Name: interactome-seq: a protocol for domainome library construction, validation and selection by phage display and next generation sequencing
Uploaded: 2018-10-03T13:00:00
Description: Watch this Scientific Journal Video about Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing at JoVE.com

इस काम के लिए शिक्षा और विश्वविद्यालय के इतालवी मंत्रालय (2010P3S8BR_002 से सीपी) अनुदान द्वारा समर्थित किया गया था ।

1. ओआरएफ पुस्तकालय का निर्माण (चित्रा 1)
<ol><li>डीएनए डालने की तैयारी
	<ol>
<li>
सिंथेटिक या जीनोमिक डीएनए से तैयारी टुकड़े
		<ol>
<li>निकालें/शुद्ध डीएनए मानक तरीकों का उपयोग कर26.</li>
			<li>son...

<ol>
	<li>Loman, N. J., Pallen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty+years+of+bacterial+genome+sequencing.">Twenty years of bacterial genome sequencing.</a> Nat Rev Microbiol. 13 (12), 787-794 (2015).</li><li>Jones, C. E., Brown, A. L., Baumann, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Estimating+the+annotation+error+rate+of+curated+GO+database+sequence+annotations.">Estimating the annotation error rate of curated GO database sequence annotations.</a> BMC Bioinformatics. 8 (1), 170 (2007).</li><li>Andorf, C., Dobbs, D., Honavar, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+inconsistencies+in+genome-wide+protein+function+annotations:+a+machine+learning+approach.">Exploring inconsistencies in genome-wide protein function annotations: a machine learning approach.</a> BMC Bioinformatics. 8 (1), 284 (2007).</li><li>Wong, W. -. C., Maurer-Stroh, S., Eisenhaber, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+Than+1,001+Problems+with+Protein+Domain+Databases:+Transmembrane+Regions,+Signal+Peptides+and+the+Issue+of+Sequence+Homology.">More Than 1,001 Problems with Protein Domain Databases: Transmembrane Regions, Signal Peptides and the Issue of Sequence Homology.</a> PLoS Comput Biol. 6 (7), e1000867 (2010).</li><li>Bioinformatics, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+correction+of+abnormal,+incomplete+and+mispredicted+proteins+in+public+databases.">Identification and correction of abnormal, incomplete and mispredicted proteins in public databases.</a> BMC Bioinformatics. 9 (9), (2008).</li><li>Phizicky, E., Bastiaens, P. I. H., Zhu, H., Snyder, M., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+analysis+on+a+proteomic+scale.">Protein analysis on a proteomic scale.</a> Nature. 422 (6928), 208-215 (2003).</li><li>DiDonato, M., Deacon, A. M., Klock, H. E., McMullan, D., Lesley, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+scaleable+and+integrated+crystallization+pipeline+applied+to+mining+the+Thermotoga+maritima+proteome.">A scaleable and integrated crystallization pipeline applied to mining the Thermotoga maritima proteome.</a> J Struct Funct Genomics. 5 (1-2), 133-146 (2004).</li><li>Nordlund, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nat Methods. 5 (2), 135-146 (2008).</li><li>Zacchi, P., Sblattero, D., Florian, F., Marzari, R., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+open+reading+frames+from+DNA.">Selecting open reading frames from DNA.</a> Genome Res. 13 (5), 980-990 (2003).</li><li>Di Niro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+interactome+profiling+by+massive+sequencing.">Rapid interactome profiling by massive sequencing.</a> Nucleic Acids Res. 38 (9), e110 (2010).</li><li>Gourlay, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+soluble/foldable+protein+domains+through+single-gene+or+genomic+ORF+filtering:+Structure+of+the+head+domain+of+Burkholderia+pseudomallei+antigen+BPSL2063.">Selecting soluble/foldable protein domains through single-gene or genomic ORF filtering: Structure of the head domain of Burkholderia pseudomallei antigen BPSL2063.</a> Acta Crystallogr Sect D Biol Crystallogr. 71 (Pt 11), 2227-2235 (2015).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filtering+&amp;#34;genic&amp;#34;+open+reading+frames+from+genomic+DNA+samples+for+advanced+annotation.">Filtering &amp;#34;genic&amp;#34; open reading frames from genomic DNA samples for advanced annotation.</a> BMC Genomics. 12 (Suppl 1), S5 (2011).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+celiac+disease+antibody+repertoire.">Profiling celiac disease antibody repertoire.</a> Clin Immunol. 148 (1), 99-109 (2013).</li><li>Robinson, M. D., McCarthy, D. J., Smyth, G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=edgeR:+A+Bioconductor+package+for+differential+expression+analysis+of+digital+gene+expression+data.">edgeR: A Bioconductor package for differential expression analysis of digital gene expression data.</a> Bioinformatics. 26 (1), 139-140 (2009).</li><li>Heger, A., Holm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+enumeration+of+protein+domain+families.">Exhaustive enumeration of protein domain families.</a> J Mol Biol. 328 (3), 749-767 (2003).</li><li>Zacchi, P., Sblattero, D., Florian, F., Marzari, R., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+open+reading+frames+from+DNA.">Selecting open reading frames from DNA.</a> Genome Res. 13 (5), 980-990 (2003).</li><li>Faix, P. H., Burg, M. A., Gonzales, M., Ravey, E. P., Baird, A., Larocca, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phage+display+of+cDNA+libraries:+Enrichment+of+cDNA+expression+using+open+reading+frame+selection.">Phage display of cDNA libraries: Enrichment of cDNA expression using open reading frame selection.</a> Biotechniques. 36 (6), 1018-1029 (2004).</li><li>Patrucco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+novel+proteins+binding+the+AU-rich+element+of+&#945;-prothymosin+mRNA+through+the+selection+of+open+reading+frames+(RIDome).">Identification of novel proteins binding the AU-rich element of &#945;-prothymosin mRNA through the selection of open reading frames (RIDome).</a> RNA Biol. 12 (12), 1289-1300 (2015).</li><li>Collins, M. O., Choudhary, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+multiprotein+complexes+by+affinity+purification+and+mass+spectrometry.">Mapping multiprotein complexes by affinity purification and mass spectrometry.</a> Curr Opin Biotechnol. 19 (4), 324-330 (2008).</li><li>Suter, B., Kittanakom, S., Stagljar, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-hybrid+technologies+in+proteomics+research.">Two-hybrid technologies in proteomics research.</a> Curr Opin Biotechnol. 19 (4), 316-323 (2008).</li><li>Nakai, Y., Nomura, Y., Sato, T., Shiratsuchi, A., Nakanishi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+Drosophila+gene+coding+for+a+protein+containing+a+novel+phosphatidylserine-binding+motif.">Isolation of a Drosophila gene coding for a protein containing a novel phosphatidylserine-binding motif.</a> J Biochem. 137 (5), 593-599 (2005).</li><li>Deng, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+antibody+single-chain+variable+fragments+with+improved+carbohydrate+binding+by+phage+display.">Selection of antibody single-chain variable fragments with improved carbohydrate binding by phage display.</a> J Biol Chem. 269 (13), 9533-9538 (1994).</li><li>Danner, S., Belasco, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T7+phage+display:+A+novel+genetic+selection+system+for+cloning+RNA-binding+proteins+from+cDNA+libraries.">T7 phage display: A novel genetic selection system for cloning RNA-binding proteins from cDNA libraries.</a> Proc Natl Acad Sci. 98 (23), 12954-12959 (2001).</li><li>Gargir, A., Ofek, I., Meron-Sudai, S., Tanamy, M. G., Kabouridis, P. S., Nissim, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+chain+antibodies+specific+for+fatty+acids+derived+from+a+semi-synthetic+phage+display+library.">Single chain antibodies specific for fatty acids derived from a semi-synthetic phage display library.</a> Biochim Biophys Acta - Gen Subj. 1569 (1-3), 167-173 (2002).</li><li>Patrucco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+novel+proteins+binding+the+AU-rich+element+of+&#945;-prothymosin+mRNA+through+the+selection+of+open+reading+frames+(RIDome).">Identification of novel proteins binding the AU-rich element of &#945;-prothymosin mRNA through the selection of open reading frames (RIDome).</a> RNA Biol. 12 (12), 1289-1300 (2015).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+Protocols+in+Molecular+Biology.">Current Protocols in Molecular Biology.</a> Mol Biol. 1 (2), 146 (2003).</li><li>Sblattero, D., Bradbury, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+recombination+in+single+bacteria+to+make+large+phage+antibody+libraries.">Exploiting recombination in single bacteria to make large phage antibody libraries.</a> Nat Biotechnol. 18, 75-80 (2000).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10 (2011).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10 (1), 421 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Quinlan, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+The+Swiss-Army+tool+for+genome+feature+analysis.">BEDTools: The Swiss-Army tool for genome feature analysis.</a> Curr Protoc Bioinforma. , (2014).</li><li>Skinner, M. E., Uzilov, A. V., Stein, L. D., Mungall, C. J., Holmes, I. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JBrowse:+A+next-generation+genome+browser.">JBrowse: A next-generation genome browser.</a> Genome Res. 19 (9), 1630-1638 (2009).</li><li>Gourlay, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+soluble/foldable+protein+domains+through+single-gene+or+genomic+ORF+filtering:+Structure+of+the+head+domain+of+Burkholderia+pseudomallei+antigen+BPSL2063.">Selecting soluble/foldable protein domains through single-gene or genomic ORF filtering: Structure of the head domain of Burkholderia pseudomallei antigen BPSL2063.</a> Acta Crystallogr Sect D Biol Crystallogr. 71, 2227-2235 (2015).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filtering+&amp;#34;genic&amp;#34;+open+reading+frames+from+genomic+DNA+samples+for+advanced+annotation.">Filtering &amp;#34;genic&amp;#34; open reading frames from genomic DNA samples for advanced annotation.</a> BMC Genomics. 12 (Suppl 1), S5 (2011).</li><li>Di Niro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterizing+monoclonal+antibody+epitopes+by+filtered+gene+fragment+phage+display.">Characterizing monoclonal antibody epitopes by filtered gene fragment phage display.</a> Biochem J. 388 (Pt 3), 889-894 (2005).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+celiac+disease+antibody+repertoire.">Profiling celiac disease antibody repertoire.</a> Clin Immunol. 148 (1), 99-109 (2013).</li></ol>

एक उच्च गुणवत्ता अत्यधिक विविध ORFs फ़िल्टर पुस्तकालय के निर्माण के बाद से यह सभी पाइपलाइन के बाद के चरणों को प्रभावित करेगा पूरी प्रक्रिया में पहली महत्वपूर्ण कदम है ।
हमारे विधि का एक महत्वप...

<table border="0" cellpadding="0" cellspacing="0" style="width:1817px;" width="1817">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Sonopuls&#160; ultrasonic homogenizer</td>
			<td style="width:444px;">Bandelin</td>
			<td style="width:423px;">HD2070</td>
			<td style="width:557px;">or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">GeneRuler 100 bp Plus DNA Ladder</td>
			<td style="width:444px;">Thermo Scientific</td>
			<td style="width:423px;">SM0321</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">GeneRuler 1 kb DNA Ladder</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">SM0311</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Molecular Biology Agarose</td>
			<td style="width:444px;">BioRad</td>
			<td style="width:423px;">161-3102</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Green Gel Plus</td>
			<td style="width:444px;">Fisher Molecular Biology</td>
			<td style="width:423px;">FS-GEL01</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">6x DNA Loading Dye</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">QIAquick Gel Extraction Kit</td>
			<td style="width:444px;">Qiagen</td>
			<td style="width:423px;">28704</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Quick Blunting Kit</td>
			<td style="width:444px;">New England Biolabs</td>
			<td style="width:423px;">E1201S</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:393px;">NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">ND-2000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">4368813</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Streptavidin Magnetic Beads</td>
			<td style="width:444px;">New England Biolabs</td>
			<td style="width:423px;">S1420S</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">QIAquick PCR purification Kit</td>
			<td style="width:444px;">Qiagen</td>
			<td style="width:423px;">28104</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">EcoRV</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>R0195L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Antarctic Phosphatase</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>M0289S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">T4 DNA Ligase</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Sodium Acetate 3M pH5.2</td>
			<td style="width:444px;">general lab supplier</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Ethanol for molecular biology</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td style="width:423px;">E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">DH5aF&#39; bacteria cells</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">0,2 ml tubes</td>
			<td style="width:444px;">general lab supplier</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">1,5 ml tubes</td>
			<td style="width:444px;">general lab supplier</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">0,1 cm electroporation cuvettes</td>
			<td style="width:444px;">Biosigma</td>
			<td style="width:423px;">4905020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Electroporator 2510</td>
			<td style="width:444px;">Eppendorf</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">2x YT medium</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>Y1003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Ampicillin sodium salt</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>A9518</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Chloramphenicol</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>C0378</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">DreamTaq DNA Polymerase</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td>EP0702</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Deoxynucleotide (dNTP) Solution Mix</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>N0447S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">96-well thermal cycler (with heated lid)</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">150 mm plates</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">100 mm plates</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>G5516</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BssHII</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>R0199L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NheI</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>R0131L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:444px;">Qiagen</td>
			<td>27104</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M13KO7 Helper Phage</td>
			<td style="width:444px;">GE Healthcare Life Sciences</td>
			<td>27-1524-01&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Kanamycin sulfate from Streptomyces kanamyceticus</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>K1377</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyethylene glycol (PEG)</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>P5413</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Cloride (NaCl)</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dynabeads Protein G for Immunoprecipitation</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MagnaRack Magnetic Separation Rack</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td>CS15000</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tween 20</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>P1379</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonfat dried milk powder</td>
			<td style="width:444px;">EuroClone</td>
			<td>EMR180500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KAPA HiFi HotStart ReadyMix&#160;</td>
			<td style="width:444px;">Kapa Biosystems, Fisher Scientific</td>
			<td>7958935001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AMPure XP beads&#160;</td>
			<td>Agencourt, Beckman Coulter</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nextera XT dual Index&#160; Primers&#160;</td>
			<td style="width:444px;">Illumina</td>
			<td>FC-131-2001 or FC-131-2002 or FC-131-2003 or FC-131-2004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MiSeq or Hiseq2500&#160;</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Spectrophotomer</td>
			<td>Nanodrop</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agilent Bioanalyzer or TapeStation</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forward PCR primer</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>5&#8217; TACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTC 3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse PCR primer</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>5&#8217; TGGTGATGGTGAGTACTATCCAGGCCCAGCAGTGGGTTTG 3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forward primer for NGS</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>&#160;5&#8217; TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCAGCAAGCGGCGCGCATGC 3&#8217;;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse primer for NGS</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>5&#8217; GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGATTGGTTTGCCGCTAGC 3&#8217;;</td>
		</tr>
	</tbody>
</table>

interactome-seq: a protocol for domainome library construction, validation and selection by phage display and next generation sequencing

तह रिपोर्टर ऐसे एंटीबायोटिक प्रतिरोध, जिसकी तह और समारोह के रूप में आसानी से पहचाने phenotypes, के साथ प्रोटीन है जब खराब तह प्रोटीन या यादृच्छिक खुले पढ़ने के फ्रेम से जुड़े समझौता किया है । हम एक रणनीति विकसित की है, जहां, उनि का उपयोग करके-1 β-lactamase (एम्पीसिलीन प्रतिरोध एंजाइम) एक जीनोमिक पैमाने पर, हम सही ढंग से जोड़कर प्रोटीन डोमेन के संग्रह का चयन कर सकते हैं किसी भी intronless जीनोम के डीएनए के कोडिंग भाग से. इस दृष्टिकोण के द्वारा प्राप्त प्रोटीन टुकड़े, तथाकथित "domainome", अच्छी तरह से व्यक्त किया जाएगा और घुलनशील, उन्हें संरचनात्मक/कार्यात्मक अध्ययन के लिए उपयुक्त बनाने.
क्लोनिंग और प्रदर्शित करके "domainome" सीधे एक फेज प्रदर्शन प्रणाली में, हमने दिखाया है कि यह वांछित बाध्यकारी गुणों के साथ विशिष्ट प्रोटीन डोमेन का चयन करने के लिए संभव है (जैसे, अंय प्रोटीन या एंटीबॉडी के लिए), इस प्रकार आवश्यक प्रदान जीन एनोटेशन या प्रतिजन पहचान के लिए प्रयोगात्मक जानकारी।
एक चयनित polyclonal जनसंख्या में सबसे समृद्ध क्लोन की पहचान उपंयास अगली पीढ़ी के अनुक्रमण प्रौद्योगिकियों (NGS) का उपयोग करके प्राप्त किया जा सकता है । इन कारणों के लिए, हम ही पुस्तकालय और चयन outputs के गहरे अनुक्रमण विश्लेषण परिचय विविधता, बहुतायत और चयनित टुकड़ा में से प्रत्येक की सटीक मानचित्रण पर पूरी जानकारी प्रदान करने के लिए । यहां प्रस्तुत प्रोटोकॉल पुस्तकालय निर्माण, लक्षण वर्णन, और सत्यापन के लिए महत्वपूर्ण कदम दिखा ।

फ़िल्टरिंग approach आरेख 1में schematized है । हर तरह के intronless डीएनए का इस्तेमाल किया जा सकता है । चित्रा 1a में फ़िल्टरिंग दृष्टिकोण के पहले भाग का प्रतिनिधित्व किया है: एक agarose जेल या ?...

Watch this Scientific Journal Video about Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing at JoVE.com

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

Interactome-Seq: फेज प्रदर्शन और अगली पीढ़ी अनुक्रमण द्वारा Domainome पुस्तकालय निर्माण, सत्यापन और चयन के लिए एक प्रोटोकॉल

प्रोटोकॉल का वर्णन निर्माण, लक्षण वर्णन और चयन की अनुमति (पसंद के लक्ष्य के खिलाफ) एक "domainome" किसी भी डीएनए स्रोत से बना पुस्तकालय । फेज प्रदर्शन, एक तह रिपोर्टर और डेटा विश्लेषण के लिए एक वेब उपकरण के साथ अगली पीढ़ी sequencing: यह एक अनुसंधान पाइपलाइन है कि विभिन्न प्रौद्योगिकियों को जोड़ती द्वारा हासिल की है.

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to ...

Research

JoVE Journal

Biology

Primer-Free Aptamer Selection Using A Random DNA Library

प्राइमर - फ्री aptamer चयन एक यादृच्छिक डीएनए लाइब्रेरी का उपयोग

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified ...

Peptides from Phage Display Library Modulate Gene Expression in Mesenchymal Cells and Potentiate Osteogenesis in Unicortical Bone Defects

फेज प्रदर्शित लाइब्रेरी से पेप्टाइड्स mesenchymal कोशिकाओं में जीन अभिव्यक्ति न्यूनाधिक और Unicortical अस्थि दोष में अस्थिजनन शक्ति

Two novel synthetic peptides accelerate bone formation and can be delivered using a collagen matrix. The aim of this study was to investigate the effects ...

Fluorescence-microscopy Screening and Next-generation Sequencing: Useful Tools for the Identification of Genes Involved in Organelle Integrity

प्रतिदीप्ति माइक्रोस्कोपी जांच और अगली पीढ़ी के अनुक्रमण: organelle वफ़ादारी में शामिल जीनों की पहचान के लिए उपयोगी उपकरण

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

पुनः संयोजक प्रोटीन फँसाना चाहे का उपयोग फेज प्रदर्शन और आत्मीयता चयन के लिए एक प्रोटोकॉल

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

16S ribosomal शाही सेना जीन amplicons की अगली पीढ़ी के अनुक्रमण

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

डीएनए मेथिलिकरण विश्लेषण अगली पीढ़ी के अनुक्रमण द्वारा लक्षित

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

रेट्रोवायरल एकता स्थलों की प्रवर्धन, अगली पीढ़ी के अनुक्रमण, और जीनोमिक डीएनए का मिलान

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

3' End Sequencing Library Preparation with A-seq2

A-seq2 के साथ 3 ' अंत अनुक्रमण पुस्तकालय की तैयारी

Studies in the last decade have revealed a complex and dynamic variety of pre-mRNA cleavage and polyadenylation reactions. mRNAs with long 3&#39; ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

टिक अगली पीढ़ी 16S rRNA Amplicon अनुक्रमण द्वारा Microbiome लक्षण वर्णन

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

Microbiota विश्लेषण दो कदम पीसीआर और अगली पीढ़ी के 16S rRNA जीन अनुक्रमण का उपयोग

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...