Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

الكتاب أود أن أشكر تيرني Gráinne للمساعدة التحريرية.

البروتوكول يتبع المبادئ التوجيهية للجنة الأخلاقيات البحثية البشرية IRST.
ملاحظة: هذا الإجراء هو مصممة خصيصا للكشف عن عدد قليل من الجزيئات كدنا في الأنسجة البشرية الطازجة المجمدة. وخفضت الفروع الأنسجة على الثلج الجاف، بينما لا تزال مجمدة، من ورم المعدة المصادق عليه سابقا مشت...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

دبكر وضعت أصلاً للحمض النووي الجزيئي القياسات10،11،،من1213 وفي وقت تم تكييف هذه التكنولوجيا للتحديد الكمي ميكرورناس، والجيش الملكي النيبالي النصوص5، ،من 1415. في هذا البر?...

ترميز الجينات CDH1 لهاء-كادهيرين، عاملاً رئيسيا يشارك في الحفاظ على ظهارة المعدة العادية من خلال تنظيم خلية التصاق والبقاء على قيد الحياة، والانتشار والهجرة1. فقدان البروتين كادهيرين ه نتيجة للفعل الضار أو تعديلات جسدية من CDH1 ارتبطت بتطوير GC2،3. قد تم الافتراض المستنسخات المتعارف عليه عدم الناشئة عن إنترون 2 الجينات أيضا أن تلعب دوراً في التسرطن المعدة4،5. على وجه الخصوص، واحد هذه المحاضر، CDH1a، لقد ثبت أن يتم التعبير عنها في خطوط الخلايا GC لكن تغيب من المعدة العادي4. ونحن مؤخرا الكشف عن CDH1a في عينات الأنسجة GC من المرضى GC استخدام دبكر المستندة إلى شرائح5. دبكر واستخدم لتقييم، للمرة الأولى، وجود نسخة الجين CDH1a في GC الأمعاء وأنسجة طبيعية.
هو أسلوب المعيار الذهبي لتحديد التعبير الجيني PCR الكمي في الوقت الحقيقي (قبكر). ومع ذلك، البيانات الناتجة في بعض الأحيان يمكن أن يكون متغير وذات نوعية رديئة، خصوصا عند مستوى المستهدفة في العينة منخفضا. يمكن أن يكون سبب هذا التغير من الملوثات، التي تعوق النشاط بوليميريز والصلب التمهيدي، مما أدى إلى تضخيم غير محددة و ردود فعل الجانب التنافسي6.
على الرغم من أن مبادئ دبكر البيوكيميائية الأساسية مشابهة لتلك التي قبكر، دبكر يظهر بعض المزايا، مما يسمح لقياسات دقيقة جداً للحمض النووي (جدنا)/التكميلية جزيئات الحمض النووي (كدنا). وفي الواقع، هو دبكر فعل نقطة نهاية التي تعتمد على تقسيم معايرة من عينة إلى آلاف آبار، حيث يحتوي كل جيدا جزيء هدف واحد أو صفر. التضخيم ثم يحدث فقط في الآبار التي تحتوي على نسخة من الرقم المستهدف وهو مبين بإشارة فلورسنت. ويمكن حساب العدد المطلق للجزيئات المستهدفة في العينة الأصلية ثم بتحديد نسبة إيجابية لمجموع الأقسام باستخدام إحصاءات Poisson ثنائي الحد7.
وبالإضافة إلى ذلك، هذا الأسلوب دبكر يلغي الحاجة لتشغيل منحنى قياسي، ومن ثم، التحيز المرتبطة بها، والتقلبات المناخية، مما يسمح لإجراء تقييم كمي مباشر للأهداف8،9؛ فإنها تعطي نتائج أكثر دقة واستنساخه مستقل عن الملوثات وكفاءة نتيجة عن التسامح عالية لمثبطات10؛ هو أكثر حساسية وتحديداً من قبكر، وهو وسيلة موثوق بها للكشف عن هدف نادر وهكذا. وأخيراً، تقسيم العينة إلى ردود فعل متعددة يقلل من المنافسة مع جزيئات الخلفية ويحسن الحد من الكشف عن الهدف، مما يجعل من الممكن التضخيم وتيسير الكشف عن الجزيئات واحدة من جدنا/كدنا6 . الكشف والتحديد الكمي للأحماض النووية بالقائم على رقاقة دبكر قد طبق متزايد لنسخ تباين عدد والتحديد الكمي للحمض النووي وشظايا والطفرات ويحلل11،،من1213، نظراً الدقة والمواد المنخفضة إدخال شرط للأسلوب. وباﻹضافة إلى ذلك، أدمج دبكر مؤخرا في تحليل كل ميكرورناس14 والجينات النصوص5،15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a، نسخة غير مقبول من الجينات CDH1 ، قد وجد أن يتم التعبير عنها في بعض خطوط خلايا سرطان المعدة (GC)، في حين أنه غائب في مخاطية المعدة العادية. في الآونة الأخيرة، اكتشفنا CDH1a النص البديل في أنسجة الورم المجمدة الطازجة التي تم الحصول عليها من مرضى GC. كان التحقيق في التعبير عن هذا البديل في عينات الأنسجة النهج بكر (دبكر) الرقمي القائم على رقاقة المعروضة هنا. دبكر يوفر إمكانيات قياس دقيقة وقوية وحساسة للغاية للأحماض النووية، وهو يتزايد استخدام العديد من التطبيقات في مختلف المجالات. دبكر قادر على كشف الأهداف النادرة؛ وبالإضافة إلى ذلك، يوفر دبكر إمكانية مطلقة ودقة التقدير الكمي للأحماض النووية دون الحاجة إلى آلة لفرز والمنحنيات القياسية. في الواقع، فعل تقسيم يثري الهدف من الخلفية، مما يحسن كفاءة التضخيم والتسامح لمثبطات. هذه الخصائص تجعل دبكر أداة مثلى للكشف عن نسخة نادرة CDH1a .

استخدام الإجراء المعروضة هنا، نحن فحص للتعبير عن البديل نسخة نادرة CDH1a في الأنسجة المجمدة الطازجة المعدة. وأجرى التحليل دبكر على إقران 21 عينات الأنسجة العادية والسرطان وفي عينات إضافية الورم 11. CDH1a كان من الممكن اكتشاف الأورام 15 من أصل 32 (47%)، بينما أي عينات أنسجة...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

الكشف عن متغير CDH1 نسخة نادرة في الأنسجة المجمدة الطازجة سرطان المعدة ببكر الرقمية المستندة إلى شرائح

ويصف المخطوط القائم على رقاقة رقمية PCR مقايسة للكشف عن CDH1 نادرة نسخة variant (CDH1a) في العادي مجمدة طازجة وورم الأنسجة التي تم الحصول عليها من المرضى الذين يعانون من سرطان المعدة.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

وضع نموذج الإكلينيكية البشرية من أوستيوكلاستوجينيسيس من الدم المحيطية وحيدات مثقف يشترك مع خطوط خلايا سرطان الثدي

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

الكشف عن الطفرات النادرة في كتدنا باستخدام تسلسل الجيل القادم

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

مصل وبلازما نسخة الكشف رقم PCR الوقت الحقيقي باستخدام

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

تلطيخ مطاطي على الشرائح جزءا لا يتجزأ من البارافين من أنسجة سرطان المعدة pT3N0M0

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

التحليل الرقمي للتلطيخ المناعي للبروتين المتفاعل ZW10 في أنسجة الرئة البشرية

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

الكشف عن نشاط البروتياز الببتيد نيون زيموجرافي

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

تقييم مخاطر الإصابة بسرطان القولون والمستقيم وانتشاره عن طريق الكشف عن سلامة الحمض النووي البراز

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

إنشاء نماذج Xenograft المستمدة من سرطان المعدة وخطوط الخلايا الأولية

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

الكشف عن نشاط الرجعية من الخط الساخن-1S من قبل لمسافات طويلة معكوس PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

الكشف عن تطور ورم الرئة في الفئران عن طريق التصوير بالموجات فوق الصوتية

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...