Name: interactome-seq: a protocol for domainome library construction, validation and selection by phage display and next generation sequencing
Uploaded: 2018-10-03T13:00:00
Description: Watch this Scientific Journal Video about Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing at JoVE.com

이 작품은 이탈리아 교육부 및 대학에서 교부 금에 의해 지원 되었다 (CP에 2010P3S8BR_002).

1. ORF 라이브러리 (그림 1)의 건설
<ol><li>삽입 DNA 준비
	<ol>
<li>
합성 또는 genomic DNA에서 조각 준비
		<ol>
<li>표준 방법26를 사용 하 여 DNA를 추출/정화.</li>
			<li>DNA를 조각화 하 여 쥡니다. 100%에 30 s 펄스와 일반적인 제안 시작으로 표준 sonicator를 사용 하 여 경우 전원 출력. 참고: 파일럿 실험 할 수와 다른 전원 쥡니다 번 DNA 준비에 ...

<ol>
	<li>Loman, N. J., Pallen, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Twenty+years+of+bacterial+genome+sequencing.">Twenty years of bacterial genome sequencing.</a> Nat Rev Microbiol. 13 (12), 787-794 (2015).</li><li>Jones, C. E., Brown, A. L., Baumann, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Estimating+the+annotation+error+rate+of+curated+GO+database+sequence+annotations.">Estimating the annotation error rate of curated GO database sequence annotations.</a> BMC Bioinformatics. 8 (1), 170 (2007).</li><li>Andorf, C., Dobbs, D., Honavar, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+inconsistencies+in+genome-wide+protein+function+annotations:+a+machine+learning+approach.">Exploring inconsistencies in genome-wide protein function annotations: a machine learning approach.</a> BMC Bioinformatics. 8 (1), 284 (2007).</li><li>Wong, W. -. C., Maurer-Stroh, S., Eisenhaber, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+Than+1,001+Problems+with+Protein+Domain+Databases:+Transmembrane+Regions,+Signal+Peptides+and+the+Issue+of+Sequence+Homology.">More Than 1,001 Problems with Protein Domain Databases: Transmembrane Regions, Signal Peptides and the Issue of Sequence Homology.</a> PLoS Comput Biol. 6 (7), e1000867 (2010).</li><li>Bioinformatics, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+correction+of+abnormal,+incomplete+and+mispredicted+proteins+in+public+databases.">Identification and correction of abnormal, incomplete and mispredicted proteins in public databases.</a> BMC Bioinformatics. 9 (9), (2008).</li><li>Phizicky, E., Bastiaens, P. I. H., Zhu, H., Snyder, M., Fields, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+analysis+on+a+proteomic+scale.">Protein analysis on a proteomic scale.</a> Nature. 422 (6928), 208-215 (2003).</li><li>DiDonato, M., Deacon, A. M., Klock, H. E., McMullan, D., Lesley, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+scaleable+and+integrated+crystallization+pipeline+applied+to+mining+the+Thermotoga+maritima+proteome.">A scaleable and integrated crystallization pipeline applied to mining the Thermotoga maritima proteome.</a> J Struct Funct Genomics. 5 (1-2), 133-146 (2004).</li><li>Nordlund, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+production+and+purification.">Protein production and purification.</a> Nat Methods. 5 (2), 135-146 (2008).</li><li>Zacchi, P., Sblattero, D., Florian, F., Marzari, R., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+open+reading+frames+from+DNA.">Selecting open reading frames from DNA.</a> Genome Res. 13 (5), 980-990 (2003).</li><li>Di Niro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+interactome+profiling+by+massive+sequencing.">Rapid interactome profiling by massive sequencing.</a> Nucleic Acids Res. 38 (9), e110 (2010).</li><li>Gourlay, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+soluble/foldable+protein+domains+through+single-gene+or+genomic+ORF+filtering:+Structure+of+the+head+domain+of+Burkholderia+pseudomallei+antigen+BPSL2063.">Selecting soluble/foldable protein domains through single-gene or genomic ORF filtering: Structure of the head domain of Burkholderia pseudomallei antigen BPSL2063.</a> Acta Crystallogr Sect D Biol Crystallogr. 71 (Pt 11), 2227-2235 (2015).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filtering+&amp;#34;genic&amp;#34;+open+reading+frames+from+genomic+DNA+samples+for+advanced+annotation.">Filtering &amp;#34;genic&amp;#34; open reading frames from genomic DNA samples for advanced annotation.</a> BMC Genomics. 12 (Suppl 1), S5 (2011).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+celiac+disease+antibody+repertoire.">Profiling celiac disease antibody repertoire.</a> Clin Immunol. 148 (1), 99-109 (2013).</li><li>Robinson, M. D., McCarthy, D. J., Smyth, G. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=edgeR:+A+Bioconductor+package+for+differential+expression+analysis+of+digital+gene+expression+data.">edgeR: A Bioconductor package for differential expression analysis of digital gene expression data.</a> Bioinformatics. 26 (1), 139-140 (2009).</li><li>Heger, A., Holm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exhaustive+enumeration+of+protein+domain+families.">Exhaustive enumeration of protein domain families.</a> J Mol Biol. 328 (3), 749-767 (2003).</li><li>Zacchi, P., Sblattero, D., Florian, F., Marzari, R., Bradbury, A. R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+open+reading+frames+from+DNA.">Selecting open reading frames from DNA.</a> Genome Res. 13 (5), 980-990 (2003).</li><li>Faix, P. H., Burg, M. A., Gonzales, M., Ravey, E. P., Baird, A., Larocca, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phage+display+of+cDNA+libraries:+Enrichment+of+cDNA+expression+using+open+reading+frame+selection.">Phage display of cDNA libraries: Enrichment of cDNA expression using open reading frame selection.</a> Biotechniques. 36 (6), 1018-1029 (2004).</li><li>Patrucco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+novel+proteins+binding+the+AU-rich+element+of+&#945;-prothymosin+mRNA+through+the+selection+of+open+reading+frames+(RIDome).">Identification of novel proteins binding the AU-rich element of &#945;-prothymosin mRNA through the selection of open reading frames (RIDome).</a> RNA Biol. 12 (12), 1289-1300 (2015).</li><li>Collins, M. O., Choudhary, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+multiprotein+complexes+by+affinity+purification+and+mass+spectrometry.">Mapping multiprotein complexes by affinity purification and mass spectrometry.</a> Curr Opin Biotechnol. 19 (4), 324-330 (2008).</li><li>Suter, B., Kittanakom, S., Stagljar, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Two-hybrid+technologies+in+proteomics+research.">Two-hybrid technologies in proteomics research.</a> Curr Opin Biotechnol. 19 (4), 316-323 (2008).</li><li>Nakai, Y., Nomura, Y., Sato, T., Shiratsuchi, A., Nakanishi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+Drosophila+gene+coding+for+a+protein+containing+a+novel+phosphatidylserine-binding+motif.">Isolation of a Drosophila gene coding for a protein containing a novel phosphatidylserine-binding motif.</a> J Biochem. 137 (5), 593-599 (2005).</li><li>Deng, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selection+of+antibody+single-chain+variable+fragments+with+improved+carbohydrate+binding+by+phage+display.">Selection of antibody single-chain variable fragments with improved carbohydrate binding by phage display.</a> J Biol Chem. 269 (13), 9533-9538 (1994).</li><li>Danner, S., Belasco, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T7+phage+display:+A+novel+genetic+selection+system+for+cloning+RNA-binding+proteins+from+cDNA+libraries.">T7 phage display: A novel genetic selection system for cloning RNA-binding proteins from cDNA libraries.</a> Proc Natl Acad Sci. 98 (23), 12954-12959 (2001).</li><li>Gargir, A., Ofek, I., Meron-Sudai, S., Tanamy, M. G., Kabouridis, P. S., Nissim, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+chain+antibodies+specific+for+fatty+acids+derived+from+a+semi-synthetic+phage+display+library.">Single chain antibodies specific for fatty acids derived from a semi-synthetic phage display library.</a> Biochim Biophys Acta - Gen Subj. 1569 (1-3), 167-173 (2002).</li><li>Patrucco, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+novel+proteins+binding+the+AU-rich+element+of+&#945;-prothymosin+mRNA+through+the+selection+of+open+reading+frames+(RIDome).">Identification of novel proteins binding the AU-rich element of &#945;-prothymosin mRNA through the selection of open reading frames (RIDome).</a> RNA Biol. 12 (12), 1289-1300 (2015).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+Protocols+in+Molecular+Biology.">Current Protocols in Molecular Biology.</a> Mol Biol. 1 (2), 146 (2003).</li><li>Sblattero, D., Bradbury, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+recombination+in+single+bacteria+to+make+large+phage+antibody+libraries.">Exploiting recombination in single bacteria to make large phage antibody libraries.</a> Nat Biotechnol. 18, 75-80 (2000).</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10 (2011).</li><li>Camacho, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BLAST+:+architecture+and+applications.">BLAST+: architecture and applications.</a> BMC Bioinformatics. 10 (1), 421 (2009).</li><li>Li, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Sequence+Alignment/Map+format+and+SAMtools.">The Sequence Alignment/Map format and SAMtools.</a> Bioinformatics. 25 (16), 2078-2079 (2009).</li><li>Quinlan, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BEDTools:+The+Swiss-Army+tool+for+genome+feature+analysis.">BEDTools: The Swiss-Army tool for genome feature analysis.</a> Curr Protoc Bioinforma. , (2014).</li><li>Skinner, M. E., Uzilov, A. V., Stein, L. D., Mungall, C. J., Holmes, I. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JBrowse:+A+next-generation+genome+browser.">JBrowse: A next-generation genome browser.</a> Genome Res. 19 (9), 1630-1638 (2009).</li><li>Gourlay, L. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+soluble/foldable+protein+domains+through+single-gene+or+genomic+ORF+filtering:+Structure+of+the+head+domain+of+Burkholderia+pseudomallei+antigen+BPSL2063.">Selecting soluble/foldable protein domains through single-gene or genomic ORF filtering: Structure of the head domain of Burkholderia pseudomallei antigen BPSL2063.</a> Acta Crystallogr Sect D Biol Crystallogr. 71, 2227-2235 (2015).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Filtering+&amp;#34;genic&amp;#34;+open+reading+frames+from+genomic+DNA+samples+for+advanced+annotation.">Filtering &amp;#34;genic&amp;#34; open reading frames from genomic DNA samples for advanced annotation.</a> BMC Genomics. 12 (Suppl 1), S5 (2011).</li><li>Di Niro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterizing+monoclonal+antibody+epitopes+by+filtered+gene+fragment+phage+display.">Characterizing monoclonal antibody epitopes by filtered gene fragment phage display.</a> Biochem J. 388 (Pt 3), 889-894 (2005).</li><li>D'Angelo, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+celiac+disease+antibody+repertoire.">Profiling celiac disease antibody repertoire.</a> Clin Immunol. 148 (1), 99-109 (2013).</li></ol>

높은 품질 높은 다양 한 ORFs 필터링 된 도서관의 창조 때문에 파이프라인의 모든 이후 단계에 영향을 미칠 것입니다 전체 절차의 첫 번째 중요 한 단계입니다.
우리의 방법의 중요 한 유리한 기능 (intronless) DNA (cDNA, genomic DNA, PCR 파생 이나 합성 DNA)의 모든 소스 라이브러리 건설에 적합 이다. 고려 되어야 하는 첫 번째 매개 변수는 pFILTER 벡터에 복제 하는 DNA 파편의 길이 게놈 또...

여기, 우리는 높은 처리량 방법 건설과 genic/게놈 시작 소스에서 접힌 및 수용 성 단백질 도메인의 라이브러리의 선택에 대 한 설명. 접근은 세 가지 다른 기술: 파지 디스플레이, 데이터 분석을 위한 접는 기자와 특정 웹 도구 다음 세대 시퀀싱 (NGS)의 사용. 식별 및 새로운 단백질/단백질 도메인의 주석, 알려진된 단백질의 구조 및 기능적 속성의 정의의 특성에 대 한 단백질 기반 연구의 많은 다른 컨텍스트에서 메서드를 사용할 수 있습니다. 단백질 상호 작용 네트워크입니다.
많은 관련 질문은 단백질 기반 연구에 여전히 존재 하 고 최적의 단백질 생산을 위한 방법의 개발은 조사의 여러 분야에 대 한 중요 한 필요. 예를 들어 간결한 하 고 진 핵 게놈1의 수천의 가용성에도 불구 하 고 코딩 된 단백질 및 펩 티 드의 직접 주석으로 상대 proteomes의 해당 지도 아직도 대부분의 유기 체에 대 한 누락 된. 완전 한 proteomes의 카탈로그는 도전 목표 시간 및 자원의 점에서 거 대 한 노력을 요구로 떠오르고 있다. 실험적인 주석에 대 한 황금 표준 남아 모든 오픈 독서 프레임 (ORFs)는 게놈의 소위 "ORFeome" 건물의 복제. 일반적으로 유전자 기능에 알려진된 활동의 관련된 유전자 상 동에 따라 할당 됩니다 하지만이 방식은 많은 잘못 된 주석 참조 데이터베이스2,3,4,의 존재로 인해 제대로 정확한 5. 또한, 심지어 식별 및 주석 된 단백질에 대 한 추가 연구는 풍요, 구조적 및 기능적 속성을 포함 하 여 다른 컨텍스트에서 식 패턴의 관점에서 특성을 달성 하는 데 필요한 뿐만 아니라 상호 작용 네트워크입니다.
또한, 이후 단백질 그들 각각의 다른 도메인으로 구성 된 특정 기능을 표시 하 고 다르게 단백질 기능에 기여 하 고, 연구 하 고 이러한 도메인의 정확한 정의 수 있습니다 더 포괄적인 그림을 모두 단일 유전자 전체 게놈 수준에서. 이 모든 필요한 정보를 만든다 단백질 기반 연구 다양 하 고 도전적인 분야를
이 관점에서 중요 한 기여 단백질 생산을 위한 공평 하 고 높은 처리량 방법으로 주어질 수 있었다. 그러나, 상당한 투자가 필요 하 고, 옆에 같은 방식의 성공 성/안정적인 단백질 구조를 생산 하는 능력에 의존 합니다. 이것은 주요 제한 요소 때문에 단백질의 약 30% 수 수 성공적으로 표현을 실험적으로 유용한6,,78될 충분 한 수준에서 생산 추정 되었다. 이 한계를 극복 하는 방법은 함께 개별 유전자의 겹치는 조각 표현을 제공 하는 다른 polypeptides를 생산 하기 위해 무작위로 파편이 된 DNA의 사용을 기반으로 합니다. 임의로 생성 된 DNA 파편의 단지 작은 백분율은 기능적 ORFs 동안 그들의 대다수 (그들의 순서 안에 정지 codons의 존재) 때문에 작동 하지 않습니다 또는 해제 자연 (원래 다른 프레임에 ORF)에 대 한 인코딩 생물학 의미 없이 polypeptides입니다.
이러한 모든 문제를 해결 하려면 우리의 그룹 게놈 규모9,10,,1112에서 사용할 수는 높은 처리량 단백질 표현과 상호 작용 분석 플랫폼을 개발 했습니다. 이 플랫폼 통합 다음 방법: 1); 모든 유기 체에서 DNA의 코딩 부분에서 제대로 접힌된 단백질 도메인의 컬렉션을 선택 하는 방법 상호 작용;의 파트너를 선택 하기 위한 2) 살 균 소 전시 기술 완전히 특성화 연구 전체 위하여 식별 관심;의 클론을 NGS 3) 그리고 4) 간단 하 고 사용자 친화적인 방식으로 위하여 Seq 분석을 수행 하기 위해 어떤 생물 정보학 또는 프로그래밍 기술 없이 사용자에 대 한 데이터 분석을 위한 웹 도구.
이 플랫폼의 사용 조사;의 대안 전략에 비해 중요 한 장점을 제공합니다 위의 모든 방법은 완전히 편견, 높은 처리량 및 전체 게놈까지 단일 유전자에서 배열 하는 연구에 대 한 모듈입니다. 파이프라인의 첫 단계가 특징인 다음 깊이 NGS 연구에서 무작위로 파편이 된 DNA에서 도서관의 창조 이다. 이 라이브러리는 관심의 유전자/파편 periplasmic 공간 (즉, 초 지도자)으로 단백질 분 비에 대 한 신호 순서와 TEM1 β-lactamase 유전자 사이 복제는 설계 된 벡터를 사용 하 여 생성 됩니다. 융해 단백질 암 피 실린 저항 및 복제 조각 프레임 경우에 암 피 실린 압력 하에서 생존 능력 부여 됩니다 이러한 요소와 결과 융해 단백질은 제대로 접힌된10,13 14. 모든 클론 항생제 선택, 소위 "필터링 클론" 구조, ORFs, 그들 (80%)의 대다수는, 실제 유전자9에서 파생 됩니다. 또한,이 전략의 힘 모든 필터링 ORF 클론 제대로 접혀/수용 성 단백질/도메인15인코딩하는 발견에 있다. 많은 클론, 라이브러리 및 매핑 동일한 지역/도메인에 있는 다른 시작 지점 및 끝 지점을, 수용 성 제품에서 발생 가능성이 최소 조각의 편견, 단일 단계 식별 수 있습니다.
기술에 있는 더 개선 라이브러리 특성 NGS의 사용에 의해 제공 됩니다. 이 플랫폼의 조합을 데이터 분석에 대 한 특정 웹 도구 참조 DNA 더 광범위 한 분석 필요성 없이 연구에 중요 한 편견된 정보 선택한 ORFs의 위치와 정확한 뉴클레오티드 시퀀스에 제공 또는 실험적인 노력입니다.
Domainome 라이브러리 선택 컨텍스트로 전송 고 기능 연구를 수행 하는 범용 악기로 사용 될 수 있습니다. 높은 처리량 단백질 표현과 상호 작용 분석 플랫폼 우리가 통합을 우리 위하여 Seq 라는 활용 살 균 소 전시 기술 phagemid 벡터 필터링된 ORF 전송 및 살 균 소 ORF를 만드는 도서관입니다. 일단 단백질 도메인 M13 입자;의 표면에 표시 되는 페이지 디스플레이 컨텍스트를에 다시 복제 이 방법으로 domainome 라이브러리는 유전자 파편 특정 효소 활동 도메인 인코딩 또는 바인딩 속성을 위하여 네트워크 프로 파일링에 대 한 직접 선택할 수 있습니다. 이 방법은 처음 Zacchi 그 외 여러분 에 의해 기술 되었다 16 및 여러 가지 다른 컨텍스트13,,1718에서 나중에 사용.
(를 포함 하 여 효 모 2 잡종 시스템 및 질량 분석19,20) 단백질 단백질 상호 작용을 공부 하는 데 사용 하는 다른 기술에 비해, 하나의 주요 장점은 살 균 소 중 발생 하는 바인딩 파트너의 증폭 선택의 여러 라운드를 표시 합니다. 이 라이브러리에 있는 낮은 풍부한 바인딩 단백질 도메인의 식별 되므로 선택 감도 증가 합니다. ORF 필터 라이브러리를 사용 하 여 수행 하는 선택의 효율성은 비 기능 클론의 부재로 인해 더욱 증가 된다. 마지막으로, 기술 선택을 단백질과 비 단백질 미끼21,22,23,,2425에 대해 수행 될 수 있습니다.
Domainome-페이지 라이브러리를 사용 하 여 페이지 선택 미끼로 다른 병 적인 조건 환자, 예를 들어 면역 질환13, 암 또는 감염 질환의 혈 청에서 나오는 항 체를 사용 하 여 수행할 수 있습니다. 이 방법은 대규모 식별 하 고 특성 항 원/epitopes 구체적으로 동시에 환자의 항 체에 의해 인식 수 있도록 연구에서 질병의 소위 "항 체 서명"를 얻기 위해 사용 됩니다. 사용 하는 다른 방법에 비해 살 균 소의 디스플레이 선형 및 구조적 항 원 epitopes의 식별 수 있습니다. 특정 서명 식별 잠재적으로 이해 병 인, 새로운 백신 디자인, 새로운 치료 목표의 확인과 개발 도구의 새로운 및 특정 진단 및 예 후에 대 한 중요 한 영향을 미칠 수 있는. 또한, 연구는 전염 성 질병에 초점을 맞추고 때 주요 이점은 면역성 단백질의 발견은 병원 체 재배에서 독립 이다.
우리의 접근 방식은 접는 기자를 "domainome"를 선택 하는 게놈에 사용할 수 있는 확인: DNA의 코딩 부분에서 제대로 접혀, 잘 표현, 수용 성 단백질 도메인 어떤 유기 체에서 cDNA의 컬렉션. 일단 고립 된 단백질 조각을 유전자 주석 뿐만 구조 연구, 항 체 epitope 매핑, 항 원 확인, 등등에 대 한 필수적인 실험 정보를 제공 하는 많은 목적을 위해 유용 하다. NGS에서 제공 하는 높은 처리량 데이터의 완전성 살 균 소 전시 도서관, 등 매우 복잡 한 샘플의 분석을 가능 하 게 그리고 전통적인 힘 드는 따기 및 개별 페이지 구조 클론의 테스트 회피 가능성을 보유 하고있다.
기능 필터링 된 라이브러리의와 극단적인 감도 그리고 NGS 분석의 힘을 동시에 만들 필요 없이 초기 화면에서 직접 각 상호 작용의 책임 단백질 도메인 식별 가능 하다 각 추가 라이브러리 바인딩 단백질. NGS genic/게놈 시작 소스 전체 domainome의 포괄적인 정의를 허용 하 고 데이터 분석 웹 도구는 매우 구체적인 특성 모두는 질적, 양적 관점에서의 획득은 위하여 단백질의 도메인입니다.

<table border="0" cellpadding="0" cellspacing="0" style="width:1817px;" width="1817">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Sonopuls&#160; ultrasonic homogenizer</td>
			<td style="width:444px;">Bandelin</td>
			<td style="width:423px;">HD2070</td>
			<td style="width:557px;">or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">GeneRuler 100 bp Plus DNA Ladder</td>
			<td style="width:444px;">Thermo Scientific</td>
			<td style="width:423px;">SM0321</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">GeneRuler 1 kb DNA Ladder</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">SM0311</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Molecular Biology Agarose</td>
			<td style="width:444px;">BioRad</td>
			<td style="width:423px;">161-3102</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Green Gel Plus</td>
			<td style="width:444px;">Fisher Molecular Biology</td>
			<td style="width:423px;">FS-GEL01</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">6x DNA Loading Dye</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">R0611</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">QIAquick Gel Extraction Kit</td>
			<td style="width:444px;">Qiagen</td>
			<td style="width:423px;">28704</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Quick Blunting Kit</td>
			<td style="width:444px;">New England Biolabs</td>
			<td style="width:423px;">E1201S</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:19px;width:393px;">NanoDrop 2000 UV-Vis Spectrophotometer</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">ND-2000</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">High-Capacity cDNA Reverse Transcription Kit</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;">4368813</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Streptavidin Magnetic Beads</td>
			<td style="width:444px;">New England Biolabs</td>
			<td style="width:423px;">S1420S</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">QIAquick PCR purification Kit</td>
			<td style="width:444px;">Qiagen</td>
			<td style="width:423px;">28104</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">EcoRV</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>R0195L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Antarctic Phosphatase</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>M0289S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">T4 DNA Ligase</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>M0202T</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Sodium Acetate 3M pH5.2</td>
			<td style="width:444px;">general lab supplier</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Ethanol for molecular biology</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td style="width:423px;">E7023</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">DH5aF&#39; bacteria cells</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">0,2 ml tubes</td>
			<td style="width:444px;">general lab supplier</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">1,5 ml tubes</td>
			<td style="width:444px;">general lab supplier</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">0,1 cm electroporation cuvettes</td>
			<td style="width:444px;">Biosigma</td>
			<td style="width:423px;">4905020</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Electroporator 2510</td>
			<td style="width:444px;">Eppendorf</td>
			<td style="width:423px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">2x YT medium</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>Y1003</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Ampicillin sodium salt</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>A9518</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">Chloramphenicol</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>C0378</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">DreamTaq DNA Polymerase</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td>EP0702</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Deoxynucleotide (dNTP) Solution Mix</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>N0447S</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">96-well thermal cycler (with heated lid)</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">150 mm plates</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:393px;">100 mm plates</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>G5516</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">BssHII</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>R0199L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NheI</td>
			<td style="width:444px;">New England Biolabs</td>
			<td>R0131L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:444px;">Qiagen</td>
			<td>27104</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">M13KO7 Helper Phage</td>
			<td style="width:444px;">GE Healthcare Life Sciences</td>
			<td>27-1524-01&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Kanamycin sulfate from Streptomyces kanamyceticus</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>K1377</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Polyethylene glycol (PEG)</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>P5413</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sodium Cloride (NaCl)</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">PBS</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Dynabeads Protein G for Immunoprecipitation</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td>10003D</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MagnaRack Magnetic Separation Rack</td>
			<td style="width:444px;">Thermo Fisher Scientific</td>
			<td>CS15000</td>
			<td>or equivalent</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Tween 20</td>
			<td style="width:444px;">Sigma-Aldrich</td>
			<td>P1379</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nonfat dried milk powder</td>
			<td style="width:444px;">EuroClone</td>
			<td>EMR180500</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">KAPA HiFi HotStart ReadyMix&#160;</td>
			<td style="width:444px;">Kapa Biosystems, Fisher Scientific</td>
			<td>7958935001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AMPure XP beads&#160;</td>
			<td>Agencourt, Beckman Coulter</td>
			<td>A63881</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Nextera XT dual Index&#160; Primers&#160;</td>
			<td style="width:444px;">Illumina</td>
			<td>FC-131-2001 or FC-131-2002 or FC-131-2003 or FC-131-2004</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">MiSeq or Hiseq2500&#160;</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Spectrophotomer</td>
			<td>Nanodrop</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agilent Bioanalyzer or TapeStation</td>
			<td>Agilent</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forward PCR primer</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>5&#8217; TACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTC 3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse PCR primer</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>5&#8217; TGGTGATGGTGAGTACTATCCAGGCCCAGCAGTGGGTTTG 3&#8217;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Forward primer for NGS</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>&#160;5&#8217; TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGCAGCAAGCGGCGCGCATGC 3&#8217;;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Reverse primer for NGS</td>
			<td style="width:444px;">general lab supplier</td>
			<td></td>
			<td>5&#8217; GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGGATTGGTTTGCCGCTAGC 3&#8217;;</td>
		</tr>
	</tbody>
</table>

interactome-seq: a protocol for domainome library construction, validation and selection by phage display and next generation sequencing

접이식 기자는 쉽게 식별할 수 있는 고기, 항생제 내성, 단백질 또는 임의의 열려있는 독서 프레임을 접는 제대로 융합 될 때 그 접는 및 기능 손상 등으로 단백질. 우리는 어디, 사용 하 여 가장-1 β-lactamase (암 피 실린 저항을 부여 하는 효소) 게놈 규모, 우리 수 선택 잘못 접힌된 단백질 도메인의 컬렉션 어떤 intronless 유전자의 DNA의 코딩 부분에서 전략을 개발 했습니다. 이 접근 방식, 소위 "domainome"에 의해 얻은 단백질 조각 잘 표현 하 고 수용 성, 구조/기능 연구에 대 한 적합 한 그들을 만드는 것입니다.
복제 페이지 디스플레이 시스템에 직접 "domainome"를 표시 함으로써, 우리 그것은 원하는 바인딩 속성 (예를 들어, 다른 단백질 또는 항 체), 특정 단백질 도메인 선택할 수 필수 제공 보였다가 유전자 주석 또는 항 원 확인. 에 대 한 실험 정보
새로운 차세대 시퀀싱 기술 (NGS)를 사용 하 여 선택한 polyclonal 인구에 가장 풍부한 클론의 id는 얻을 수 있습니다. 이러한 이유로 라이브러리 자체의 다양성, 풍부 및 정확한 매핑을 선택한 조각의 각에 완전 한 정보를 제공 하도록 선택 출력 깊은 시퀀싱 분석을 소개 합니다. 여기에 제시 된 프로토콜 라이브러리 건설, 특성화 및 유효성 검사에 대 한 주요 단계를 보여줍니다.

필터링 접근은 그림 1에서 도식화. Intronless DNA의 각 종류를 사용할 수 있습니다. 그림 1A 에서 필터링 접근의 첫 번째 부분 표시 됩니다: agarose 젤에 있는 bioanalyzer 후, 관심의 DNA의 좋은 조각 조각 150-750 bp의 원하는 크기에 길이 분포의 얼룩으로 나타납니다. 얻은 조각난된 DNA의 대표적인 가상 젤 이미지는 주어진 다. 조각 agarose ?...

Watch this Scientific Journal Video about Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing at JoVE.com

Interactome-Seq: A Protocol for Domainome Library Construction, Validation and Selection by Phage Display and Next Generation Sequencing

위하여-Seq: Domainome 라이브러리 건설, 유효성 검사 및 페이지 표시 및 다음 세대 시퀀싱 선택 프로토콜

설명 하는 프로토콜 건설, 특성화 및 DNA 소스에서 만든 "domainome" 라이브러리 (선택의 대상)에 대 한 선택 수 있습니다. 이것은 다른 기술을 결합 하 여 연구 파이프라인에 의해 달성: 파지 디스플레이, 접이식 기자와 다음 세대 시퀀싱 데이터 분석을 위한 웹 도구.

Folding reporters are proteins with easily identifiable phenotypes, such as antibiotic resistance, whose folding and function is compromised when fused to ...

이 방법은 새로운 단백질 또는 단백질 도메인의 음장, 알려진 단백질의 구조적 및 기능적 특성의 특성화, 단백질 상호 작용 네트워크 또는 다른 조건에서 항원 항체 시그니처의 정의와 같은 단백질 기반 연구에서 주요 질문에 답하는 데 도움이 될 수 있습니다. 이 기술의 주요 장점은 단일 유전자에서 전체 게놈에 이르기까지 모든 종류의 연구에 대해 완전히 편견이 없고 높은 처리량및 모듈식이라는 것입니다. 도메인 라이브러리의 구성은 기능 연구에 매우 유용합니다.그것은 파지 디스플레이 문맥으로 옮겨지고 결합 단백질 또는 정제 항체와 같은 다른 표적에 대하여 선택을 위해 사용될 수 있다. NGS와의 커플링은 매우 민감하고 강력한 분석을 가능하게 합니다. 동시에, 특별히 개발 된 웹 도구는 전체 도메인 및 상호 작용의 정확한 특성을 제공합니다.먼저 ORF 라이브러리를 구성하려면 100%의 출력으로 30초 펄스로 DNA를 초음파 처리합니다. 초음파 처리 후 사다리와 초음파 처리 된 DNA를 1.5 % 아가로즈 젤에 적재하십시오. 그런 다음 전기 전도 장치를 센티미터 당 5 볼트로 15 분 동안 시작합니다.아가로즈 겔 전기포고증은 초음파 처리를 확인하는 DNA 얼룩의 존재를 나타낸다. 이는 초음파 처리를 거치지 않는 DNA로부터 얻은 고체 밴드와 비교된다. 그런 다음 단편화된 DNA 얼룩으로 젤 부분을 자르고 컬럼 기반 젤 추출 키트를 사용하여 정화합니다.UV 분광계에서 정제된 DNA의 농도를 측정합니다. 그런 다음 제조업체의 지시에 따라 빠른 무딘 효소 믹스의 마이크로 리터 1개로 5마이크로그램의 인서트를 치료합니다. 그런 다음 효소 믹스를 섭씨 70도에서 10분 동안 비활성화합니다.여과 벡터를 준비하려면 먼저 EcoRV 제한 효소로 정제된 복제 벡터의 5마이크로그램을 소화한다. 그런 다음 소화되고 소화되지 않은 벡터와 분자 마커를 1% 아가로즈 젤에 적재합니다. 그런 다음 가열은 제한 효소를 섭씨 80도에서 20분 동안 비활성화합니다.다음으로, 소화된 벡터를 5단위의 인산효소와 10X 인산염 버퍼의 1/10부피를 증식한다. 그런 다음 혼합물을 섭씨 37도에서 15분 동안 배양합니다. 그런 다음 인산염 효소를 섭씨 65도에서 5분간 비활성화합니다.다음으로, 젤에서 플라스미드를 추출하고 DNA를 정화합니다. 그런 다음 UV 분광계에서 DNA의 농도를 측정합니다. 결찰 반응을 수행하기 위해 소화된 벡터 1마이크로그램에 인산체 400나노그램, 10X T4 DNA 리구아제 버퍼 및 T4 DNA 리구아제를 100 마이크로리터의 최종 부피에 추가한다.그런 다음 하룻밤 동안 16섭씨에서 결찰 반응을 배양합니다. 다음 날, 열은 10 분 동안 65섭씨에서 리그아제비활성화. 다음으로, 3개의 어금니 나트륨 아세테이트의 1/10 부피를 pH 5.2 및 2.5부량의 100% 에탄올을 추가하여 결찰 생성물을 침전시한다.DNA를 침전시키기 위해 시약을 섞고 섭씨 영하 80도에서 20분 동안 동결하십시오. 20분 후, 섭씨 4도에서 20분 동안 최고 속도로 원심분리기. 원심 분리 후, 상체를 추방.펠릿에 차가운 70% 에탄올과 원심분리기 500마이크로리터를 넣습니다. 원심 분리의 끝에 상체를 폐기합니다. 펠릿이 공기건조되면 침전된 DNA를 10마이크로리터의 물에 녹입니다.전기 포기를 수행하기 전에, 얼음에 미세 원심 분리기 튜브와 0.1 센티미터 전기 포기큐벳의 적절한 수를 준비합니다. 그런 다음 세포의 25 마이크로 리터에 정제 된 결찰 제품의 마이크로 리터 1 개를 추가합니다. 그런 다음 DNA, 세포 혼합물을 차가운 전기 기화 큐벳에 피펫하고 튜브를 쓸어 넘깁니다.그런 다음 큐벳의 외부에서 물을 닦아 전기 기장치에 배치하고 펄스를 명중. 전기 포기가 끝난 후, 큐벳의 세포에 항생제없이 액체 2X YT 배지 의 1 밀리리터를 신속하게 추가하십시오. 그런 다음 세포 혼합물을 10 밀리리터 튜브로 옮김합니다.분당 220회전에서 1시간 동안 37도의 회전에서 튜브를 흔들어 두십시오. 10센티미터 2X YT 아가 플레이트에 클로람페니콜, 암피실린, 클로람페니콜만 으로 보충한 10센티미터 2X YT 아가 플레이트에 보관물의 희석을 플레이트. 이것은 PCR에 의해 시험되고 적정을 능력을 발휘하기 위하여 단 하나 식민지를 얻는 것입니다.다음으로, 15센티미터 2X YT 아가 플레이트에 변형된 유능한 세포를 클로람페니콜과 암피실린으로 보충합니다. 그런 다음 하룻밤 동안 섭씨 30도에서 접시를 배양합니다. 다음 날, 식민지들이 계산할 수 있는 희석을 선택하는 것을 세어라.그런 다음 라이브러리 크기를 계산합니다. 라이브러리 크기는 다음과 같이 계산되며, 평균 콜로니 수 시간 희석 계수 시간 총 라이브러리 볼륨이 계산됩니다. 라이브러리 크기는 6개의 클론의 힘에 10의 순서로 되어 있어야 합니다.암피실린 농도가 더 많은 여과를 수행하는 것이 최적인 경우, 클론 수는 이 항생제가 없는 상태에서 얻은 것의 1내지 20으로 감소한다. 긍정적인 식민지에 대 한 테스트, 주위 를 데리러 팁을 사용 하 여 15 받는 것 20 단일 식민지. 그런 다음 항생제없이 2X YT 배지의 100 마이크로 리터로 식민지를 희석시하십시오.다음으로, PCR은 Taq DNA 폴리머라제와 DNA 템플릿으로 배양의 0.5 마이크로리터를 증폭시다. PCR 동안 섭씨 55도의 어너링 온도와 섭씨 72도에서 40초의 연장 시간을 사용하여 25사이클의 증폭을 실행합니다. 인서트 길이가 150 ~ 750베이스 쌍의 예상 범위에 있는지 확인합니다.그리고 다른 식민지는 다른 크기의 다른 인서트를 제시한다. 이는 가변성 측면에서 좋은 라이브러리 준비를 나타냅니다. 다음으로, 박테리아를 수집하기 위해 150mm 플레이트에 신선한 2X YT 배지 3 밀리리터를 추가합니다.그런 다음 멸균 스크레이퍼를 사용하여 박테리아를 수확하십시오. 철저하게 혼합 한 후, 추가 20% 글리세롤과 향후 사용을 위해 알리코에 영하 80도에 둡니다. 즉시 사용하려면 컬럼 기반 플라스미드 추출 키트를 수행하여 글리세롤을 추가하기 전에 라이브러리의 알리쿼트 중 하나에서 플라스미드 DNA를 정화합니다.UV 분광광계에서 DNA의 농도를 측정한 다음 사용전까지 샘플을 섭씨 영하 20도에 저장합니다. PCR 증폭을 위한 DNA 템플릿으로 라이브러리의 2.5 마이크로리터를 사용합니다. 열순환기 조건을 설정하고 실행을 시작합니다.다음으로 인덱스 PCR 키트를 사용하여 인덱스 PCR을 수행합니다. 이렇게 하면 멀티플렉스 일루미나 실행 내의 이중 인덱싱 된 라이브러리가 시퀀싱됩니다. 그런 다음 열순환기 조건을 설정하고 실행을 시작합니다.AMPure XP 구슬로 정화한 후 크기를 확인하기 위해 바이오 분석기에 최종 라이브러리의 1~10희석을 1마이크로리터로 실행합니다. 그런 다음 최종 라이브러리 추적 영역을 선택하여 정량화합니다. 이러한 회로도 표현은 P 필터 벡터로 복제 한 후, ORFs에 대응하는 식민지만이 항생제의 존재에서 기능성 베타 - 락타마아를 생산한다는 것을 악마.20배의 클론 수의 감소를 필터링한 후 예상된다. 좋은 폴더 ORFs 높은 항생제 농도에서 성장. 또한 ORF 조각은 필터링된 라이브러리에서 쉽게 복구할 수 있습니다.파지미드 ORF 라이브러리는 표적 단백질 또는 항체에 대한 파지 디스플레이 선택을 수행하기 위해 구성됩니다. 그런 다음 얻은 모든 라이브러리와 출력은 NGS에 의해 깊이 분석됩니다. NGS는 선택한 각 조각의 라이브러리 다양성, 풍부하고 정확한 매핑에 대한 완전한 정보를 제공합니다.마지막으로 상호 작용 추구 웹툴개발은 유전체 성모가 있는 퍼디지도메인 목록에 이르는 원시 시퀀싱 판독을 생성합니다. 이 비디오를 시청한 후에는 원하는 DNA 소스에서 도메인 라이브러리를 구성하고 검증하는 방법을 잘 이해해야 합니다. 그리고 차세대 시퀀싱에 의한 라이브러리의 높은 처리량 스크리닝을 수행한다.우리는 일루미나 플랫폼으로 ORF 필터링 라이브러리의 순서를 최적화하고 프로그래밍 기술없이 이러한 종류의 데이터를 분석 할 수있는 웹 도구를 개발했습니다.

Research

JoVE Journal

Biology

Primer-Free Aptamer Selection Using A Random DNA Library

랜덤 DNA 라이브러리를 사용하여 뇌관 - 무료 Aptamer 선택

Aptamers are highly structured oligonucleotides (DNA or RNA) that can bind to targets with affinities comparable to antibodies 1. They are identified ...

연구

생물학

Peptides from Phage Display Library Modulate Gene Expression in Mesenchymal Cells and Potentiate Osteogenesis in Unicortical Bone Defects

파지 디스플레이 도서관에서 펩티드는 Mesenchymal 세포의 유전자 발현을 조절하고 Unicortical 뼈 결함에 Osteogenesis을 힘을 주다

Two novel synthetic peptides accelerate bone formation and can be delivered using a collagen matrix. The aim of this study was to investigate the effects ...

Fluorescence-microscopy Screening and Next-generation Sequencing: Useful Tools for the Identification of Genes Involved in Organelle Integrity

형광 - 현미경 검사와 차세대 장면 : Organelle 무결성에 관련된 유전자의 식별을위한 유용한 도구

This protocol describes a fluorescence microscope-based screening of Arabidopsis seedlings and describes how to map recessive mutations that alter the ...

A Protocol for Phage Display and Affinity Selection Using Recombinant Protein Baits

재조합 단백질의 미끼를 사용 파지 디스플레이와 궁합 선택을위한 프로토콜

Using  recombinant phage as a scaffold to present various protein portions encoded by  a directionally cloned cDNA library to immobilized bait molecules ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

16S 리보솜 RNA 유전자 증폭 산물의 차세대 시퀀싱

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Targeted DNA Methylation Analysis by Next-generation Sequencing

DNA 메틸화 분석 차세대 시퀀싱 대상

The role of epigenetic processes in the control of gene expression has been known for a number of years. DNA methylation at cytosine residues is of ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

레트로 바이러스 통합 사이트의 증폭, 차세대 시퀀싱 및 게놈 DNA 매핑

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

3' End Sequencing Library Preparation with A-seq2

3' 끝 시퀀싱 A seq2 라이브러리 준비

Studies in the last decade have revealed a complex and dynamic variety of pre-mRNA cleavage and polyadenylation reactions. mRNAs with long 3&#39; ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

다음-세대 16S rRNA Amplicon 시퀀싱에 의해 틱 미생물 특성

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

2단계 PCR 및 차세대 16S rRNA 유전자 시퀀싱을 사용한 미생물 분석

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...