양 샘플에서 S. subterranea DNA의 양을 감지 하 여 평가 되었습니다. 마그네틱 비드 기반 메서드는 CTAB-페 놀-클로 프롬 기반 방법18, 빠른 DNA 미니 준비 방법19,20및 기타를 포함 하 여 다른 방법으로 비교 되었다 보충 그림 1에서 보듯이, 표준 실리 카 기반의 DNA 추출 키트입니다. 6 다른 방법을 사용 하 여 추출한 DNA 샘플 기존의 실험실 기반의 실시간 PCR를 받게 되었다. 결과 제안 자석 구슬 기반 메서드는 다른 방법으로, 비교 비록 실리 카 기반의 DNA 추출 키트 우리가 테스트 하는 방법 중에서 최고의 성능을 보여주었다. 모든 키트 포함 guanidinium 안산 또는 guanidinium 염: 모두 대부분 RNases 등 DNases 세포질 단백질의 변성, 강력한 chaotropic 대리인. 따라서, 방법을 사용 하는 DNA와 RNA 추출에 적합 합니다.
휴대용 실시간 PCR와 기존의 실험실 기반의 실시간 PCR 사이 비교
감도 기존의 실험실 기반의 PCR, DNA21 pGEM-T 벡터에 의해 실행 되었다 S. subterranea 는 유전자의 다른 금액을 사용 하 여 수행 하는 병원 체의 절대 정량화를 휴대용 PCR의 특이성을 비교 하 . 그것의 유전자의 10 희석의 시리즈 (10 100 사본6 ) SsTQ 프라이 머/프로브 세트22를 사용 하 여 분석 했다. 결과 시연 휴대용 PCR 방법 대상 병원 체 DNA 발견 (~ 100 복사본), 비록 감도 10 배 낮은 보다는 적어도 10의 사본 (그림 2) 감지 기존의 실험실 기반의 PCR 방법의.
추가 유효성 검사에 대 한 인위적으로 감염된 토양 테스트 되었습니다. S. subterranea sporosori 감자 뿌리에서 가루 딱지 뿌리 혹에서 얻은 했다. 토양은 토양의 105 sporosori/g 건조 중량의 최종 농도에 sporosori 정지로 득실 거리는. 마그네틱 비드 기반 방법을 사용 하 여, DNA는 감염된 토양 샘플에서 추출 된 고 10 직렬 희석 농도 10에 해당를 준비 했다5, 104, 103, 102, 10,1및 100 sporosori/g 건조 토양의 무게. DNA 샘플 SPO 뇌관/프로브 세트23을 사용 하 여 PCR를 위해 사용 되었다. 결과 휴대용 PCR 메서드는 기존의 연구소 기반 PCR 방법 비교 분석 기능 이지만, 다시, 감도 ~ (그림 3) 10의 요인에 의해 감소 되었다 보여주었다.
마지막으로, 우리는 자연스럽 게 S. subterranea으로 오염 된 필드에서 토양 샘플 테스트. 마그네틱 비드 기반 DNA 추출 (추출 버퍼 솔루션의 500 µ L 당 토양의 10, 20, 50, 100 mg)의 토양의 다른 양의에서 수행 되었다. 결과 DNA 추출에 대 한 시작 물자로 토양의 최적의 무게 50-100 mg (그림 4)는 제안 했다. 토양 금액 범위 밖에 있는 경우 다운스트림 PCR 단계에 오류가 발생합니다. 이 효과 시작 물자로 토양의 초과 하는 금액을 사용 오염 (예, 페 놀 화합물) PCR24방해할 수 있기 때문에 수 있습니다. 토양의 낮은 볼륨의 경우 추출 된 DNA의 양을 PCR (예를 들어, 10-20 밀리 그램 토양에서 추출한 DNA 다양 했다 총의 수익률)의 검출 한계 보다 낮은 수 있습니다. 감도 매우 휴대용 PCR와 기존의 PCR 방법 사이 비교 했다. 비슷한 결과 다른 추출 방법 (보충 그림 2)에 의해 DNA 샘플에서 가져온
휴대용 실시간 PCR를 사용 하 여 현장 탐지 시스템에 의해 다른 병원 균의 검출
다른 중요 한 토양 품 어진 감자 병원 체, R. solani AG3 및 PMTV를 검출 하기 위하여 휴대용 PCR 방법을 테스트 했습니다. 이 연구에서 우리는 순수한 문화에서 DNA와 R. solani AG3 검색 RsTq 프라이 머/RQP1 프로브 세트25 를 사용 하 여 실시간 PCR 수행. 우리는 또한 실시간 PCR를 사용 하 여 PMTV D 뇌관/프로브 세트26 spraing 증상 결 절 샘플에서 RNA와 PMTV 탐지에 대 한 사용을 수행. 그림 5에서 보듯이 휴대용 PCR 방법 두 병원 체를 성공적으로 감지. 결과 제안 하는 휴대용 PCR 방법은 다양 하 고 다른 병원 체 탐지에 적용 가능한 실시간 PCR를 위한 뇌관 시퀀스를 사용할 수 있는 경우, 휴대용 및 전통적인 악기 사이 비교 했다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56891/56891fig1.jpg"> 그림 1. 현장 병원 체 검출을 위한 휴대용 실시간 PCR 시스템의 절차. 프로토콜은 다음과 같은 순서로 단계 구성: 간단한 균질 (A), 자석 구슬 기반 핵 산 추출 (B), 휴대용 실시간 PCR (C), 및 양적 데이터 분석 (D) 랩톱 컴퓨터를 사용 하 여 의해 lysate 준비. 참고 사이트에 모든 단계를 완료할 수 있습니다.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56891/56891fig2v2.jpg"> 그림 2 . 휴대용 PCR와 기존의 실험실 기반의 PCR 감도의 비교. 병원 체 DNA의 정량화 S. subterranea 는 유전자의 다른 금액을 사용 하 여 수행 되었다 (10 100 사본6 ) SsTQ 프라이 머/프로브 설정. S. subterranea 플라스 미드 DNA의 로그 값과 기존의 thermocycler (A) 및 (B) 휴대용 thermocycler Cq의 상호 로그 값 사이의 선형 회귀. <a href="/files/ftp_upload/56891/56891fig2v2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56891/56891fig3v2.jpg"> 그림 3 . 인위적으로 감염된 토양에서 검출 성능을 비교 S. subterranea. 토양은 인위적으로 득실 거리 (10 100 sporosori/g5 건조 토양의 무게) S. subterranea sporosori 정지로. 마그네틱 비드 기반 방법을 사용 하 여, DNA는 감염된 토양 샘플에서 추출 했다. PCRs는 SPO 뇌관/프로브 세트와 토양 샘플을 사용 하 여 수행 했다. 토양의 그램 당 sporosori에 시작 수량의 로그 값과 기존의 thermocycler (A) 및 (B) 휴대용 thermocycler Cq의 상호 로그 값 사이의 선형 회귀. <a href="/files/ftp_upload/56891/56891fig3v2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56891/56891fig4v2.jpg"> 그림 4 . DNA 추출에 대 한 토양 샘플의 시작의 비교. 마그네틱 비드 기반 방법은 10, 20, 50, 및 100 mg의 토양 샘플에서 DNA 추출에 사용 되었다. 실시간 PCRs 휴대용 thermocycler를 사용 하 여 수행 했다. 표준 곡선 (x 축) 토양 견본에서 추출 총 DNA의 양과 Sss 뇌관/프로브 세트에 의해 증폭 PCR 제품 (y 축)의 금액 사이의 관계를 나타냅니다. <a href="/files/ftp_upload/56891/56891fig4v2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56891/56891fig5.jpg"> 그림 5 . 다른 감자 병원 균의 검출 R. solani 및 PMTV. 실시간 PCRs 휴대용 thermocycler 기존의 thermocycler를 사용 하 여 수행 했다. R. solani AG3 RsTq 뇌관 및 (A) PMTV PMTV D 뇌관/프로브 설정 (B) 사용 하 여 PMTV에 감염 된 괴 경 샘플에서 추출 된 총 RNA에서 검색 되었습니다 RQP1 프로브를 사용 하 여 순수 문화에서 추출한 총 DNA에서 발견 되었다. <a href="/files/ftp_upload/56891/56891fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/56891/56891fig6.jpg"> 그림 6 . Phytopathogens에 대 한 진단 파이프라인. 순서도 phytopathogen 진단에 대 한 일반적인 워크플로 보여 줍니다. Note 경우 현장 분자 검출 활용 간단 하 고 빠른 진단의 전체 프로세스를 만드는 전통적인 단계, 예를 들어, 시각적 식별, 생략할 수 있습니다. <a href="/files/ftp_upload/56891/56891fig6large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td></td>
			<td>휴대용 실시간 PCR</td>
			<td>실시간 PCR</td>
			<td>램프</td>
			<td>ELISA</td>
			<td>측면 흐름</td>
		</tr>
<tr>
<td>대상 반응 당 비용</td>
			<td>$0.60-$ 8.47</td>
			<td>$ 0.60</td>
			<td>$ 0.75</td>
			<td>$ 0.60</td>
			<td>$ 4.74</td>
		</tr>
<tr>
<td>감도</td>
			<td>100 복사본</td>
			<td>10 부</td>
			<td>10 부</td>
			<td>1-10 sporosori33 1-10 ng/mL (단백질)33
</td>
			<td>1-10 sporosori34 5 x 105CFU/mL35
</td>
		</tr>
<tr>
<td>시간 비용</td>
			<td>90 분</td>
			<td>80-240 분</td>
			<td>50-90 분32
</td>
			<td>3-24 시간</td>
			<td>10-15 분</td>
		</tr>
<tr>
<td>준비 필요</td>
			<td>●Nucleic 산 성 추출 ● 뇌관 디자인</td>
			<td>●Nucleic 산 성 추출 ● 뇌관/프로브 설계</td>
			<td>● Nucelic 산 추출 ● 뇌관 디자인</td>
			<td>● 단백질 추출 ● 항 체</td>
			<td>N/A</td>
		</tr>
<tr>
<td>다른 재료 필요</td>
			<td>● 휴대용 thermocycler</td>
			<td>● 기존의 thermocycler</td>
			<td>● Colormetric 얼룩 ● 보육</td>
			<td>● 플레이트 리더 ● 세척 장비</td>
			<td>N/A</td>
		</tr>
</tbody></table>표 1입니다. Phytopathogens에 대 한 분자 및 serological 검출 방법의 비교 차트
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>뇌관</td>
			<td colspan="2">(5 '-3 ')는는 순서
</td>
			<td>대상b
</td>
		</tr>
<tr>
<td>SsTQ-F13
</td>
			<td colspan="2">CCGGCAGACCCAAAACC</td>
			<td>S. subterranea 에 ITS1 ITS2
</td>
		</tr>
<tr>
<td>SsTQ-R13
</td>
			<td colspan="2">CGGGCGTCACCCTTCA</td>
			<td>S. subterranea 에 ITS1 ITS2
</td>
		</tr>
<tr>
<td>SsTQ-P13
</td>
			<td colspan="2">[팸] CAGACAATCGCACCCAGGTTCTCATG [탐]</td>
			<td>S. subterranea 에 ITS1 ITS2
</td>
		</tr>
<tr>
<td>Genesig S.subterranea 뇌관/프로브</td>
			<td colspan="2">N/A</td>
			<td>S. subterranea 에 걸
</td>
		</tr>
<tr>
<td>SPO1014
</td>
			<td colspan="2">GGTCGGTCCATGGCTTGA</td>
			<td>S. subterranea 에 ITS
</td>
		</tr>
<tr>
<td>SPO1114
</td>
			<td colspan="2">GGCACGCCAATGGTTAGAGA</td>
			<td>S. subterranea 에 ITS
</td>
		</tr>
<tr>
<td>SPOPRO114
</td>
			<td colspan="2">[팸] CCGGTGCGCGTCTCTGGCTT [탐]</td>
			<td>S. subterranea 에 ITS
</td>
		</tr>
<tr>
<td>RsTqF119
</td>
			<td colspan="2">AAGAGTTTGGTTGTAGCTGGTCTATTT</td>
			<td>R. solani 에 ITS1 ITS2
</td>
		</tr>
<tr>
<td>RsTqR119
</td>
			<td colspan="2">AATTCCCCAACTGTCTCACAAGTT</td>
			<td>R. solani 에 ITS1 ITS2
</td>
		</tr>
<tr>
<td>RQP119
</td>
			<td colspan="2">[팸] TTTAGGCATGTGCACACCTCCCTCTTTC [탐]</td>
			<td>R. solani 에 ITS1 ITS2
</td>
		</tr>
<tr>
<td>Genesig PMTV 뇌관/프로브</td>
			<td colspan="2">N/A</td>
			<td>CP-RT PMTV에</td>
		</tr>
<tr>
<td>PMTV-D-F20
</td>
			<td colspan="2">AGAATTGRCATCGAAACAGCA</td>
			<td>PMTV에 CP</td>
		</tr>
<tr>
<td>PMTV-D-R20
</td>
			<td colspan="2">GTCGCGCTCCAATTTCGTT</td>
			<td>PMTV에 CP</td>
		</tr>
<tr>
<td>PMTV-D-P20
</td>
			<td colspan="2">[팸] CCACAAACAGACAGGTATGGTCCGGAA [탐]</td>
			<td>PMTV에 CP</td>
		</tr>
<tr>
<td colspan="4">
는 올리고 DNA 뇌관 식구 들 (6-carboxyfluorescein) 또는 탐 (5-carboxytetramethylrhodamine) 수정</td>
		</tr>
<tr>
<td colspan="4">
b ITS: 내부 베낀된 스페이서, CP: 코트 단백질; CP-RT: 외 투 단백질 쓰루가</td>
		</tr>
</tbody></table>표 2입니다. 이 연구에 사용 된 뇌관
보충 그림 1입니다. 가루 딱지 병원 체의 검출에 대 한 DNA 추출 방법의 비교. 6 다른 DNA 추출 방법 (A-F) 가루 딱지 병원 체, S. subterranea 토양 샘플에서의 검출에 대 한 비교 했다. (B, D, F)입니다. DNA는 실리 카 기반 키트 # 1을 사용 하 여 추출 했다 (모든 키트에 자료의 표 참조), 실리 카 기반 키트 #2, 그리고 자석 구슬 기반 키트, repsectively. PCR는 기존의 연구소 기반 PCR thermocycler를 사용 하 여 수행 되었다. 표준 곡선 SsTQ 프라이 머/프로브 세트에 의해 증폭 PCR 제품의 금액 및 토양 샘플에서 추출 하는 전체 DNA의 양 사이의 관계를 나타냅니다. <a href="/files/ftp_upload/56891/Supplementary_Figure_1.pdf" target="_blank">이 그림을 다운로드 하려면 여기를 클릭 하십시오.</a>
보충 그림 2입니다. 휴대용 PCR와 기존의 실험실 기반의 PCR 사이 탐지의 한계의 비교. 총 DNA는 3 개의 다른 추출 방법을 사용 하 여 토양 샘플에서 격리: (A, B)도 일 방법 (C, D) 실리 카 기반 키트 #2, 및 (E, F) 자석 구슬 기반 키트. 왼쪽에 데이터를 사용 하는 휴대용 thermocycler Sss 프라이 머/프로브 세트 오른쪽 그래프 나타냅니다 기존의 실험실 기반의 thermocycler SsTQ 프라이 머/프로브와 함께 사용 하 여 생성 된 데이터를 표시 하는 그래프 설정 합니다. <a href="/files/ftp_upload/56891/Supplementary_Figure_2.pdf" target="_blank">이 그림을 다운로드 하려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System at JoVE.com

On-Site Molecular Detection of Soil-Borne Phytopathogens Using a Portable Real-Time PCR System

식물 병원 체 현장, 특히 토양을 매개로 병원 균의 신속 하 고 정확한 검색은 추가 inoculum 생산 및 공장 분야에서 질병의 확산을 방지 하기 위해 중요 합니다. 여기 휴대용 실시간 PCR 탐지 시스템을 사용 하 여 개발 메서드 필드 조건에서 현장 진단이 있습니다.

휴대용 실시간 PCR 시스템을 사용 하 여 토양 품 어진 Phytopathogens의 현장 분자 검출

On-site diagnosis of plant diseases can be a useful tool for growers for timely decisions enabling the earlier implementation of disease management ...

Research

JoVE Journal

Environment

Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR

실시간 PCR에 의한 연안 퇴적물 및 정량 16S의 rRNA의 유전자 및 성적 증명서에서 동시 DNA-RNA 추출

Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of ...

연구

환경과학

Measuring and Mapping Patterns of Soil Erosion and Deposition Related to Soil Carbonate Concentrations Under Agricultural Management

측정 및 토양 침식과 토양 탄산 농도 농업 관리에 관련 된 증 착 패턴 매핑

Spatial patterns of soil erosion and deposition can be inferred from differences in ground elevation mapped at appropriate time increments. Such changes ...

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter spp. Using Conventional PCR on Citrus Leaf Tissue Samples

Specific and Accurate Detection of the Citrus Greening Pathogen Candidatus liberibacter  spp. Using Conventional PCR on Citrus Leaf Tissue Samples

특정 및 감귤 류 녹화 병원 체 Candidatus liberibacter 종 감귤 잎 조직 샘플에서 사용 하 여 기존의 PCR의 정확한 검출

Citrus greening, also known as huanglongbing, is a destructive citrus disease ravaging citrus farms globally. This disease causes asymmetrical yellow leaf ...

Self-standing Electrochemical Set-up to Enrich Anode-respiring Bacteria On-site

현장 양극 다 박테리아를 풍부 하 게 각자 서 있는 전기 설정

Anaerobic respiration coupled with electron transport to insoluble minerals (referred to as extracellular electron transport [EET]) is thought to be ...

Measuring Stolons and Rhizomes of Turfgrasses Using a Digital Image Analysis System

디지털 이미지 분석 시스템을 사용 하 여 Turfgrasses의 Rhizomes Stolons을 측정

Length and diameter of stolons or rhizomes are usually measured using simple rulers and calipers. This procedure is slow and laborious, so it is often ...

Detection of Viruses from Bioaerosols Using Anion Exchange Resin

Bioaerosols 음이온 교환 수 지를 사용 하 여 바이러스의 검출

This protocol demonstrates a customized bioaerosol sampling method for viruses. In this system, anion exchange resin is coupled with liquid ...

A Precise and Autonomous System for the Detection of Insect Emergence Patterns

곤충 출현 패턴의 검출을 위한 정확 하 고 자치 시스템

Existing systems to measure insect emergence patterns have limitations; they are only partially automated and are limited in the maximum number of ...

Detection of 3-Nitrotyrosine in Atmospheric Environments via a High-performance Liquid Chromatography-electrochemical Detector System

Detection of 3-Nitrotyrosine in Atmospheric Environments via a High-performance Liquid Chromatography-electrochemical Detector System

3-Nitrotyrosine 대기 환경을 통해 고성능 액체 착 색 인쇄기-전기 화학 검출기 시스템에서의 탐지

3-nitrotyrosine (3-NT) is generated from the tyrosine residue in atmospheric bio-aerosol proteins via a reaction with ozone (O3) and nitrogen dioxide ...

Detection of Tilapia Lake Virus Using Conventional RT-PCR and SYBR Green RT-qPCR

Tilapia 호수 바이러스를 사용 하 여 기존의 RT-PCR 및 SYBR의 탐지 RT 정량 그린

The aim of this method is to facilitate the fast, sensitive and specific detection of Tilapia Lake Virus (TiLV) in tilapia tissues. This protocol can be ...

A New Portable In Vitro Exposure Cassette for Aerosol Sampling

A New Portable In Vitro Exposure Cassette for Aerosol Sampling

새로운 휴대용 체 외에 노출 카세트 졸 샘플링에 대 한

This protocol introduces a new in vitro exposure system, capable of being worn, including its characterization and performance. Air-liquid interface (ALI) ...