Name: detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr
Uploaded: 2018-02-05T15:00:00
Description: Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Forfatterne vil gerne takke Gráinne Tierney for redaktionelle bistand.

Protokollen følger retningslinjerne i IRST menneskelige forskning etiske komité.
Bemærk: Denne procedure er specielt designet til påvisning af et lavt antal af cDNA molekyler i humane frisk frosset væv. Afsnittene væv er skåret på tøris, mens stadig frosset, fra tidligere validerede patient-afledte gastrisk tumor eller normal vævsprøver.
1. RNA isolering og oprensning
<ol><li>
RNA udvinding Bemærk: RNA isolering er udført under kø...

<ol>
	<li>van Roy, F., Berx, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+cell-cell+adhesion+molecule+E-cadherin.">The cell-cell adhesion molecule E-cadherin.</a> Cell Mol Life Sci. 65 (23), 3756-3788 (2008).</li><li>Carneiro, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=E-cadherin+dysfunction+in+gastric+cancer:+cellular+consequences,+clinical+applications+and+open+questions.">E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions.</a> FEBS Lett. 586 (18), 2981-2989 (2012).</li><li>Corso, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+mutations+and+deletions+of+the+E-cadherin+gene+predict+poor+survival+of+patients+with+gastric+cancer.">Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer.</a> J Clin Oncol. 31 (7), 868-875 (2013).</li><li>Pinheiro, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+initiation+arising+from+E-cadherin/CDH1+intron2:+a+novel+protein+isoform+that+increases+gastric+cancer+cell+invasion+and+angiogenesis.">Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis.</a> Hum Mol Genet. 21 (19), 4253-4269 (2012).</li><li>Abou Khouzam, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+identifies+changes+in+CDH1+(E-cadherin)+transcription+pattern+in+intestinal-type+gastric+cancer.">Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer.</a> Oncotarget. 8 (12), 18811-18820 (2017).</li><li>Taylor, S. C., Laperriere, G., Germain, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Droplet+Digital+PCR+versus+qPCR+for+gene+expression+analysis+with+low+abundant+targets:+from+variable+nonsense+to+publication+quality+data.">Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data.</a> Sci Rep. 7 (1), (2017).</li><li>Basu, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+Assays+Part+I:+Partitioning+statistics+and+digital+PCR.">Digital Assays Part I: Partitioning statistics and digital PCR.</a> SLAS Technol. 22 (4), 369-386 (2017).</li><li>Huggett, J. F., Whale, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+as+a+novel+technology+and+its+potential+implications+for+molecular+diagnostics.">Digital PCR as a novel technology and its potential implications for molecular diagnostics.</a> Clin Chem. 59 (12), 1691-1693 (2013).</li><li>Alikian, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RT-qPCR+and+RT-Digital+PCR:+A+comparison+of+different+platforms+for+the+evaluation+of+residual+disease+in+chronic+myeloid+leukemia.">RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia.</a> Clin Chem. 63 (2), 525-531 (2017).</li><li>Hoshino, T., Inagaki, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+quantification+of+environmental+DNA+using+microfluidics+and+digital+PCR.">Molecular quantification of environmental DNA using microfluidics and digital PCR.</a> Syst Appl Microbiol. 35 (6), 390-395 (2012).</li><li>Salvi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circulating+AR+copy+number+and+outcome+to+enzalutamide+in+docetaxel-treated+metastatic+castration-resistant+prostate+cancer.">Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer.</a> Oncotarget. 7 (25), 37839-37845 (2016).</li><li>Tessitore, M. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+newly+produced+T+and+B+lymphocytes+by+digital+PCR+in+blood+stored+dry+on+nylon+flocked+swabs.">Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs.</a> J.Transl.Med. 15 (1), (2017).</li><li>Sho, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+PCR+Improves+mutation+analysis+in+pancreas+fine+needle+aspiration+biopsy+specimens.">Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens.</a> PLoS One. 12 (1), e0170897 (2017).</li><li>Conte, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+method+to+detect+microRNAs+using+chip-based+QuantStudio+3D+digital+PCR.">Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR.</a> BMC Genomics. 16, 849 (2015).</li><li>Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+digital+PCR+for+absolute+RNA+quantification.">Evaluation of digital PCR for absolute RNA quantification.</a> PLoS One. 8 (9), e75296 (2013).</li></ol>

dPCR blev oprindeligt udviklet for DNA molekylære målinger10,11,12,13 og i gang denne teknologi blev tilpasset til kvantificering af MicroRNA og RNA udskrifter5, 14,15. I denne protokol har vi udvidet listen over programmer til at omfatte påvisning af sjældne udskrifter fremstillet af frisk frosse...

CDH1 genet koder for E-cadherin, en vigtig faktor i opretholdelsen af den normale gastrisk epitel gennem regulering af celle vedhæftning, overlevelse, spredning og migration1. Tab af E-cadherin protein som følge af skadelige kønscelleoverførsel eller somatiske forandringer af CDH1 har været forbundet med udviklingen af GC2,3. Ikke-kanoniske udskrifter som følge af intron 2 af genet har også været en hypotese for at spille en rolle i gastrisk carcinogenese4,5. Især en sådan udskrift, CDH1a, har vist sig at være udtrykt i GC cellelinjer men er fraværende fra den normale mave4. Vi har for nylig opdaget CDH1a i GC vævsprøver fra GC patienter, som bruger chip-baserede dPCR5. dPCR blev brugt til at vurdere, for første gang, tilstedeværelsen af CDH1a gen udskrift i tarm GC og normale væv.
Guld standard metoden til at bestemme genekspression er Real-Time kvantitativ PCR (qPCR). Men de resulterende data kan undertiden være variabel og af dårlig kvalitet, især når de mål i stikprøven er lavt. Denne variation kan være forårsaget af forurenende stoffer, som hæmmer polymerase aktivitet og primer udglødning, fører til ikke-specifikke forstærkning og konkurrencedygtig side reaktioner6.
Selv om de grundlæggende biokemiske principper for dPCR svarende til qPCR, dPCR viser nogle fordele, giver mulighed for meget præcise målinger af genomisk DNA (gDNA) / supplerende DNA (cDNA) molekyler. DPCR er faktisk en end-point reaktion, der bygger på en kalibreret opdeling af en prøve i tusindvis af brønde, således at hver godt indeholder nul eller et enkelt mål molekyle. Forstærkning derefter forekommer kun i de brønde, der indeholder en kopi af målet og angives med et fluorescerende signal. Det absolutte antal målmolekyler i den oprindelige prøve kan derefter beregnes ved at bestemme forholdet mellem positive til samlede partitioner ved hjælp af binomial Poisson statistik7.
Derudover dPCR teknik eliminerer behovet for at køre en standardkurve og dermed forbundet bias og variabilitet, giver mulighed for en direkte kvantificering af mål8,9; Det producerer mere nøjagtige og reproducerbare resultater uafhængigt af forurenende stoffer og effektivitet på grund af sin høje tolerance til hæmmere10; Det er mere følsom og specifik end qPCR, og er dermed en pålidelig metode til påvisning af en sjælden mål. Endelig partitionering af prøven i flere reaktioner reducerer konkurrence med baggrunden molekyler og forbedrer målet påvisningsgrænsen, muliggjort forstærkning og lette påvisning af enkelt molekyler af gDNA/cDNA6 . Påvisning og kvantificering af nukleinsyrer ved chip-baserede dPCR har anvendt i stigende grad for at kopiere nummeret variation, kvantificering af DNA fragmenter og mutation analyserer11,12,13, gives den præcision og lav materiale input kravet om metoden. Derudover har dPCR for nylig blevet integreret i analysen af begge MicroRNA14 og gen udskrifter5,15.

<table border="0" cellpadding="0" cellspacing="0" width="1127">
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">TRIazol Reagent</td>
			<td style="width:159px;">Thermo Fisher Scientific</td>
			<td style="width:344px;">15596018</td>
			<td style="width:339px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Glycogen 20 mg/ml</td>
			<td>ROCHE</td>
			<td>10901393001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RNeasy MinElute Cleanup kit</td>
			<td>QIAGEN</td>
			<td>74204</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">iScript cDNA Synthesis kit</td>
			<td>BioRad</td>
			<td>1708891</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Master Mix v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26358</td>
			<td></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;">CDH1a IDT custom designed assay</td>
			<td style="width:159px;">Integrated DNA Technologies (IDT)</td>
			<td>NA</td>
			<td style="width:339px;">F) GCTGCAGTTTCACTTTTAGTG 
			(R) ACTTTGAATCGGGTGTCGAG 
			(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/ 
			[dPCR optimized assay concentrations: 900 nM (F),&#160;&#160;&#160;&#160;&#160;&#160;&#160; 900 nM (R), 250 nM (P)]</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR 20K Chip Kit v2</td>
			<td>Thermo Fisher Scientific</td>
			<td>A26316</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Heraeus Biofuge Fresco</td>
			<td>Thermo&#160; Scientific</td>
			<td>75002402</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Thermocycler (Labcycler)</td>
			<td>Sensoquest</td>
			<td>011-103</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>N805-0200</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Dual Flat Block Sample Module</td>
			<td>Thermo Fisher Scientific</td>
			<td>4425757</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700</td>
			<td>Thermo Fisher Scientific</td>
			<td>4486414</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:344px;">4485513</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">QuantStudio 3D Digital PCR Chip Loader</td>
			<td>Thermo Fisher Scientific</td>
			<td>4482592</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:285px;">QuantStudio 3D Digital PCR Instrument with power cord</td>
			<td>Thermo Fisher Scientific</td>
			<td>4489084</td>
			<td></td>
		</tr>
	</tbody>
</table>

detection of a cdh1 rare transcript variant in fresh-frozen gastric cancer tissues by chip-based digital pcr

CDH1a, en ikke-kanoniske udskrift af CDH1 -genet er blevet fundet skal udtrykkes i nogle gastrisk kræft (GC) cellelinjer, der henviser til, at det er fraværende i normal mavens slimhinde. For nylig har opdaget vi CDH1a udskrift variant i frisk frosset tumor væv fra patienter med GC. Udtryk for denne variant i vævsprøver blev undersøgt af den chip-baserede digitale PCR (dPCR) tilgang præsenteres her. dPCR giver mulighed for en nøjagtig, robust og meget følsomme måling af nukleinsyrer og er i stigende grad udnyttet for mange programmer i forskellige felter. dPCR er i stand til at opdage sjældne mål; Desuden tilbyder dPCR muligheden for absolut og præcis kvantificering af nukleinsyrer uden behov for kalibratorer og standard kurver. Faktisk beriger den reaktion partitionering målet fra baggrunden, som forbedrer forstærkning effektivitet og tolerance over for hæmmere. Disse egenskaber gør dPCR en optimal værktøj til påvisning af CDH1a sjældne udskrift.

Ved hjælp af den procedure, der præsenteres her, tjekket vi for udtryk for den sjældne udskrift variant CDH1a i gastrisk frisk frosset væv. Analyse af dPCR blev udført på 21-parret normal og kræft vævsprøver og i 11 ekstra tumor prøver. CDH1a var påvises i 15 ud af 32 (47%) tumorer, der henviser til, at ingen normal vævsprøver viste tilstedeværelsen af denne sjældne udskrift5. I vores analyse, blev chips med mindre end 13.000 datapu...

Watch this Scientific Journal Video about Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR at JoVE.com

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Påvisning af en CDH1 sjældne udskrift Variant i frisk frosset gastrisk kræft væv af Chip-baserede digitale PCR

Manuskriptet beskrives en chip-baserede digitale PCR assay til påvisning af en sjælden CDH1 udskrift variant (CDH1a) i frisk frosset normal og tumor væv fra patienter med mavekræft.

CDH1a, a non-canonical transcript of the CDH1 gene, has been found to be expressed in some gastric cancer (GC) cell lines, whereas it is absent in normal ...

Research

JoVE Journal

Cancer Research

Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR

Development of a Human Preclinical Model of Osteoclastogenesis from Peripheral Blood Monocytes Co-cultured with Breast Cancer Cell Lines

Udvikling af en menneskelig prækliniske Model af Osteoclastogenesis fra perifert blod monocytter Co kulturperler med bryst kræft cellelinjer

The crosstalk between tumor cells and bone cells in the bone microenvironment is crucial to understanding the mechanism of bone metastasis formation. We ...

Detection of Rare Mutations in CtDNA Using Next Generation Sequencing

Påvisning af sjældne mutationer i CtDNA ved hjælp af næste Generation Sequencing

The analysis of circulating tumor DNA (ctDNA) using next-generation sequencing (NGS) has become a valuable tool for the development of clinical oncology. ...

Serum and Plasma Copy Number Detection Using Real-time PCR

Serum og Plasma kopi nummer påvisning ved hjælp af Real-time PCR

Serum and plasma cell free DNA (cfDNA) has been shown as an informative, non-invasive source of biomarkers for cancer diagnosis, prognosis, monitoring, ...

Elastic Staining on Paraffin-embedded Slides of pT3N0M0 Gastric Cancer Tissue

Elastisk farvning på paraffin-indlejrede slides af pT3N0M0 gastrisk Cancer væv

The elastic lamina, which is usually located in the sub-mesothelial layer, adjacent to the peritoneum mesothelial cells, is amphiphilic on hematoxylin and ...

Digital Analysis of Immunostaining of ZW10 Interacting Protein in Human Lung Tissues

Digital analyse af immun farvning af ZW10 interagerende protein i humant lunge væv

The purpose of this study is to introduce a methodology of the immunostaining of human lung tissues, followed by whole-slide digital scanning and image ...

Detection of Protease Activity by Fluorescent Peptide Zymography

Påvisning af Protease aktivitet af fluorescerende peptid Zymography

The purpose of this method is to measure the proteolytic activity of complex biological samples. The samples are separated by molecular weight using ...

Evaluation of Colorectal Cancer Risk and Prevalence by Stool DNA Integrity Detection

Evaluering af kolorektal cancer risiko og prævalens ved afføring DNA Integrity Detection

Nowadays, stool DNA can be isolated and analyzed by several methods. The long fragments of DNA in stool can be detected by a qPCR assay, which provides a ...

Establishment of Gastric Cancer Patient-derived Xenograft Models and Primary Cell Lines

Etablering af gastrisk Cancer patient afledte xenograft-modeller og primære cellelinjer

The use of preclinical models to advance our understanding of tumor biology and investigate the efficacy of therapeutic agents is key to cancer research. ...

Detection of Retrotransposition Activity of Hot LINE-1s by Long-Distance Inverse PCR

Påvisning af tilbagevirkende aktivitet af Hot LINE-1s ved lang distance-inverse PCR

Long interspersed nuclear elements 1 (LINE-1s) are the only family of mobile genetic elements in the human genome that can move autonomously. They do so ...

Detection of Lung Tumor Progression in Mice by Ultrasound Imaging

Påvisning af lungetumorprogression hos mus ved ultralydsscanning

With ~1.6 million victims per year, lung cancer contributes tremendously to the worldwide burden of cancer. Lung cancer is partly driven by genetic ...